Sensitivity of current laboratory methods for brucellosis diagnosis at endemic foci

Abstract

Background

Brucella is an intracellular pathogen that can infect both animals and humans. Brucellosis is one of the most important zoonotic diseases and a global public health problem.

Methods

In this study, 800 blood and serum samples were collected during 2021–2022 from suspected brucellosis patients with clinical symptoms, fever and chills, night sweats, recurrent and prolonged fever, weight loss, anorexia, and joint inflammation at medical centers in eastern and northeastern cities of Iran. The laboratory procedures were conducted between 2021 and 2023. The samples were evaluated via the culture method, Wright, 2-mercaptoethanol, Enzyme Linked Immuno Sorbent Assay, Polymerase Chain Reaction for the 16 S rRNA gene target, and real-time Polymerase Chain Reaction for the IS711 gene target diagnostic tests.

Results

Sixty-six percent of the patients were men and 34% women with 12–86 years old. The most common age group was 25–45 years. The most common clinical symptom was fever (38%), and 51.5% of the patients had a history of livestock contact.

Brucella melitensis was detected in 25 of the 44 cultured samples through culture (56.81% and 82.5% specificity). All the isolated species were Brucella melitensis. A positive Wright test was detected in 33 serum samples (75% sensitivity, 89.63% specificity), a positive 2-mercaptoethanol test was detected with 68.96% sensitivity, 88.45% specificity, and an Enzyme Linked Immuno Sorbent Assay was detected with 78% sensitivity, 91.18% specificity. Polymerase Chain Reaction targeting the 16 S rRNA gene identified 32 positive samples (72.72% sensitivity, 90.9% specificity). Real-time Polymerase Chain Reaction targeting the IS711 gene revealed 34 positive samples and the highest diagnostic value, with 77.2% sensitivity and 93% specificity.

Conclusion

The study revealed that compared with bacterial culture and serology techniques, IS711 real-time PCR is the most sensitive test. Also, selection of diagnostic tests is dependent on the acute, subacute or chronic forms of brucellosis.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12866-026-04842-x.

Introduction

Brucella is an intracellular bacterium, and Brucella numbers in samples obtained from patients are typically low. Therefore, the detection of low bacterial loads in clinical samples requires a highly sensitive diagnostic technique [1, 2]. Because brucellosis often presents with nonspecific symptoms such as fever and muscle pain, clinical examination alone cannot establish a diagnosis, which highlights the need for sensitive laboratory methods [2]. Various methods are available for diagnosing brucellosis, including bacterial culture; serological tests, such as the Wright test, 2ME, and ELISA; and more sensitive molecular techniques, such as PCR and real-time PCR. Compared with conventional PCR, real-time PCR can detect microorganisms with greater sensitivity, precision, and speed [3, 4]. These limitations of culture and serology highlight the necessity of direct pathogen detection through molecular methods such as PCR and real-time PCR. Recently, PCR and real-time PCR have been performed using primers and probes specific to the genes of this bacterium. Among these genes are bcsp31, BP26, 16SrRNA, and the random sequence IS711 [5, 6]. Molecular methods are particularly valuable when rapid confirmation is needed in patients with ambiguous clinical symptoms [6].

Each of these methods has specific advantages and limitations. In particular, serological tests may exhibit lower sensitivity in the early stages of the disease or in chronic infections, whereas molecular methods can rapidly and accurately identify the causative bacteria [7, 8]. However, a significant challenge arises from the preference for serological methods in smaller towns and rural areas of Iran, primarily owing to the lack of facilities and financial resources to establish modern and advanced laboratories. Additionally, the shortage of qualified specialists to perform more complex tests, such as cultures and molecular techniques, exacerbates these challenges in these regions. In particular, the high incidence of brucellosis in rural communities and among occupationally exposed groups such as herders and farmers in Northeast Iran underscores the importance of applying diagnostic methods with the highest possible sensitivity in these high risk cohorts, because delayed or inaccurate diagnosis in such populations not only prolongs individual suffering but also increases the risk of continued transmission to family members, livestock, and the wider community. This reliance on serology, despite its shortcomings in ambiguous clinical cases, further emphasizes the clinical imperative for molecular approaches [9, 10].

Clinical examination is not able to diagnose brucellosis without laboratory testing. Definitive diagnosis is generally performed by isolation and identification of the causal agent. This procedure is time-consuming, must be performed by highly skilled personnel, and is hazardous. Therefore, serological tests are normally preferred [11]. Brucellosis serology has advanced considerably in recent decades, with very sensitive and specific new tests. Today, the microbiological diagnosis of human brucellosis relies on three different methods, including blood culture, serology, and nucleic acid amplification tests (NAATs), such as polymerase chain reaction (PCR) and real-time PCR. Given the nonspecific nature of clinical symptoms, NAATs provide a crucial solution by directly detecting Brucella DNA, thereby overcoming the diagnostic uncertainty that serology and culture alone cannot resolve [12, 13].

Molecular methods, such as PCR and real-time PCR, offer high accuracy and sensitivity for detecting Brucella infections. Compared with conventional PCR, real-time PCR, in particular, provides superior sensitivity, specificity, and speed. These methods often use primers and probes targeting specific bacterial genes, such as bcsp31, BP26, 16 S rRNA, and the IS711 sequence. Among these, 16 S rRNA is a key target in bacterial evolution and ecology, including phylogenetic studies and bacterial detection in diagnostic samples [7, 14, 15].

The IS711 sequence, however, represents a particularly promising molecular target because it is found exclusively in the Brucella genome, provides high specificity, and has been shown to enhance sensitivity compared to other targets such as 16 S rRNA. The IS711 is an 842-bp transposon element found exclusively in the Brucella genome, consisting of incomplete inverted repeats and two overlapping open reading frames translated via a -1 frameshift. It duplicates the dinucleotide TA at the consensus target site (YTAR) and is a unique feature of the genus Brucella [16, 17]. These molecular targets strengthen the diagnostic rationale in cases where serology may fail due to ambiguous or atypical clinical presentations [17].

This study was designed to evaluate and compare the sensitivity, specificity, and clinical applicability of various diagnostic methods. Our aim is to demonstrate how these comparisons can enhance existing knowledge and contribute to improving diagnostic protocols in countries with high prevalence rates. By providing new insights, this research aims to assist physicians and researchers in making informed decisions about selecting the most appropriate diagnostic methods, especially in cases where rapid and accurate diagnosis is essential. The study compares several diagnostic techniques, including bacterial culture, serological methods (such as the Wright test, 2ME test, and ELISA), and molecular methods, including PCR targeting the 16 S rRNA gene and real-time PCR targeting the IS711 gene, to assess their effectiveness in diagnosing brucellosis. The integration of these approaches in this study addresses the gap left by previous works and strengthens the clinical rationale for molecular methods, clarifying their role alongside traditional approaches. While molecular tests are increasingly applied, les definitive and simultaneous comparison of RT-PCR targeting the highly specific the IS711 gene against conventional and serological methods has yet been performed in high-risk Iranian populations. This study was therefore designed to fill this gap and propose an integrative optimal diagnostic procedure [9, 10, 16, 17].

Materials and methods

Sample collection

After providing informed consent, 800 blood samples were collected from individuals suspected of brucellosis or exhibiting symptoms such as fever and chills, night sweats, recurrent and prolonged fever, weight loss, anorexia, joint pain, myalgia, and joint inflammation at medical centers in the eastern and northeastern cities of Iran: Mashhad (210), Quchan (140), Nishapur (120), Shirvan (80), Chenaran (70), Kashmar (60), Shandiz (50), Torqabeh (40), and Golbahar (30) during 2021–2022. Blood serum was separated by centrifugation at 2000 rpm for 10 min and used for serological tests.

Blood culture test

For Brucella isolation and identification, Brucella broth and Brucella agar (Merck, Germany) were selected for culture and specific enrichment for the growth of the bacterium. All 800 samples, including Wright-negative cases, were subjected to bacterial culture as part of the diagnostic workflow. First, 1 ml of blood samples was cultured in screw-door tubes containing Brucella broth (Merck, Germany) enriched with 5% sheep blood serum for 24 to 48 hours at 37°C. One milliliter of the medium was subsequently cultured on a plate containing Brucella agar (Merck, Germany) at 37°C for 72 hours. Then, the environments were checked and controlled in terms of bacterial growth. After streak cultivation on Brucella agar culture medium enriched with sheep blood, the positive samples were tested by other methods, including Gram staining and biochemical tests, such as oxidase, catalase, urease, movement, and hydrogen sulfur production; reactions on TSI agar media; and growth in the presence of Thionin and Fuchsin dyes. For a definitive negative culture report, the plates were incubated for four weeks to ensure that no late growth occurred. Species identification was performed by cultivating Brucella strains isolated from blood samples of patients at different dilutions of Thionin and Fuchsin. For definitive species identification, isolates were tested with monospecific antisera for B. melitensis and B. abortus. Positive agglutination confirmed the species identity [18].

Serological tests

Serological tests, including the Wright test, were used to assess the antibody profile of the patients. The Wright test with a cutoff titer of 1/80 was considered positive. This cutoff was selected based on national epidemiological guidelines and previous validation studies conducted in endemic regions of Iran, where titers ≥ 1/80 are strongly associated with active brucellosis [9, 10, 19]. The Wright antigen was purchased from Parsian Optimum Grower Company. Then, for the samples with positive Wright test, the type of antibody and the active or inactive status of the disease were determined by 2ME and ELISA. For 2ME test, serum samples were treated with 0.2 M 2-mercaptoethanol solution and incubated at 37 °C for 2 h. The reduction of IgM antibodies was assessed by comparing agglutination patterns with positive and negative controls, thereby differentiating acute from chronic infection [19]. The ELISA test was performed using the IBL kit (Germany) and read with the ELISA reader Lab System Multi Sca (Italy). The kit was standardized with Brucella-specific smooth lipopolysaccharide (sLPS) antigens for IgG and IgM detection. Cutoff values were calculated according to the manufacturer’s instructions: samples with OD index > 1.1 were considered positive, 0.9–1.1 borderline, and < 0.9 negative [13, 19]. In the first step of the reaction, diluted patient samples were incubated in the wells. In the presence of the specific IgG or IgM antibodies, they bind to the antigens. To identify the bound antibodies, a second incubation was performed using an enzyme-labeled anti-human IgG or IgM conjugate. After adding the substrate, tetramethylbenzidine/hydrogen peroxide and a stop solution (sulfuric acid), the resulting color reaction was measured photometrically at a wavelength of 490 nm. The limitations of this method include the possibility of false positives or negatives because cross-reactions or low titers in the sensitivity and specificity percentages were determined on the basis of the following formulas. Sensitivity: The ratio of the number of true positives identified by the method to the total number of true positives (true positives + false negatives). Specificity: The ratio of the number of true negatives identified by the method to the total number of true negatives (true negatives + false positives). Contingency tables were used to calculate the sensitivity and specificity criteria.

Molecular tests

Brucella DNA extraction was performed by a high-purity DNA extraction kit (Roche, Switzerland) according to the manufacturer’s instructions [lifescience.roche.com]. The primers were designed by Primer 3 online software, and the specificity of the primers was evaluated by BLAST-NCBI [https://www.ncbi.nlm.nih.gov]. The IS711 and 16S rRNA genes were selected because of their high sensitivity and specificity for identifying Brucella. The optimal primers selected for the PCR process were F: 5’- GACCTTCGGCAAATGGACAG − 3’ and R: 5’- TGGTGCTGTCAATGAGGACA-3’ for the IS711 gene; and F: 5’- GGCGGCAGGCTTAACACATG-3 and R: 5’- CTTTCCCCCGAAGGGCACATAC-3 for the 16SrRNA gene. The PCR thermal program included 10 min of initial denaturation at 95 °C, followed by 40 amplification cycles, including 15 s of denaturation at 95 °C, 1 min of annealing at 55 °C, 32 s of extension at 60 °C, and 10 min of final extension at 72°C.

The real-time PCR process for the IS711 gene was performed with the mentioned primers 10 pM, 100 mM MgCl2 and 5 µl of DNA. The specific GAPDH primers F: 5’- GAAGGTGAAGGTCGGAGTC-3’ and R: 5’- GAAGATGGTGATGGGATTTC-3’ were used for endogenous control gene. The thermal program included annealing at 95 °C for 5 min and 45 cycles of denaturation at 95 °C for 15 s, annealing at 55 °C for 30 s, and amplification at 60 °C for 60 s. Three positive controls of Purified genomic DNA of B. melitensis M13 strain was used as the positive control in PCR assays. A genomic DNA suspension was prepared in sterile distilled water and analyzed by the spectrophotometric method [7]. Serial dilutions of purified template DNA were prepared to generate a standard curve and calculate reaction efficiency. Potential limitations of this method include the possibility of sample contamination or reduced sensitivity in cases with low microbial load, and to prevent contamination in PCR experiments, we implemented strict protocols, including the use of negative controls in each run; separation of pre-PCR, PCR, and post-PCR areas; and strict aseptic techniques. Work surfaces and equipment were disinfected with 70% ethanol and 10% sodium hypochlorite, and ultraviolet radiation was used for additional sterilization. The consumables were autoclaved, and the samples were stored at low temperatures in appropriate buffers. Regular pipette maintenance and calibration ensure accuracy. These measures minimize the risk of contamination and increase the reliability of the results.

Statistical analysis

The statistical analysis of the obtained data was performed by SPSS software, version 2019 (IBM, Chicago, IL). The paired samples test was used to evaluate the differences in sensitivity and specificity between various diagnostic methods for brucellosis. Statistical significance was set at p < 0.05.

For the calculation of sensitivity and specificity of the diagnostic tests, blood culture was considered the gold standard. Culture-positive cases were defined as True Positives, and culture-negative cases as True Negatives. Given the limited sensitivity of culture, a composite reference standard (culture positivity or concordant positivity in molecular/serological assays) was also applied in secondary analyses. Comparisons of sensitivity and specificity among the diagnostic methods were performed using the Paired Samples Test.

Results

Demographic characteristics of patients

In this study, 66% of the patients were male, and 34% were female, with an average age of 33 years. The youngest patient was 12 years old, and the oldest patient was 86 years old. The age distribution of infection consisted of 25–12 years (22.7%), 25–45 years (35.5%), 45–65 years (24.6%) and > 65 years (16.7%), and the most common age group was 25–45 years, accounting for 35.8% of the total.

The most common risk factors for brucellosis were direct contact with livestock (51.5%) and the consumption of unpasteurized dairy products (48.3%), and occupational exposure, particularly among livestock herders and farmers, accounted for 29.5% of the cases. A family history of the disease was more prevalent in rural areas (29.6%) than in urban areas (23.8%). The highest incidence was observed in cities such as Mashhad, Quchan, and Kashmar. Clinically, the most frequent symptoms were fever (38%), fatigue (16%), and muscle pain (25%), with some patients presenting multiple symptoms simultaneously. Notably, 3.4% of patients had previous infections and sought treatment due to therapeutic failure.

Blood culture and species identification

From the total of 800 collected samples that were subjected to both Wright test and culture, 44 were identified as assumed Brucella-positive. Among these 44 suspected samples, 25 (56.81%) yielded positive culture results. Colonies growing on Brucella agar medium enriched with 5% sheep blood were observed as needle tip shape. This bacterium is Gram-negative coccobacillus, and the small, single and sometimes paired or short chains of bacilli as shown in Fig. 1. All the samples were positive for catalase, oxidase and urease. The sensitivity of the culture test was 56.81%, and the specificity was 82.5%. This Gram-negative coccobacillus bacterium was found to be positive for catalase, oxidase and urease.

Fig. 1.

Microscopic morphology of Brucella by Gram staining, showing Gram-negative coccobacilli appearing as single, paired, or short chains

A culture of Brucella isolated from blood samples of patients with different dilutions of Thionin and Fuchsin dyes revealed that all the isolated species were B. melitensis. Definitive species identification confirmed by Positive agglutination test using monospecific antisera for B. melitensis and B. abortus.

Serological assays

Among the 44 suspected samples collected, 33 samples (75%) had positive Wright tests. Among the 33 positive samples reported with the Wright test, 24 samples (72.72%) also had positive results in the 2ME test, which indicated the presence of IgG. In the ELISA test, IgG was detected in 22 samples (50%), and IgM was detected in 14 samples (31.81%) out of 44 investigated samples. Ten patients had only IgM. Four patients had both antibodies at the same time, which indicates acute disease in these people. Eighteen patients were only IgG positive, which indicates the subacute form of the disease. The serological tests showed different sensitivities and specificities as follows: Wright test, 75% sensitivity and 89.63% specificity; 2ME, 68.96% sensitivity and 88.45% specificity; ELISA, 78% sensitivity and 91.18% specificity.

Molecular tests

Using the molecular PCR method for the IS711 gene, 34 of the 44 examined samples (77.27%) were reported to be positive. The 16 S rRNA gene was also detected in 32 samples (72.72%). The results of PCR product electrophoresis of the IS711 and 16SrRNA genes are shown in Fig. 2. The efficiency of the real-time PCR test was 1.01, which is an acceptable value. The CT values of the 44 samples examined for the IS711 gene were between 11.80 and 29.42, and all the samples were considered positive. Lower CT values (approximately 11.80) indicate a greater bacterial load, whereas higher CT values (approximately 29.42) suggest a lower bacterial load. These findings align with the clinical patterns of brucellosis, where the bacterial load may vary depending on the stage of the disease (acute or chronic). Finally, the sensitivity and specificity of PCR for the 16 S rRNA and IS711 genes were as follows: 72.72% sensitivity and 90.9% specificity for 16 S rRNA and 77.2% sensitivity and 93% specificity for IS711. Table 1 presents the distribution of confirmed cases across different regions, based on a total of 44 positive samples (Fig. 3).

Fig. 2.

The results of PCR product electrophoresis of the amplified IS711 and 16SrRNA genes (a) The PCR product electrophoresis of the amplified IS711 gene. M, DNA Marker DM2100 100 bp DNA ladder, SMOBIO. Line 1, positive control. Line 2, negative control. Lines 3-6 positive samples. b The PCR product electrophoresis of the amplified 16SrRNA gene Lines 1-3 negative samples. Line 4, negative control. Lines 5-7 positive samples. Line 8 positive control. M, DNA Marker DM1100 50 bp DNA ladder, SMOBIO

Table 1.

The table presents the distribution of confirmed cases across different regions, based on a total of 44 positive samples. The highest number of samples was collected from Mashhad (15 samples), with Wright and IS711 tests showing the highest positivity rates (80%). In contrast, Torqabeh had the lowest number of samples (1 sample), where all tests yielded positive results. The culture method demonstrated a sensitivity range of 50%–60% in most regions, while the Real-time PCR method targeting the IS711 gene exhibited the highest sensitivity across all areas

Region	Number of samples	Positive culture (number/%)	Positive wright (number/%)	2ME positive (number/%)	ELISA IgG (number/%)	ELISA IgM (number/%)	16SrRNA positive (number/%)	IS711 positive (number/%)
Mashhad	15	8 (53.33%)	12 (80.00%)	8 (53.33%)	7 (46.67%)	4 (26.67%)	11 (73.33%)	12 (80.00%)
Quchan	8	4 (50.00%)	6 (75.00%)	5 (62.50%)	4 (50.00%)	3 (37.50%)	5 (62.50%)	6 (75.00%)
Neyshabur	6	3 (50.00%)	5 (83.33%)	4 (66.67%)	3 (50.00%)	2 (33.33%)	4 (66.67%)	5 (83.33%)
Shirvan	5	3 (60.00%)	4 (80.00%)	3 (60.00%)	2 (40.00%)	1 (20.00%)	4 (80.00%)	4 (80.00%)
Chenaran	4	2 (50.00%)	3 (75.00%)	3 (75.00%)	2 (50.00%)	1 (25.00%)	3 (75.00%)	3 (75.00%)
Kashmir	3	2 (66.67%)	2 (66.67%)	2 (66.67%)	1 (33.33%)	1 (33.33%)	2 (66.67%)	2 (66.67%)
Shandiz	2	1 (50.00%)	2 (100.00%)	2 (100.00%)	1 (50.00%)	1 (50.00%)	2 (100.00%)	2 (100.00%)
Turqaba	1	1 (100.00%)	1 (100.00%)	1 (100.00%)	1 (100.00%)	1 (100.00%)	1 (100.00%)	1 (100.00%)

Fig. 3.

Comparison of the sensitivity and specificity of different diagnostic methods for brucellosis in this study. The values presented indicate the performance of each method in identifying positive cases and its accuracy within the study population

Statistical analysis

To evaluate the differences between various diagnostic methods for brucellosis, the paired samples test was employed. In this analysis, the sensitivity and specificity of each method were compared. The results showed that, in most cases, the differences between the methods in terms of sensitivity and accuracy were statistically significant. Compared with the 2ME and culture methods, the Wright test demonstrated statistically significant differences (p < 0.001) and recorded higher values. Among the serological tests, ELISA also showed statistically significant differences (p < 0.001) and greater mean differences than the other serological tests did.

The real-time PCR method, with a mean difference of 0.305 and p < 0.001, exhibited greater sensitivity than the other methods did, and this difference was statistically significant and noteworthy. However, no statistically significant difference was observed between conventional PCR and real-time PCR (p = 0.160).

Discussion

In the current study different conventional and nucleic acid based diagnostic tests have been evaluated in brucellosis endemic foci. The results help to strengthen the routine approach to diagnosis of brucellosis in endemic foci, especially for patients with ambiguous or chronic presentations. Further, the health policy making and implementing the diagnostic approach will be affected in the endemic foci.

In this study, the culture method identified 25 of 44 cases, corresponding to a sensitivity of 56.81% and specificity of 82.5%. Among these, 23 were confirmed by other tests, while two were Wright negative and one was PCR negative. These findings reflect the inherent difficulty of isolating Brucella from paucibacillary clinical samples, requiring time consuming and hazardous procedures. Similar low yields have been reported in previous studies [13, 20]. Although culture remains the gold standard for definitive diagnosis, its low sensitivity, particularly in early stages of disease, underscores the need for complementary molecular approaches. Our culture sensitivity of 56.81% is comparable to studies reporting low diagnostic yield in endemic regions [13, 20], but slightly higher than reported results.

The serological diagnostic Wright test demonstrated satisfactory performance in Khorasan Province, with sensitivity of 75% and specificity of 89.63%. All Wright positive cases had antibodies detected by ELISA, and no Wright negative case had antibodies. Twenty-two patients were Wright + IgG+, 14 were Wright + IgM+, and four were positive for Wright, IgG, and IgM simultaneously. These results confirm the utility of Wright in endemic regions [9, 21]. However, Yang et al. (2019) reported higher sensitivity (81.8%) [22], suggesting regional prevalence and immune response variations may influence results. Our findings also revealed higher Wright sensitivity in Mashhad, a high prevalence area, consistent with stronger antibody responses [13, 23]. Conversely, in regions with lower prevalence, weaker immune responses or laboratory errors may reduce sensitivity [24]. Limitations in chronic or subacute stages emphasize the need for concurrent use with PCR or ELISA [24, 25].

The achieved ELISA results for IgG were largely consistent with 2ME, except for two cases where 2ME was positive but ELISA IgG was negative; one of these was IgM positive. In 44 samples, ELISA detected IgG in 22 (47.82%) and IgM in 14 (30.43%), with four patients positive for both antibodies, indicating acute infection. Ten patients were IgM only (chronic inactive infection), and 18 were IgG only (subacute infection). ELISA showed sensitivity of 91.78% and specificity of 87.89%, outperforming Wright (75%, 63.89%) and 2ME (68%, 88.45%). These findings align with Yang et al. (2019), who reported ELISA sensitivity above 90% [26], and with local studies by Seyed Nozadi and Vakili [27, 28]. Saadati et al. [29] reported lower sensitivity (65%), possibly due to cross reactions, differing test conditions, repeated low-dose exposures in endemic regions or Clinical heterogeneity and prior infections. Dalabsheh et al. (2020) highlighted Wright’s limitations [30]. Serology remains standard for epidemiologic monitoring, but cross reactions with gram negative bacteria (e.g., Yersinia enterocolitica O:9, Francisella tularensis, Escherichia coli O:157, Salmonella urbana, Vibrio cholerae, Stenotrophomonas maltophilia) may yield false positives, due to the O chain of smooth LPS [31].

In the study, the conventional PCR technique targeting the 16 S rRNA gene identified 32 of 44 cases, with sensitivity of 72.72% and specificity of 90.9%. Two discrepant cases were PCR positive while other tests were negative, underscoring the importance of molecular detection in ambiguous cases. These values are consistent with previous reports using 16 S rRNA and other gene targets such as the 16–23 S spacer, omp2, and bcsp31 [32–36]. PCR is easy, fast, and safe for laboratory staff, and more sensitive than culture, but less accurate than real time PCR. Our PCR sensitivity of 72.72% is broadly in line with studies using single gene targets [32–36], but slightly lower than multi target approaches that reported higher sensitivity; this difference likely reflects the use of a single genetic marker and the low bacterial load in early-stage infections.

The real time PCR test targeting IS711 identified 34 of 44 cases, with sensitivity of 77.27% and specificity of 93%, the highest diagnostic accuracy among all methods. This method detected five serology negative infections, while four cases were serology positive but IS711 negative, likely due to false positives from cross reactions [29, 37, 38]. Compared with conventional PCR, real time PCR demonstrated superior sensitivity and specificity, consistent with Zakaria et al. [39], who reported high sensitivity using TaqMan real time PCR, and with Satti et al. [40], who found ~ 70% sensitivity using BCSP31/IS711. Our higher sensitivity may reflect differences in sample size and patient populations, as our cohort included individuals from high prevalence rural areas with continuous exposure to Brucella. IS711’s exclusivity in the Brucella genome [16, 17] reinforces its role as a highly specific diagnostic marker. Of 32 molecular positive samples, 24 were culture positive and 29 Wright positive; 4 were Wright negative but PCR positive, often in continuously exposed groups such as veterinarians, livestock breeders, and farmers, consistent with Adabi [41] and Gerashabi [42].

In the epidemiological context and public health, Discrepancies between molecular and serological methods may be due to infection stage, antibody kinetics, or sample handling [43]. Moreover, culture methods demonstrated the lowest diagnostic yield in this study, reflecting the inherent difficulty of isolating Brucella from clinical samples, which are often paucibacillary and require time consuming, hazardous procedures. These shortcomings highlight the superiority of molecular approaches, particularly real time PCR targeting the IS711, which detected cases missed by serology and culture.

The procedure of sample collection or processing may affect serological results, whereas molecular methods, owing to their high sensitivity, are still able to detect the infectious agent. In addition, differences in methodology and serological methods rely on the patient’s immune response, whereas molecular methods directly detect bacterial DNA.

Brucellosis remains a major public health issue, with WHO estimating ~ 500,000 annual infections worldwide [44, 45]. Despite declining prevalence, it remains endemic in countries such as Iran [46], where nomadic lifestyles, traditional husbandry, and delayed livestock vaccination contribute to high incidence. Reported cases vary by season and region [9]. Norouzinezhad et al. [24] reported prevalence ranging from 12.07 to 25.89 per 100,000 between 2009 and 2017. Our study found 44 positives among 800 samples, reflecting the combined diagnostic yield of culture, serology, and molecular methods. The clinical picture of brucellosis is unique and easily confused with other diseases, leading to delayed diagnosis and treatment. These findings emphasize the importance of integrating multiple diagnostic approaches and preventive measures such as vaccination and health education. Ultimately, laboratory tests remain essential, but no single method is completely reliable [13].

Across all evaluated techniques, the sensitivities and specificities were as follows: RT PCR (IS711) 77.27%, 93%; PCR (16 S rRNA) 72.72%, 90.9%; ELISA 91.78%, 87.89%; Wright 75%, 89.63%; 2ME 68%, 88.45%; Rose Bengal 68.96%, 88.45%; culture 56.81%, 82.5%. Notably, 23/44 (50%) were positive across all methods. RT PCR detected cases missed by serology and culture, while serology occasionally produced false positives due to cross reactions. ELISA and IS711 RT PCR provided superior diagnostic performance and should be prioritized, particularly for early, ambiguous, or chronic cases.

As reported in other studies, combining serological and molecular methods bridges diagnostic gaps and improves accuracy, especially in high prevalence areas [22, 39–42, 47].

Overall, the findings of this study demonstrated that the real-time PCR method targeting the IS711 gene, owing to its increased sensitivity, specificity, and accuracy, could serve as a key tool for the rapid and precise diagnosis of brucellosis, especially in the early stages of the disease. These results highlight the importance of combining molecular and serological methods and emphasize the necessity of using advanced diagnostic tools tailored to the epidemiological conditions of the region. In particular, the use of real-time PCR alongside conventional methods can bridge the gap in the diagnosis of suspected or chronic cases.

Conclusion

The study findings demonstrate that while traditional serological assays such as Wright remain useful in endemic regions, the integration of ELISA with the IS711 real-time PCR significantly improves diagnostic accuracy compared to serology alone. The use of B. melitensis reference strain DNA as positive control ensured the accuracy and reliability of amplification results, thereby strengthening methodological rigor. These results highlight the importance of incorporating molecular methods, particularly the IS711 real-time PCR, into routine diagnostic protocols, especially for patients with ambiguous or chronic presentations. Looking forward, we propose that this combined diagnostic algorithm be tested as a routine approach in endemic settings, and future studies should evaluate its scalability, cost-effectiveness, and integration with rapid point-of-care testing. Such efforts will enhance early detection, reduce misdiagnosis, and ultimately strengthen public health strategies against brucellosis.

Abbreviations

16S rRNA

16S ribosomal RNA

2ME

2-Mercaptoethanol

bcsp31

31KDa Brucella cell surface protein

BP26

Brucella Periplasmic protein 26

ELISA

Enzyme-Linked Immunosorbent Assay

CT values

Cycle Threshold value, the number of cycles needed to replicate enough DNA/RNA to be detected

IS711

Insertion Sequens 711

NAATs

Nucleic Acid Amplification Test

omp2

Outer membrane protein 2

PCR

Polymerase Chain Reaction

SPSS software

Statistical Package for the Social Sciences software

WHO

World Health Organization

Authors’ contributions

**S. J.** conducted the experiments, collected the data, and drafted the initial manuscript. **M. R. R.** conceived and designed the study, analyzed and interpreted the data, and edited the manuscript. **K. G.** analyzed the experiments and collected the data. **M. S.** analyzed and interpreted the data.

Funding

No funding was received for conducting this study.

Data availability

All data analysis during this study are included in the manuscript. However, the row data is available from the corresponding author upon formal request.

Declarations

Ethics approval and consent to participate

The study was conducted in accordance with the Declaration of Helsinki and was approved by the Health Research Ethics Committee of North Tehran Islamic Azad University (reference number IR.IAU.TNB.REC.1400_096). Written informed consent was obtained from all participants prior to their inclusion in the study. Confidentiality and anonymity of participant data were strictly maintained throughout the research process.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.