Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 May 24.
Published in final edited form as: J Control Release. 2025 May 24;384:113880. doi: 10.1016/j.jconrel.2025.113880

Multi-modality imaging for precise intra-arterial delivery of mRNA, AAVs, and antibodies to the head and neck area in mice

Chengyan Chu 1, Guanda Qiao 1, Shriya Madan 1, Lucia Fadon-Padilla 1, Jinghui Wang 1, Abdallah Salemdawod 1, Shalini Sharma 1, David Gulisashvili 1, Lorissa McDougall 1, Yajie Liang 1, Miroslaw Janowski 1, Piotr Walczak 1,*
PMCID: PMC13197855  NIHMSID: NIHMS2176753  PMID: 40418990

Abstract

The intra-arterial (IA) route offers several advantages over systemic infusion for drug administration, enabling selective delivery to target organs, achieving higher local drug concentrations, and minimizing off-target toxicity. However, its clinical adoption remains limited, with only a few IA-based therapies routinely used in patients. While IA chemotherapy for head and neck cancer has been explored, results remain conflicting. With the rapid rise of biologics, we investigated the efficacy of IA delivery for three key classes—mRNA, adeno-associated viruses (AAVs), and monoclonal antibodies—targeting the head and neck region in mice. We infused firefly luciferase-encoding mRNA (Luc mRNA), adeno-associated virus encoding luciferase (AAV9-Luc), and radiolabeled anti-VEGF monoclonal antibody (bevacizumab) via the external carotid artery and compared results with IV administration. Bioluminescence imaging revealed robust expression of Luc mRNA and AAV9-Luc in the head and neck region following IA infusion, with negligible expression after IV delivery. qPCR analysis further confirmed significantly higher Luc mRNA expression in targeted tissues (salivary gland, temporal muscle, and tongue) following IA administration. In contrast, after IV administration, Luc mRNA expression was detected only in the salivary gland at a level 100-fold lower, with no detectable expression in the temporal muscle or tongue. For quantitative assessment of antibody biodistribution, we radiolabeled bevacizumab with Zirconium-89 (89Zr) and performed positron emission tomography (PET) imaging following IA vs. IV infusion. PET imaging revealed significantly increased uptake of bevacizumab in the neck following IA delivery (mean standardized uptake values: 0.65 vs. 0.29, IA vs. IV), corroborated by ex vivo biodistribution analysis, which confirmed higher accumulation of bevacizumab in targeted structures of the head and neck. In summary, our findings demonstrate the feasibility and superiority of the IA route for the delivery of biologics to the head and neck territory. This study provides compelling evidence supporting the translational potential of IA administration as a highly effective strategy for precise biologic delivery in head and neck disorders and cancers.

Keywords: Intra-arterial, Head and neck, MRI, mRNA, AAV, Monoclonal antibody

1. Introduction

Head and neck cancer (HNC) encompasses a group of malignancies arising from the oral cavity, larynx, pharynx, nasal cavity, paranasal sinuses, and salivary glands. It remains one of the most prevalent cancers worldwide, with approximately 900,000 new cases and over 400,000 deaths annually [1]. The current standard of care (SOC) for advanced HNC includes high-dose radiation with concomitant intravenous cisplatin chemotherapy, which has improved survival with some tumor control. However, its efficacy is often compromised by severe adverse effects, including dysphagia, mucositis, functional impairments in speech and hearing [2]. More importantly, these debilitating side effects significantly diminish patient’s quality of life and contribute to higher suicide rate among the HNC population. It has been reported that the suicide risk for HNC patients is double that of patients with other cancers and about 4 times that of the general population [3]. These challenges underscore the urgent need for new precision therapeutic approaches that effectively reach cancer while minimizing off-target effects.

Intra-arterial (IA) delivery holds the potential to enhance treatment efficacity while reducing off-target exposure for cells [4] and drugs [5,6]. This approach exploits the first-pass effect, achieving higher local drug concentrations at the tumor site. The head and neck region receives blood supply primarily from branches of the external carotid artery (ECA), which are easily accessible for selective catheterization, allowing precise locoregional drug delivery [7]. HNC is particularly well-suited for IA therapy since tumors typically remain localized, with metastases largely confined to regional lymph nodes in advanced stages [7,8]. Indeed, IA chemotherapy for HNC has been explored for decades, with cisplatin IA infusion demonstrating higher drug uptake and increased cisplatin adduct formation in tumors compared to IV infusion [9]. Recent clinical trials have shown promising outcomes with IA chemotherapy, but results have been variable [2,10–14]. A multicenter, randomized phase 3 trial comparing IA and IV chemoradiation in advanced oral squamous cell carcinoma found that while IA therapy yielded positive results, it did not significantly outperform IV chemoradiation regarding locoregional control and survival. However, systemic side effects were notably lower for IA treatment [15].These mixed clinical findings warrant further exploration of IA-based strategies for HNC treatment, particularly with rapid advancement of novel biologic therapies. For instance, mRNA-based therapeutics, viral vector-based therapeutics and novel monoclonal antibodies represent three distinct and clinically relevant classes of biologics with growing therapeutic interest in head and neck diseases. These agents also differ in molecular size and pharmacokinetics, allowing for exploring the broad applicability of IA delivery across diverse platforms.

Despite its clinical potential, IA drug delivery to the head and neck region remains largely unexplored in animal models. This is likely due to the lack of techniques for accessing the head and neck arteries in small animals. Our previous studies have demonstrated the value of MRI-guided IA infusion in targeting the brain across multiple species [16–18], as well as the superiority of IA administration in delivering therapeutic agents, including antibodies and stem cells [5,6,19,20]. This experience provides a foundation for adapting IA-based approaches to the head and neck region.

In this study, we established a murine model of IA drug delivery to the head and neck region using surgical cannulation of the ECA. Real-time MRI was employed to visualize perfusion area following IA infusion of gadolinium contrast agent, precisely demarcating the territory perfused via IA catheter including tongue or jaw muscles. We then assessed the targeting efficiency of key classes of biologic therapeutics via IA vs. IV administration: mRNA encoding firefly luciferase (Luc-mRNA), adeno-associated virus also encoding luciferase (AAV9-Luc), and monoclonal antibody anti-VEGF bevacizumab. Bioluminescence imaging (BLI) demonstrated robust Luc-mRNA and AAV9-Luc expression in the head and neck region after IA delivery, with no detectable signal after IV injection. RT-qPCR analysis confirmed significantly higher Luc-mRNA expression in targeted tissues following IA delivery compared to IV. For quantitative assessment of bevacizumab distribution, we radiolabeled the antibody with zirconium-89 (89Zr-bevacizumab) and performed PET/CT imaging. PET/CT imaging revealed a significantly higher uptake of 89Zr-bevacizumab in the head and neck following IA infusion, as compared to IV administration. Ex vivo biodistribution analysis further confirmed a higher accumulation of bevacizumab in targeted tissues after IA delivery. Taken together, this study successfully established an IA-based technique for precise drug delivery to the head and neck region under MRI guidance. Our findings demonstrate clear superiority of IA administration of mRNA, AAV, and monoclonal antibody-based therapies. Given the emerging landscape of novel biologic therapeutics, these results provide a strong foundation for future translational studies aimed at enhancing targeted drug delivery for head and neck cancer and other diseases.

2. Materials and methods

2.1. Cell culture and Luc-mRNA transfection in vitro

HEK 293 cells (American Type Culture Collection) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher Scientific) containing 10 % fetal bovine serum (FBS, Gibco) and 1 % penicillin/streptomycin (Sigma). 5 × 104 cells/well in a 24-well plate were seeded 24 h prior to transfection. Luc-mRNA (CleanCap FLuc mRNA 5moU, TriLink BioTechnologies) was encapsulated with Lipofectamine 2000 reagent (Thermo Fisher Scientific) according to the manufacturer’s recommendation. Briefly, 1 μl Lipofectamine 2000 was diluted in 49 μl Opti-MEM medium and incubated for 5 min at room temperature. 0.5 μg Luc-mRNA in 50 μl Opti-MEM medium was then added into the diluted Lipofectamine 2000 and incubated for 20 min. Subsequently, the mRNA-lipofectamine complex in a total of 100 μl was added to the well. 1 μl Lipofectamine 2000 in 99 μl Opti-MEM medium was added to the control well. 4 h after incubation, transfection solution was replaced by fresh medium. The luciferase expression of transfected cells was measured 24 h later using Xenogen IVIS optical imaging system and Living Image software (Perkin Elmer).

2.2. Animals and surgery

All procedures were performed in accordance with guidelines for the care and use of laboratory animals and were approved by the Animal Care and Use Committee at the University of Maryland, Baltimore. Male C57BL/6 mice (10–12 weeks old, 20–25 g, Jackson Laboratory) were used in this study. For intramuscular (i.m.) injections in mice (n = 3) to validate the transfection in vivo, Luc-mRNA formulations complexed with Lipofectamine 2000 in OptiMEM medium were injected into the femur skeletal muscle (1.5 μg/left side, 3.0 μg/right side). Endovascular catheterization on mice was performed to secure access to the external carotid artery (ECA) as follows. Anesthesia was induced with 5 % isoflurane and maintained with 1.5–2 % isoflurane during surgery. The common carotid artery (CCA) bifurcation was exposed using blunt dissection. The internal carotid artery (ICA) was temporarily ligated with a 4–0 silk suture to route the flow into ECA. A temporary tie was placed on the ECA, and the proximal CCA was permanently ligated using a 4–0 suture. A small arteriotomy was made in the CCA, and a microcatheter (PE-8–100, SAI Infusion Technologies) flushed with 2 % heparin (1000 units/ ml, heparin sodium, Upjohn) was inserted via the arteriotomy. The catheter was secured by two purse-string suture ties around CCA and used for the subsequent infusion of agents. The overall experimental design is schematically represented in Fig. 1.

Fig. 1.

Fig. 1.

The experimental outline.

2.3. Interventional MRI

The mice with IA catheter secured in place were positioned in a Bruker 9.4 T MRI scanner. Baseline T2 (TR/TE = 2500/33 ms) and T1 (TR/TE 1500/7.5 ms)-weighted images of the head and neck were acquired. The microcatheter was connected to a syringe mounted on an MRI-compatible programmable syringe pump (PHD 2000, Harvard Apparatus Inc.) for controlled solution administration. Gadolinium (Gd; Gadavist®) dissolved in saline at 1:100 was infused intra-arterially at the rate of 0.3 ml/min under dynamic T1-weighted imaging (TR/TE 200/5.2 ms, field of view (FOV) = 15 × 15 mm, matrix = 128 × 64, acquisition time = 240 s and 50 repetitions) for visualization of perfusion territory. T1 was repeated after Gd infusion. The intensity of MR images was calculated with Image J. The Color-coded scale for mapping the signal intensity resulting from the transient Gd inflow was generated by Horos version 3.3.6.

2.4. Bioluminescence imaging

Mice (C57BL/6, 10–12 weeks old) received IA (n = 4) or intravenous (IV, n = 4) injection of Luc-mRNA (1.5 μg) complexed with Lipofectamine 2000 in OptiMEM medium, in a total of 300 μl at the rate of 300 μl/min. Another cohort of mice was subjected to IA (n = 4) or IV (n = 4) administration of 300 μl of the AAV9-CAG-Luc-T2A (1.0 × 1012 VG/ml, SignaGen Laboratories) over 1 min. Bioluminescence imaging (BLI) was used to monitor the expression of infused Luc-mRNA and AAV9-Luc. Briefly, animals were anesthetized using 2 % isoflurane and intraperitoneally injected at 150 mg/kg body weight. Images were acquired every 5 min post-injection until the bioluminescence signal reached the peak. For quantitative analysis of BLI, images were quantified by drawing regions of interest (ROIs). The data were presented as photon flux (P/s) and plotted using GraphPad Prism 8.

2.5. RT-qPCR

Mice (C57BL/6, 10–12 weeks old) were randomly divided into two groups: IA Luc mRNA (n = 4); IV Luc mRNA (n = 4). The preparation and injection parameters of the Luc-mRNA solution are the same as described above. 12 h after injection, animals were sacrificed with an overdose of isoflurane. The ipsilateral organs in the head and neck region were isolated immediately including salivary, tongue and jaw muscle. The samples were kept in RNAlater solution (Thermo Scientific) at 4 °C overnight. Trizol (Invitrogen) was then used to extract the total RNA from the samples, which were reversely transcribed into cDNA using the RevertAid First Strand cDNA Synthesis kit (Thermo Scientific). RT-qPCR was performed using the StepOnePlus™ Real-Time PCR System. The primer sequences are listed in Table 1. This experiment was performed in triplicate, and the mRNA expression was represented using the 2−ΔΔCt method and normalized to GAPDH as a control.

Table 1.

List of primer sequences used for RT-qPCR.

Gene name Forward Reverse
Luc TTCGGCAACCAGATCATCCC GAACCGGTACATCAGCACCA
GAPDH TGACCTCAACTACATGGTCTACA CTTCCCATTCTCGGCCTTG

2.6. Radiolabeling of bevacizumab

89Zr-labeled bevacizumab was prepared as previously described. Briefly, 1 mCi of 89ZrC4O8 was mixed with 20 μl of 1 M oxalic acid and 25 μl of 2 M Na2CO3. After 3 min, 200 μl of HEPES containing 1 mg of bevacizumab-deferoxamine conjugate was added. The pH of the solution was then adjusted to 7 using 2 M Na2CO3, and the mixture was incubated at room temperature for 45 min. The 89Zr-bevacizumab was purified using a Zeba™ Spin Desalting Column (7 kDa MWCO) that had been pre-equilibrated with sterile PBS. The resulting 89Zr-bevacizumab achieved approximately 99 % radiochemical purity and a specific activity of 60 MBq/mg. The prepared 89Zr-bevacizumab was used immediately for in vivo injections.

2.7. PET/CT imaging

Two experimental groups were designated for evaluating 89Zr-bevacizumab biodistribution in the head and neck (n = 4/each). Group 1: IV infusion of 89Zr-bevacizumab; Group 2: IA infusion of 89Zr-bevacizumab. 0.1 mg 89Zr-bevacizumab was reconstituted with 300 μl of sterile saline for injection per animal. Upon completion of infusion, the animal was transferred to a PET/CT scanner immediately. PET imaging was performed for 10 min on a preclinical micro-PET/CT scanner (Siemens Inveon). For anatomic co-registration, CT scan was conducted followed by PET scan. For analysis of PET/CT images, OSEM3D/SP-MAP reconstruction algorithm was used to reconstruct the PET/CT data. Standardized uptake values (SUV) were determined using the Fiji ImageJ with a PET/CT plugin. The presented PET/CT images and whole-body 3D reconstructions were created using Amira 3D version 2022.2 (ThermoScientific).

2.8. Ex Vivo biodistribution of 89Zr-bevacizumab

The mice were sacrificed immediately after the PET/CT scan. Tissues in head neck including bilateral salivary, jaw muscle and tongue were harvested and the tongue was further divided into left/right side. Each sample was weighed, and the radioactivity was measured using CRC®−55tR Dose Calibrator and Well Counter (Mirion Technologies). The 89Zr-bevacizumab uptake in the sample was calculated as: percent of injected dose per gram of organ (%ID/g) = (radioactivity in each organ / total injected radioactivity in each animal) × 100 % / the organ’s weight. To calculate the total injected radioactivity, the radioactivity of the syringe and catheter post-injection was subtracted from the initial radioactivity in the syringe prior to injection.

2.9. Statistical analysis

Data is expressed as mean ± SD unless otherwise specified. Gd-enhancement for each mouse was analyzed using a paired t-test. Quantitation of BLI signal and qPCR, Ex vivo biodistribution, and PET-based SUV were analyzed using a student’s unpaired t-test. A P-value < 0.05 was considered significant. GraphPad Prism 8.0 was used to perform statistical analysis and create graphs.

3. Results

3.1. MRI-guided IA drug delivery for precision targeting of the head and neck

To visualize anatomical structures in the head and neck region, we first acquired a T2-weighted (T2w) MRI, which clearly delineated main muscle groups, including the tongue, masseter, and medial pterygoid muscles (Fig. 2a). To assess regional perfusion, we administered gadolinium (Gd) contrast agent via IA infusion. This enabled real-time visualization of the perfused territory on T1-weighted (T1w) MRI, where hyperintense regions corresponded to areas of active contrast flow. The spatiotemporal distribution of the IA flow was dynamically sampled at a temporal resolution of 3 images per second, allowing precise real-time monitoring of perfusion patterns. We initially set the transcatheter Gd infusion rate at 0.1 ml/min, which produced only a marginal T1 signal increase in the head and neck area. The infusion rate was then gradually increased in 0.1 ml/min increments until the contrast enhancement was observed on real-time MRI, with 0.3 ml/min determined as the optimal rate for consistent and reproducible perfusion (Fig. 2b). Quantitative analysis of dynamic signal changes in the bilateral tongue and masseter muscles showed a steep rise of signal intensity in the ipsilateral perfused region (ROI1 and ROI3), while the contralateral side (ROI2 and ROI 4) remained unchanged (Fig. 2c, d). Perfusion maps using color-coded scale overlays further highlight the localized distribution of IA-delivered contrast (Fig. 2e). High-resolution T1w MRI confirmed sustained contrast enhancement in the ipsilateral area following IA infusion (Fig. 2f, g). With the assumption that Gd is a surrogate marker for small molecule drugs, these findings indicate that IA delivery achieved selective regional uptake in the head and neck. Overall, our results confirm that the real-time MRI guided-IA route enables precise, region-specific delivery to the head and neck, providing a powerful strategy for targeted therapeutic administration.

Fig. 2.

Fig. 2.

Real-time MRI visualization of perfusion in the head and neck region. (a) T2w MRI (horizontal projection) depicting anatomical structures in the head and neck of a mouse. (b) Representative T1w dynamic contrast-enhanced (DCE) images before (0 s) and 40 s after infusion of Gd at the rate of 0.3 ml/min. Dynamic signal changes in the bilateral tongue (c) and masseter (d) for the four ROIs marked in (b). “Start” indicates the beginning of IA Gd infusion, and “Stop” indicates the end of infusion. (e) Color-coded perfusion maps illustrating signal intensity changes resulting from Gd inflow. (f) Pre-and post-infusion T1w images demonstrating sustained contrast enhancement. (g) Quantifying signal intensity differences between the ipisi- and contralateral tissues (tongue and masseter). n = 3, **P < 0.01.

3.2. Testing in vitro and in vivo transfection efficiency of Luc mRNA

Our selection of mRNA for these tests was driven by the growing excitement surrounding mRNA-based drugs, which have emerged as promising candidates for combating various diseases, including infectious diseases and cancers. To enable easy detection of transgene expression, we used Luc mRNA as a surrogate therapeutic agent and first assessed transfection efficiency using lipofectamine prior to proceeding with IA infusion experiments. In vitro transfection of HEK 293T cells with Luc mRNA resulted in a detectable bioluminescence signal 24 h post-transfection (Fig. 3a), quantified in (Fig. 3b). To test the feasibility of in vivo transfection, Luc mRNA was administered via intramuscular (i.m.) injection, resulting in visible BLI signal in the legs (Fig. 3c). Additionally, higher mRNA doses (2.5 μg) led to enhanced Luc expression, as evidenced by a stronger BLI signal (Fig. 3d). Taken together, these results reveal that lipofectamine-based Luc mRNA transfection is feasible both in vitro and in vivo, establishing a strong foundation for subsequent IA infusion studies.

Fig. 3.

Fig. 3.

Transfection of Luc-mRNA using Lipofectamine. (a) BLI images of HEK 293T with and without Luc mRNA transfection. (b) Quantification of BLI signal for each group. (c) Representative BLI image of i.m. injected mouse 24 h postinjection of Luc-mRNA (right side: 2.5 μg, left side: 1.25 μg). (d) Quantification of BLI signal in left and right legs. n = 3, **P < 0.01.

3.3. IA delivery achieves localized Luc mRNA expression in the head and neck area

After validation of the transfection protocol, Luc mRNA was infused via the external carotid artery (ECA) to examine whether IA administration could achieve regional expression in the head and neck. BLI detected Luciferase expression as early as 6 h post-injection in mice that received IA administration, whereas no detectable signal was observed following IV injection (Fig. 4a). Quantitative BLI analysis revealed that Luc expression peaked at 12 h post-injection and gradually declined over the next 72 h (Fig. 4b). To further quantify Luc mRNA, RT-qPCR was performed 12 h post-injection on head and neck tissues, including the salivary glands, tongue and jaw muscles. IA-delivered Luc mRNA exhibited remarkably higher levels in all examined tissues (Fig. 4c), strongly corroborating the BLI findings. In contrast, Luc mRNA was undetectable (assigned as 0) in the jaw muscle and tongue after IV injection, with only minimal levels (100 folds less than IA delivery) detected in the salivary glands (Fig. 4c). These results reveal that IA administration enables localized and concentrated expression of Luc mRNA in the head and neck, highlighting its superiority over systemic (IV) delivery for targeted gene therapy applications.

Fig. 4.

Fig. 4.

IA delivery of Luc mRNA to head and neck. (a) Representative BLI images of mice received IV and IA administration of Luc mRNA at different timepoints post injection. (b) Quantification of BLI signal change over 144 h. (c) RT-qPCR analysis of Luc mRNA in the organs located in head and neck 12 h post injection. n = 4, **P < 0.01.

3.4. IA delivery enables sustained and localized AAV9-Luc expression in the head and neck

AAV-mediated gene therapy has emerged as a groundbreaking approach for a wide range of conditions. However, current gene delivery methods, such as intravenous administration, require high viral doses and are plagued by inadequate spatial containment, raising concerns about off-target effects and reduced therapeutic efficacy. To assess whether IA administration can overcome these limitations, we directly compared IA vs. IV delivery of AAV9-Luc to the head and neck. BLI showed that IA delivery of AAV9-Luc led to robust and localized transgene expression in the head and neck as early as one-day post-administration, with the signal persisting throughout the 14-day follow-up period (Fig. 5a). In contrast, no detectable BLI signal was observed in the head and neck region following IV administration (Fig. 5a). Quantitative analysis of BLI signal confirmed that Luc expression was stable over time, demonstrating the long-term transgene expression achieved via IA administration (Fig. 5b). These findings highlight the superiority of IA delivery in achieving regionally precise localization of AAVs, offering a highly effective strategy for sustained transgene expression in the targeted tissues while minimizing systemic exposure.

Fig. 5.

Fig. 5.

In vivo monitor of IV and IA delivered AAV9-Luc. (a) Representative BLI images of mice received AAV9-Luc at indicated time points. (b) Quantification of BLI signal over head and neck for each group. n = 4, **P < 0.01.

3.5. IA delivery enhances the uptake of monoclonal antibody-bevacizumab in the head and neck

Antibodies have become cornerstones of modern therapeutics, particularly in oncology immunotherapy. To assess the impact of IA administration on the uptake of large-sized biologics, we investigated the delivery of bevacizumab, a monoclonal antibody targeting VEGF. Bevacizumab was radiolabeled with 89Zr, to enable non-invasive visualization of its in vivo spatial biodistribution using PET imaging. PET imaging revealed a high radioactivity signal in the neck region following IA delivery of 89Zr-bevacizumab (Fig. 6a), whereas IV injection resulted in negligible signal intensity (Fig. 6b). Quantitative analysis of standardized uptake values (SUVmean and SUVmax) confirmed a markedly higher accumulation of bevacizumab the head and neck following IA administration compared to IV (SUVmean 0.29 ± 0.11 vs. 0.65 ± 0.12, SUVmean 0.46 ± 0.08 vs. 0.88 ± 0.21) (Fig. 6c). These results demonstrate that IA delivery significantly enhances local monoclonal antibody accumulation, offering a superior alternative to IV administration for targeted therapy.

Fig. 6.

Fig. 6.

PET/CT imaging after 89Zr-bevacizumab injection, IV vs. IA. (a–b) Representative PET/CT images of 89Zr-bevacizumab in axial, sagittal, coronal views and whole-body 3D reconstruction. (c) Quantifications of SUVmean and SUVmax in the ipsilateral neck. n = 4, **P < 0.01.

3.6. Ex vivo biodistribution confirms enhanced regional uptake of bevacizumab via IA delivery

To validate the PET/CT imaging observations, we performed an ex vivo biodistribution assay to quantitatively assess 89Zr-bevacizumab uptake in the neck region following IA vs. IV administration. As expected, IA delivery resulted in significantly higher antibody accumulation in the ipsilateral salivary, jaw and tongue, with uptake values of 15.75 ± 4.77 ID%/g, 7.14 ± 1.64 ID%/g and 8.26 ± 1.36 ID%/g, respectively, versus 3.09 ± 0.63 ID%/g, 6.27 ± 1.54 ID%/g, 4.46 ± 1.35 ID%/g and 3.20 ± 1.06 ID%/g in IV group (Fig. 7a). We also calculated the ipsi−/contralateral ratios of 89Zr-bevacizumab uptake in these tissues. In the IV group the ratios were close to 1, indicating comparable uptake in both sides. In contrast, the IA group exhibited significantly higher ipsilateral uptake (~1.5 fold increase), reinforcing the targeting advantage of IA administration (Fig. 7b). These ex vivo findings corroborate imaging data, providing additional quantitative confirmation that IA delivery significantly enhances localized drug accumulation making it superior strategy for targeted monoclonal antibody therapy.

Fig. 7.

Fig. 7.

Ex biodistribution of 89Zr radioactivity in the neck and head. (a) Quantification of 89Zr-bevacizumab between IA and IV administration in the ipsilateral organs of head and neck. (b) The ipsi−/contralateral ratio (fold) in each organ ratio between IA and IV administration. n = 4, *P < 0.05, **P < 0.01.

4. Discussion

Our previous studies have succeeded in leveraging MRI-guided IA delivery for precisely targeting the brain and robustly enhancing the drug accumulation both in preclinical and clinical settings in a brain tumor patient [16–18,21]. Such image-guided delivery methodology provides a promising approach for developing effective noninvasive treatment of neurological diseases. Meanwhile, the encouraging findings have revived an interest in extending image-guide IA drug delivery to other areas. Head and neck diseases are the ideal candidates for IA treatment as the feeding vessels in these areas can be easily and precisely accessed, allowing for targeted and efficient delivery of therapeutic agents. Thus, the present study adapted the methodology to head and neck using mice and successfully targeted the area, including tongue and jaw muscle, via the ECA under real-time MRI guidance. We also observed that the Gd contrast (604.71 g/mol) used for visualization remained in the perfused area after injection, indicating that IA delivery facilitated the uptake of small-sized molecules in the head and neck region. Interestingly, a recent clinical study reported by Shintaro et al. [22], demonstrated the Gd-enhanced MRI could be used to determine the optimal dose of IA-delivered chemotherapeutics in the tumor, further fueling the unique value of MRI incorporation in the treatment of HCN.

mRNA is a type of single-stranded ribonucleic acid transcribed from a DNA strand. It carries the genetic instructions for protein synthesis, which are then translated and processed to form functional proteins [23]. mRNA-based therapy can theoretically encode any therapeutic protein/peptide upon successfully transfecting the cells with mRNA in vitro or in vivo [24]. Compared to other functional biomolecules such as DNA, mRNA can be rapidly and easily designed, and the therapeutics it produces mediate transient activity in a dose-dependent manner [25]. Additionally, mRNA transcripts feature relatively high transfection efficiency and low toxicity since their translocation into the nucleus is not required [26]. The vast therapeutic potential of mRNA was not realized until multiple mRNA-based vaccines for SARS-CoV-2 were practically used in humans were during the COVID-19 pandemic in the past years [27]. To date, mRNA-based therapies have gained rapid advancement, presenting a promising and versatile approach for new vaccine development, cancer immunotherapies, and more [25,28,29]. However, several challenges remain to be addressed before mRNA can be translated as a general therapeutic modality. The major one is ensuring the efficient in vivo delivery of mRNA to the target region. Naked mRNA is susceptible to degradation by the abundance of RNases in vivo [30]. Additionally, the large size, negative charge, and hydrophilic properties of mRNA hinder its ability to cross cell membranes. Lipid nanoparticle (LNP) encapsulation is a widely used system for mRNA delivery, which can protect the mRNA and aid in their transfection into cells [26]. However, the majority of LNPs have inherent liver tropism, greatly restricting their use in other tissues [25,26]. The current effort focuses on engineering the LNP for targeted delivery of mRNA. Yet, it will still require a high dose of LNP-mRNA to achieve adequate concentration if administrated systemically. The IA route may offer a cost-effective method for the targeted delivery of mRNA. Thus, in this study, we first optimized the mRNA transfection protocol using Lipofectamine 2000, a widely used commercially available lipid-based transfection reagent [31]. The high transfection efficiency and high level of transgene expression of Lipofectamine 2000 have been well demonstrated in a range of mammalian cell types in vitro, but less explored for in vivo transfection. Consequently, the feasibility of the Lipofectamine 2000-based Luc-mRNA transfection protocol was validated both in vitro using HEK cells and in vivo via intramuscular injection. Using this protocol and the model we established; we observed a regional Luc expression in the head and neck after IA delivery. The dynamic expression of Luc was also profiled, which started at 6 h post-injection, consistent with a previous report when the signal could be detected [25]. The signal reached the peak at 12 h and gradually decreased afterward until no signal was observed at 72 h, indicating the completed degradation of Luc-mRNA. A negligible signal was found over the head and neck after IV administration across the 6-day period. The qPCR analysis provided more intuitive evidence by measuring the level of administrated Luc mRNA in the head and neck region. In consistent with BLI observations, qPCR results revealed that Luc mRNA was undetectable in the organs located in head and neck except a limited expression in salivary glands, probably due to their feature as an immune organ. Meanwhile, remarkable levels of Luc mRNA were determined in all organs, including the salivary gland, jaw muscle, and tongue, following IA delivery. Thus, our study shows that the IA route enables targeted and efficient delivery of mRNA to the neck and head region, potentially broadening the application of mRNA-based therapies to head and neck conditions and beyond.

Unlike non-viral gene transfer, such as the emerging mRNA-based therapy, viral-based gene therapies have been studied for decades. Small, nonpathogenic viruses are widely used as vectors to deliver therapeutic genes into cells. Among them, AAV vectors are preferably employed for the majority of gene therapy applications, including clinical trials, due to their high gene delivery efficacy, lack of pathogenicity, and relatively safe profile [32]. Successful transduction of AAV-mediated transgene can result in long-lasting therapeutic gene expression without integrating into the host genome. Currently, AAV-based gene therapy has expanded from treating genetic disorders to addressing a wide range of diseases. For instance, AAV-mediated cancer gene therapy has successfully transported therapeutic payloads to cancer cells, such as suicide genes, anti-angiogenic genes, and immunostimulatory genes, to inhibit tumor initiation, growth, and metastasis [33,34]. In the context of HCN, clinical trials have shown encouraging outcomes from gene therapy in combination with other treatment modalities, indicating its promise in HCN treatment. Interestingly, we found that the viral vectors were typically injected intratumorally across the trials [35,36]. This administration can directly target the tumor and yield immediate effects, but on the other hand, it greatly compromised the therapeutic efficacy as the majority of vectors were restricted regionally in the tumor. Additionally, the local injection limited the application of gene therapy for metastatic HCN if delivered intratumorally [35]. Systemic administration can achieve widespread patterns but requires a high-dose virus due to their broad tissue tropism and the neutralizing antibodies in the bloodstream. It magnificently raises safety concerns about potential off-target effects such as hepatotoxicity [37]. Apparently, the lack of an optimal administration strategy has become a major obstacle to the breakthrough of gene therapy. IA route represents a promising alternative to overcome the challenges of gene therapy, allowing for direct injection to the target tissue, such as the entire tumor. Moreover, IA delivery requires a relatively low dose of the virus as they are not exposed to pre-existing neutralizing antibodies from the vascular system, thereby significantly reducing the risk of liver toxicity. Thus, we further exploited the model to test the targeting efficiency of IA-delivered AAV vectors, in which Luc was used as the transgene for in vivo monitoring. We found that IA administration achieved regionally precise localization of AAVs in the head and neck, providing maximum treatment concentration as compared to IV delivery. Therefore, our findings provide a proof-of-concept for improving the efficacy, specificity, and safety of endovascular AAV-mediated gene therapy delivery.

Monoclonal antibodies represent a source of therapeutic agents and have emerged as a widely accepted immunotherapy for tumors and many other disorders. Cetuximab, an anti-epidermal growth factor receptor monoclonal antibody, has shown favorable outcomes in HCN treatment when added to radical radiotherapy, improving locoregional control, overall survival, and progression-free survival compared to radiation alone [38–40]. More recently, a phase III randomized trial reported that monoclonal antibody pembrolizumab targeting programmed cell death protein 1 (PD-1) yielded survival benefit versus cetuximab in recurrent/metastatic HCN [41]. Although monoclonal antibodies-based therapy has been showcased as a promising anti-tumor strategy, there are still some challenges and much room for improvement in clinical outcomes. One of them is safety concern; clinical trials have shown severe adverse effects after systemic administration of monoclonal antibodies such as cetuximab [42]. Other antibodies, including pembrolizumab, exhibited slight adverse effects, but the escalation of the doses remains cautious due to the potential risk. As thus, the concentration of monoclonal antibodies in the tumor region might be inadequate, contributing to a limited therapeutic efficacy. Therefore, our study further explored the potential benefit of the IA route in enhancing the local accumulation of monoclonal antibodies in the head and neck. Bevacizumab, a monoclonal antibody capable of inhibiting tumor-mediated angiogenesis by targeting vascular endothelial growth factor, was then investigated for the following reasons. First, clinical trials have confirmed the encouraging efficacy of bevacizumab, providing a promising option in HCN treatment [43–46]. Secondly, we have extensive experience working with bevacizumab, such as radiolabeling and PET imaging in rodents, allowing for its seamless utilization in the present study [20,6]. As expected, our PET imaging showed considerable 89Zr-bevacizumab accumulation in the head and neck region, where a relatively strong signal was observed in the IA group but not in the IV group. The findings were further validated by the subsequent ex vivo biodistribution analysis, showing that IA delivery resulted in a substantially higher uptake of bevacizumab in the head and neck region, including tongue and salivary, than in IV administration. Thus, our data demonstrate that IA route is superior to IV injection in term of monoclonal antibody such as bevacizumab, offering a promising strategy for improving the therapeutic effectiveness of monoclonal antibody-based therapy in HCN.

The IA delivery platform established in this study may extend beyond mRNA, AAV, and monoclonal antibodies to support additional biologic modalities, such as LNP-formulated agents. Future studies will be necessary to evaluate their local bioavailability and systemic toxicity following IA delivery. Additionally, recent advancements in non-invasive imaging and diagnostic technologies offer exciting opportunities to enhance real-time monitoring and treatment guidance for IA-delivered biologics. For example, hybrid semiconducting polymer nanoparticles have enabled high-resolution NIR-II/MRI imaging of vascular structures in small animals [47], while confinement-guided AI-driven optical assays demonstrate ultrasensitive disease detection capabilities [48]. In parallel, evolving clinical imaging platforms for conditions such as liver fibrosis [49] underscore the translational potential of combining anatomical and functional imaging to assess treatment response and disease progression. These innovations may ultimately support more precise and adaptive IA therapeutic strategies.

Our findings showed the potential advantages of IA delivery of biologics for head and neck; however, our study did not directly assess potential risks associated with IA infusion, such as local injury (e.g. vascular damage, inflammation) and off-target tissue toxicity—particularly given the immunomodulatory nature of many biologic agents. Such studies, comprehensively evaluating both short- and long-term safety (i.e. by using longitudinal MRI monitoring, molecular analyses, and post-mortem histopathology) will be essential prior to implementation of therapeutic interventions or clinical translation of IA strategies.

5. Conclusions

Overall, this study established an MRI-guided IA delivery methodology for precisely targeting the head and neck in mice. This approach shows a distinct advantage in enhancing regional drug accumulation, such as mRNA, AAV vectors, and small and large-sized molecules (Gd and monoclonal antibodies). Such a platform will be of great value for optimizing and guiding treatment strategies for a variety of head and neck disorders, including HCN.

Acknowledgements

We acknowledge the support of the University of Maryland, Baltimore, Institute for Clinical & Translational Research (ICTR) and the National Center for Advancing Translational Sciences (NCATS) Clinical Translational Science Award (CTSA), UM1TR004926 and S10OD030430 instrumentation grant. We would like to also acknowledge the support of the Core for Translational Research in Imaging (CTIRM) at UMB for their technical support and assistance with MRI and PET imaging. This work was supported by the NIH R01DA056739, R01NS120929, and 2024-MSCRFD-6348.

Footnotes

CRediT authorship contribution statement

Chengyan Chu: Writing – review & editing, Writing – original draft, Visualization, Resources, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Guanda Qiao: Methodology, Investigation. Shriya Madan: Investigation, Data curation. Lucia Fadon-Padilla: Resources, Investigation, Data curation. Jinghui Wang: Investigation, Data curation. Abdallah Salemdawod: Resources. Shalini Sharma: Investigation, Data curation. David Gulisashvili: Resources. Lorissa McDougall: Resources. Yajie Liang: Conceptualization. Miroslaw Janowski: Writing – review & editing, Funding acquisition, Conceptualization. Piotr Walczak: Writing – review & editing, Supervision, Methodology, Investigation, Funding acquisition, Conceptualization.

Declaration of competing interest

P.W. and M.J. are co-owners of Ti-com, LLC and IntraART, LLC, but there is no direct relation of the manuscript’s content to the activity of either company. All other authors declare no competing interests.

Data availability

Data will be made available on request.

References

  • [1].Global Cancer Observatory, International Agency for Research on Cancer, 2023. in.
  • [2].Aigner KR, Selak E, Aigner K, Short-term intra-arterial infusion chemotherapy for head and neck cancer patients maintaining quality of life, J. Cancer Res. Clin. Oncol 145 (2019) 261–268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Osazuwa-Peters N, Simpson MC, Zhao L, Boakye EA, Olomukoro SI, Deshields T, Loux TM, Varvares MA, Schootman M, Suicide risk among cancer survivors: head and neck versus other cancers, Cancer 124 (2018) 4072–4079. [DOI] [PubMed] [Google Scholar]
  • [4].Malysz-Cymborska I, Golubczyk D, Kalkowski L, Kwiatkowska J, Zawadzki M, Glodek J, Holak P, Sanford J, Milewska K, Adamiak Z, Walczak P, Janowski M, Intra-arterial transplantation of stem cells in large animals as a minimally-invasive strategy for the treatment of disseminated neurodegeneration, Sci. Rep 11 (2021) 6581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [5].Lesniak WG, Chu C, Jablonska A, Behnam Azad B, Zwaenepoel O, Zawadzki M, Lisok A, Pomper MG, Walczak P, Gettemans J, Janowski M, PET imaging of distinct brain uptake of a nanobody and similarly-sized PAMAM dendrimers after intra-arterial administration, Eur. J. Nucl. Med. Mol. Imaging 46 (2019) 1940–1951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Lesniak WG, Chu C, Jablonska A, Du Y, Pomper MG, Walczak P, Janowski M, A distinct advantage to intraarterial delivery of (89)Zr-bevacizumab in PET imaging of mice with and without osmotic opening of the blood-brain barrier, J. Nucl. Med 60 (2019) 617–622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Homma A, Onimaru R, Matsuura K, Robbins KT, Fujii M, Intra-arterial chemoradiotherapy for head and neck cancer, Jpn. J. Clin. Oncol 46 (2016) 4–12. [DOI] [PubMed] [Google Scholar]
  • [8].Kuan CH, Chung MJ, Hong RL, Tseng TY, Tai HC, Cheng NC, Hsieh JH, Horng SY, Lai HS, The impacts of intra-arterial chemotherapy on head and neck microvascular reconstruction, J. Formos. Med. Assoc 119 (2020) 1524–1531. [DOI] [PubMed] [Google Scholar]
  • [9].Los G, Blommaert f A, Barton R, Heath DD, den Engelse L, Hanchett C, Vicario D, Weisman R, Robbins KT, Howell SB, Selective intra-arterial infusion of high-dose cisplatin in patients with advanced head and neck cancer results in high tumor platinum concentrations and cisplatin-DNA adduct formation, Cancer Chemother. Pharmacol 37 (1995) 150–154. [DOI] [PubMed] [Google Scholar]
  • [10].Robbins KT, Kumar P, Wong FS, Hartsell WF, Flick P, Palmer R, Weir AB 3rd, Neill HB, Murry T, Ferguson R, Hanchett C, Vieira F, Bush A, Howell SB, Targeted chemoradiation for advanced head and neck cancer: analysis of 213 patients, Head Neck 22 (2000) 687–693. [DOI] [PubMed] [Google Scholar]
  • [11].Robbins KT, Kumar P, Harris J, McCulloch T, Cmelak A, Sofferman R, Levine P, Weisman R, Wilson W, Weymuller E, Fu K, Supradose intra-arterial cisplatin and concurrent radiation therapy for the treatment of stage IV head and neck squamous cell carcinoma is feasible and efficacious in a multi-institutional setting: results of Radiation Therapy Oncology Group Trial 9615, J. Clin. Oncol 23 (2005) 1447–1454. [DOI] [PubMed] [Google Scholar]
  • [12].Mitsudo K, Shigetomi T, Fujimoto Y, Nishiguchi H, Yamamoto N, Furue H, Ueda M, Itoh Y, Fuwa N, Tohnai I, Organ preservation with daily concurrent chemoradiotherapy using superselective intra-arterial infusion via a superficial temporal artery for T3 and T4 head and neck cancer, Int. J. Radiat. Oncol. Biol. Phys 79 (2011) 1428–1435. [DOI] [PubMed] [Google Scholar]
  • [13].Heianna J, Makino W, Hirakawa H, Agena S, Tomita H, Ariga T, Ishikawa K, Takehara S, Maemoto H, Murayama S, Therapeutic efficacy of selective intra-arterial chemoradiotherapy with docetaxel and nedaplatin for fixed bulky nodal disease in head and neck cancer of unknown primary, Eur. Arch. Otorrinolaringol 279 (2022) 3105–3113. [DOI] [PubMed] [Google Scholar]
  • [14].Homma A, Mikami M, Matsuura K, Onimaru R, Yoshida D, Shinomiya H, Ohkoshi A, Hayashi R, Saito Y, Tachibana H, Shiga K, Ueda T, Uemura H, Nakamura K, Fukuda H, Head G, Neck Cancer Study Group of the Japan Clinical Oncology, Dose-finding and efficacy confirmation trial of the superselective intra-arterial infusion of cisplatin and concomitant radiation therapy for locally advanced maxillary sinus cancer (JCOG1212): results of the efficacy confirmation phase in patients with T4aN0M0, Int. J. Radiat. Oncol. Biol. Phys 118 (2024) 1271–1281. [DOI] [PubMed] [Google Scholar]
  • [15].Rasch CR, Hauptmann M, Schornagel J, Wijers O, Buter J, Gregor T, Wiggenraad R, de Boer JP, Ackerstaff AH, Kroger R, Hoebers FJ, Balm AJ, Hilgers FJ, Intra-arterial versus intravenous chemoradiation for advanced head and neck cancer: results of a randomized phase 3 trial, Cancer 116 (2010) 2159–2165. [DOI] [PubMed] [Google Scholar]
  • [16].Chu C, Jablonska A, Gao Y, Lan X, Lesniak WG, Liang Y, Liu G, Li S, Magnus T, Pearl M, Janowski M, Walczak P, Hyperosmolar blood-brain barrier opening using intra-arterial injection of hyperosmotic mannitol in mice under real-time MRI guidance, Nat. Protoc 17 (2022) 76–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Zawadzki M, Walecki J, Kostkiewicz B, Kostyra K, Pearl MS, Solaiyappan M, Walczak P, Janowski M, Real-time MRI guidance for intra-arterial drug delivery in a patient with a brain tumor: technical note, BMJ Case Rep 12 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Janowski M, Walczak P, Pearl MS, Predicting and optimizing the territory of blood-brain barrier opening by superselective intra-arterial cerebral infusion under dynamic susceptibility contrast MRI guidance, J. Cereb. Blood Flow Metab 36 (2016) 569–575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Jablonska A, Shea DJ, Cao S, Bulte JW, Janowski M, Konstantopoulos K, Walczak P, Overexpression of VLA-4 in glial-restricted precursors enhances their endothelial docking and induces diapedesis in a mouse stroke model, J. Cereb. Blood Flow Metab 38 (2018) 835–846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Chu C, Jablonska A, Lesniak WG, Thomas AM, Lan X, Linville RM, Li S, Searson PC, Liu G, Pearl M, Pomper MG, Janowski M, Magnus T, Walczak P, Optimization of osmotic blood-brain barrier opening to enable intravital microscopy studies on drug delivery in mouse cortex, J. Control. Release 317 (2020) 312–321. [DOI] [PubMed] [Google Scholar]
  • [21].Chu C, Liu G, Janowski M, Bulte JWM, Li S, Pearl M, Walczak P, Real-time MRI guidance for reproducible hyperosmolar opening of the blood-brain barrier in mice, Front. Neurol 9 (2018) 921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Ito S, Fuwa N, Nomura M, Daimon T, Ota S, Morishima T, Ii N, Miyati T, Intratumor hemodynamics using contrast-enhanced MRI in intra-arterial chemotherapy for head and neck cancer, Oral Surg. Oral Med. Oral Pathol. Oral Radiol 133 (2022) 706–715. [DOI] [PubMed] [Google Scholar]
  • [23].Mascola JR, Fauci AS, Novel vaccine technologies for the 21st century, Nat. Rev. Immunol 20 (2020) 87–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Kallen KJ, Thess A, A development that may evolve into a revolution in medicine: mRNA as the basis for novel, nucleotide-based vaccines and drugs, Ther. Adv. Vaccines 2 (2014) 10–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [25].Wang X, Liu S, Sun Y, Yu X, Lee SM, Cheng Q, Wei T, Gong J, Robinson J, Zhang D, Lian X, Basak P, Siegwart DJ, Preparation of selective organ-targeting (SORT) lipid nanoparticles (LNPs) using multiple technical methods for tissue-specific mRNA delivery, Nat. Protoc 18 (2023) 265–291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [26].Qin S, Tang X, Chen Y, Chen K, Fan N, Xiao W, Zheng Q, Li G, Teng Y, Wu M, Song X, mRNA-based therapeutics: powerful and versatile tools to combat diseases, Signal Transduct. Target. Ther 7 (2022) 166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Widge AT, Rouphael NG, Jackson LA, Anderson EJ, Roberts PC, Makhene M, Chappell JD, Denison MR, Stevens LJ, Pruijssers AJ, McDermott AB, Flach B, Lin BC, Doria-Rose NA, O’Dell S, Schmidt SD, Neuzil KM, Bennett H, Leav B, Makowski M, Albert J, Cross K, Edara VV, Floyd K, Suthar MS, Buchanan W, Luke CJ, Ledgerwood JE, Mascola JR, Graham BS, Beigel JH, R.N.A.S.G. M, Durability of responses after SARS-CoV-2 mRNA-1273 vaccination, N. Engl. J. Med 384 (2021) 80–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Miao L, Li L, Huang Y, Delcassian D, Chahal J, Han J, Shi Y, Sadtler K, Gao W, Lin J, Doloff JC, Langer R, Anderson DG, Delivery of mRNA vaccines with heterocyclic lipids increases anti-tumor efficacy by STING-mediated immune cell activation, Nat. Biotechnol 37 (2019) 1174–1185. [DOI] [PubMed] [Google Scholar]
  • [29].Oberli MA, Reichmuth AM, Dorkin JR, Mitchell MJ, Fenton OS, Jaklenec A, Anderson DG, Langer R, Blankschtein D, Lipid nanoparticle assisted mRNA delivery for potent cancer immunotherapy, Nano Lett. 17 (2017) 1326–1335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Swingle KL, Hamilton AG, Mitchell MJ, Lipid nanoparticle-mediated delivery of mRNA therapeutics and vaccines, Trends Mol. Med. 27 (2021) 616–617. [DOI] [PubMed] [Google Scholar]
  • [31].Sork H, Nordin JZ, Turunen JJ, Wiklander OP, Bestas B, Zaghloul EM, Margus H, Padari K, Duru AD, Corso G, Bost J, Vader P, Pooga M, Smith CE, Wood MJ, Schiffelers RM, Hallbrink M, Andaloussi SE, Lipid-based transfection reagents exhibit cryo-induced increase in transfection efficiency, Mol. Ther. Nucleic Acids 5 (2016) e290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Wang JH, Gessler DJ, Zhan W, Gallagher TL, Gao G, Adeno-associated virus as a delivery vector for gene therapy of human diseases, Signal Transduct. Target. Ther 9 (2024) 78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Santiago-Ortiz JL, Schaffer DV, Adeno-associated virus (AAV) vectors in cancer gene therapy, J. Control. Release 240 (2016) 287–301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Hadi M, Qutaiba BAO, Jabari M, Jasoor AM, Naderloo O, Yasamineh S, Gholizadeh O, Kalantari L, Recent advances in various adeno-associated viruses (AAVs) as gene therapy agents in hepatocellular carcinoma, Virol. J 21 (2024) 17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Chisholm E, Bapat U, Chisholm C, Alusi G, Vassaux G, Gene therapy in head and neck cancer: a review, Postgrad. Med. J 83 (2007) 731–737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Bali A, Bali D, Sharma A, An overview of gene therapy in head and neck cancer, Indian J. Hum. Genet 19 (2013) 282–290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [37].Ertl HCJ, Immunogenicity and toxicity of AAV gene therapy, Front. Immunol 13 (2022) 975803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [38].Bonner JA, Harari PM, Giralt J, Azarnia N, Shin DM, Cohen RB, Jones CU, Sur R, Raben D, Jassem J, Ove R, Kies MS, Baselga J, Youssoufian H, Amellal N, Rowinsky EK, Ang KK, Radiotherapy plus cetuximab for squamous-cell carcinoma of the head and neck, N. Engl. J. Med 354 (2006) 567–578. [DOI] [PubMed] [Google Scholar]
  • [39].Bonner JA, Harari PM, Giralt J, Cohen RB, Jones CU, Sur RK, Raben D, Baselga J, Spencer SA, Zhu J, Youssoufian H, Rowinsky EK, Ang KK, Radiotherapy plus cetuximab for locoregionally advanced head and neck cancer: 5-year survival data from a phase 3 randomised trial, and relation between cetuximab-induced rash and survival, Lancet Oncol 11 (2010) 21–28. [DOI] [PubMed] [Google Scholar]
  • [40].Posner MR, Wirth LJ, Cetuximab and radiotherapy for head and neck cancer, N. Engl. J. Med 354 (2006) 634–636. [DOI] [PubMed] [Google Scholar]
  • [41].Harrington KJ, Burtness B, Greil R, Soulieres D, Tahara M, de Castro G Jr., Psyrri A, Brana I, Baste N, Neupane P, Bratland A, Fuereder T, Hughes BGM, Mesia R, Ngamphaiboon N, Rordorf T, Wan Ishak WZ, Lin J, Gumuscu B, Swaby RF, Rischin D, Pembrolizumab with or without chemotherapy in recurrent or metastatic head and neck squamous cell carcinoma: updated results of the phase III KEYNOTE-048 study, J. Clin. Oncol 41 (2023) 790–802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [42].Tamimi A, Tamimi A, Sorkheh F, Asl SM, Ghafari A, Karimi AG, Erabi G, Pourmontaseri H, Deravi N, Monoclonal antibodies for the treatment of squamous cell carcinoma: a literature review, Cancer Rep. (Hoboken) 6 (2023) e1802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [43].Argiris A, Karamouzis MV, Gooding WE, Branstetter BF, Zhong S, Raez LE, Savvides P, Romkes M, Phase II trial of pemetrexed and bevacizumab in patients with recurrent or metastatic head and neck cancer, J. Clin. Oncol 29 (2011) 1140–1145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Nyflot MJ, Kruser TJ, Traynor AM, Khuntia D, Yang DT, Hartig GK, McCulloch TM, Wiederholt PA, Gentry LR, Hoang T, Jeraj R, Harari PM, Phase 1 trial of bevacizumab with concurrent chemoradiation therapy for squamous cell carcinoma of the head and neck with exploratory functional imaging of tumor hypoxia, proliferation, and perfusion, Int. J. Radiat. Oncol. Biol. Phys 91 (2015) 942–951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [45].Heydar H, Mansouri K, Norooznezhad M, Norooznezhad F, Mohamadnia A, Bahrami N, Bevacizumab inhibits angiogenic cytokines in head and neck squamous cell carcinoma: from gene to the protein, Int. J. Hematol. Oncol. Stem Cell Res 12 (2018) 136–141. [PMC free article] [PubMed] [Google Scholar]
  • [46].Fury MG, Lee NY, Sherman E, Lisa D, Kelly K, Lipson B, Carlson D, Stambuk H, Haque S, Shen R, Kraus D, Shah J, Pfister DG, A phase 2 study of bevacizumab with cisplatin plus intensity-modulated radiation therapy for stage III/IVB head and neck squamous cell cancer, Cancer 118 (2012) 5008–5014. [DOI] [PubMed] [Google Scholar]
  • [47].Xu L, Li Z, Ma Y, Lei L, Yue R, Cao H, Huan S, Sun W, Song G, Imaging carotid plaque burden in living mice via hybrid semiconducting polymer nanoparticles-based near-infrared-II fluorescence and magnetic resonance imaging, Research (Wash. DC) 6 (2023) 0186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [48].Zhang W, Lu Y, Su C, Wang Y, Wang Y-F, Zhang B, Jiang C, Guo K, Xu C, Confinement-guided ultrasensitive optical assay with artificial intelligence for disease diagnostics, Innov. Med 1 (2023) 100023. [Google Scholar]
  • [49].Huang W, Peng Y, Kang L, Advancements of non-invasive imaging technologies for the diagnosis and staging of liver fibrosis: present and future, View 5 (2024). [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be made available on request.

RESOURCES