Abstract
Background
Fascin actin-bundling protein 1 (FSCN1), a member of actin cytoskeletal protein family genes, plays critical roles in cell migration, motility, adhesion, and other cellular interactions. It has shown its ascending importance in tumors of multiple systems, including the nervous system, respiratory system, digestive system and urinary system. Nevertheless, no systematic pan-cancer analysis has been carried out to investigate its function in diagnosis, prognosis, and immunological prediction.
Methods
We used UCSC Xena, The Cancer Genome Atlas (TCGA), Genotype Tissue Expression Project (GTEx), Human Protein Atlas (HPA), cBioPortal, STRING, Cancer single-cell state Atlas (CancerSEA), Genomics of Drug Sensitivity in Cancer (GDSC) and Xiantao Academic analysis tool websites and databases for the extraction of pan-cancer data on FSCN1. We adopted bioinformatics methods to explore the potential role of FSCN1 in pan-cancer, including analysis of the correlation between FSCN1 and clinicopathologic features, prognosis, genetic alteration, immune, DNA methylation, single cell function and drug sensitivity. Furthermore, a protein–protein interaction network was drawn, and gene set enrichment analysis was conducted to explore the functions of FSCN1. Finally, we validated the effects of FSCN1 on cell proliferation and apoptosis through experiments.
Results
The findings of the comprehensive pan-cancer analysis revealed that FSCN1 was highly expressed in most cancers, except in acute myeloid leukemia, prostate adenocarcinoma and thyroid carcinoma, and it has a certain diagnostic and prognosis value in many cancers. Furthermore, FSCN1 expression was found to correlate with immune cell infiltration, immune checkpoint (ICP) genes expression, DNA methylation and drug sensitivity in a variety of cancers. In addition, we discovered that FSCN1 participated in the proliferation and DNA repair at the single-cell level. Besides, Gene function enrichment analyses revealed that genes that were co-expressed with FSCN1 were enriched within the actin filament regulation pathways. CCK-8 assay and flow cytometry apoptosis assay results indicated that FSCN1 knockdown inhibited proliferation and induced apoptosis in mesothelioma (MESO).
Conclusion
FSCN1 is a prospective marker for the diagnosis, prognosis, immunology, chemotherapy, and small molecular drugs targeted for pan-cancer treatment.
Keywords: FSCN1, Pan-cancer, Diagnosis, Prognosis, Immunization
Introduction
Fascin actin-bundling protein 1 (FSCN1), also called fascin or fascin-1, is a globular, filamentous, actin-binding protein, which belongs to the actin cytoskeletal protein family [1]. FSCN1 contributes to tissue function through two different actin-based structures—dynamic cortical cell protrusions and cytoplasmic microfilament bundles. Filopodia, spikes, lamellipodial ribs, oocyte microvilli, and the dendrites on dendritic cells are examples of cortical structures, which are involved in cell–matrix adhesion, cell interactions and cell migration. The cytoplasmic actin bundles, on the other hand, seem to have a role in cell architecture [2, 3].
Previous studies have discovered that FSCN1 is abnormally expressed in a variety of human carcinomas. It is present in all grades of glioblastoma, where its function appears to be related to cell motility, invasion, and immune response [4–6]. Quantitative RT-PCR and western blot analysis demonstrated that FSCN1 expression was markedly up-regulated in laryngeal squamous cell carcinoma and tongue squamous cell carcinoma in comparison with adjacent normal mucosal tissues [7, 8]. Compared to normal para-carcinoma tissue, FSCN1 exhibits differential expression in non-small cell lung cancer(NSCLC) tissue and correlates with poor prognosis in NSCLC patients [9]. FSCN1 expression is significantly elevated in esophageal squamous cell carcinoma and gastric adenocarcinoma, with a substantial correlation to histological grade and prognosis [10–13]. In hepatocellular carcinoma, FSCN1-positive tumors exhibit greater size, less differentiation, and an increased propensity for hematogenous metastasis compared to FSCN1-negative tumors [14]. FSCN1 expression is also increased in renal cell carcinoma and bladder cancer [15, 16], and its elevated level correlates with the aggressiveness of patients [17].
Although the studies mentioned above have shown the role of FSCN1 in some cancers, the potential value of FSCN1 for other cancers, including mesothelioma, remains unclear. In the present study, we conducted a comprehensive analysis to examine the role of FSCN1 in human cancer prognosis and immunology. We also investigated the relationship between FSCN1 and immune infiltration, DNA methylation, immune checkpoint genes, genomic alterations, potentially regulatory pathways and single cell function. Ultimately, we investigated effective small molecule drugs through analysing the relationship between drug sensitivity and FSCN1 expression.
Methods
Data and software availability
All originate data downloaded from the Cancer Genome Atlas (TCGA) (https://cancergenome.nih.
gov/) database and and the Genotype-Tissue Expression (GTEx) database. TCGA consists of more than 20,000 primary cancer samples over 33 cancer types [18]. We used R 4.4.1 and GraphPad Prism 8.0.2 for statistical analysis and graphing.
Gene expression and subcellular localization analysis of FSCN1 in pan-cancer
We downloaded RNA-seq data from The Cancer Genome Atlas (TCGA) database and the Genotype-Tissue Expression (GTEx) database by UCSC XENA (https://xenabrowser.net/datapages/). It should be pointed out that the data from two different databases, TCGA and GTEx, were integrated by the UCSC team and batch effects were removed [19]. The log2 (TPM + 0.001) transformed normalized expression profiles. Xiantao Academic (https://www.xiantaozi.com/) online analysis tools was used to analyze the expression of FSCN1 in tumor and normal tissues. Statistical analysis was performed using the Wilcoxon rank-sum test, and significant outcomes were defined at p < 0.05 (ns, p ≥ 0.05; *, p < 0.05; **, p < 0.01; ***, p < 0.001). We used the immunofluorescence staining images of three human cancer cell lines (U251MG, A-431, and U2OS) to display the subcellular localization of FSCN1 in cells from the Human Protein Atlas (HPA) database (https://www.proteinatlas.org/) [20]. The abbreviations of the 33 tumors are shown in Table 1.
Table 1.
Pan-cancers and the corresponding abbreviations
| Cancer type | Abbreviation |
|---|---|
| Adrenocortical carcinoma | ACC |
| Bladder urothelial carcinoma | BLCA |
| Breast invasive carcinoma | BRCA |
| Cervical squamous cell carcinoma and endocervical adenocarcinoma | CESC |
| Cholangiocarcinoma | CHOL |
| Colon adenocarcinoma | COAD |
| Lymphoid neoplasm diffuse large B-cell lymphoma | DLBC |
| Esophageal carcinoma | ESCA |
| Glioblastoma multiforme | GBM |
| Head and neck squamous cell carcinoma | HNSC |
| Kidney chromophobe | KICH |
| Kidney renal clear cell carcinoma | KIRC |
| Kidney renal papillary cell carcinoma | KIRP |
| Acute myeloid leukemia | LAML |
| Brain lower grade glioma | LGG |
| Liver hepatocellular carcinoma | LIHC |
| Lung adenocarcinoma | LUAD |
| Lung squamous cell carcinoma | LUSC |
| Mesothelioma | MESO |
| Ovarian serous cystadenocarcinoma | OV |
| Pancreatic adenocarcinoma | PAAD |
| Pheochromocytoma and paraganglioma | PCPG |
| Prostate adenocarcinoma | PRAD |
| Rectum adenocarcinoma | READ |
| Sarcoma | SARC |
| Skin cutaneous melanoma | SKCM |
| Stomach adenocarcinoma | STAD |
| Testicular germ cell tumors | TGCT |
| Thyroid carcinoma | THCA |
| Thymoma | THYM |
| Uterine corpus endometrial carcinoma | UCEC |
| Uterine carcinosarcoma | UCS |
| Uveal melanoma | UVM |
Relationship between FSCN1 and clinicopathologic features
The Wilcoxon test was used to explore the correlation between FSCN1 expression and clinicopathological features, including T stage, N stage and pathologic stage. Correlation analyses were completed using the Xiantao Academic (https://www.xiantaozi.com/) online analysis tool.
Prognostic analysis of FSCN1 in pan-cancer
The survival data of pan-cancer, including overall survival (OS), disease-specific survival (DSS) and progression-free interval (PFI), was downloaded from TCGA database (https://portal.gdc.cancer.gov/) for evaluating the prognostic significance of FSCN1. Patients were categorized into high and low FSCN1 groups based on the median FSCN1 expression value with 50% cut-off high and 50% cut-off low. Kaplan–Meier survival analysis and Cox regression were performed to explore the correlation between FSCN1 and survival prognosis. Correlation analyses were completed using the Xiantao Academic (https://www.xiantaozi.com/) online analysis tool.
Immune-related analysis of FSCN1
The Xiantao Academic (https://www.xiantaozi.com/) online analysis tool was used to analyze infiltration ratio of 24 types of immune cells based on ssGSEA algorithm and estimate algorithm. Spearman correction was used to analyze the correlation between FSCN1 and the enrichment scores of 24 types of immune cells. Furthermore, 11 immune checkpoint genes (including BTLA, CTLA4, HAVCR2, LAG3, LILRB2, LILRB4, PDCD1, SIGLEC7, SIRPA, TIGIT and VSIR) [21] were extracted from TCGA datasets for immune checkpoint gene correlation analysis.
Genetic alteration analysis of FSCN1
The cBioPortal platform (http://www.cbioportal.org/) was utilized to analyze and visualize cancer genetic data, aiding in the interpretation of molecular profiles derived from histologic and cytologic studies [22]. We retrieved gene alteration data for the "TCGA Pan-Cancer Atlas Studies" from the UCSC Xena and International Cancer Genome Consortium (ICGC) (https://www.icgc-argo.org) portals for subsequent analysis. Within cBioPortal, the "Cancer Types Summary" module was specifically used to explore the mutation landscape of the FSCN1 gene, detailing its mutation type, copy number alteration (CNA), and mutation frequency data.
DNA methylation analysis of FSCN1
Aberrant DNA methylation is a common form of epigenetic modifications in tumors [23]. Shiny Methylation Analysis Resource Tool (SMART, http://www.bioinfo-zs.com/smartapp/) was applied to discuss the distribution of methylation probes in chromosomes [24]. In addition, we explore the correlation between FSCN1 expression and DNA methylation levels using Spearman correlation analysis. DNA methylation profiles and phenotype data of pan-cancer was downloaded from UCSC Xena and TCGA. This analysis was conducted and displayed by the R packages psych and ggplot2.
Protein–protein interaction network and genomes enrichment analysis of FSCN1
The protein–protein interaction (PPI) networks of FSCN1 were acquired through the STRING database (https://cn.string-db.org/) [25]. We input FSCN1 in the Protein by name, and basic settings were as follows: the minimum required interaction score (medium confidence (0.400)), and max number of interactors to show (custom value (100)). Thereafter, we utilized genes that interact with FSCN1 which were obtained from the STRING database to perform enrichment analysis. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of the proteins were conducted using the R package clusterProfiler [26] and results were visualized in the Cytoscape software (version 3.10.1) and R package ggplot2.
Molecular docking
In this study, the HDOCK server was employed for protein–protein molecular docking [27–29]. HDOCK incorporates a hybrid docking strategy that combines template-based docking and template-free docking [29], enabling efficient prediction of complex conformations even when structural templates are limited or unavailable. During the docking process, the server generated 100 candidate binding conformations, which were ranked according to a comprehensive score. The conformation with the lowest docking score was selected as the final binding model, as a more negative docking score typically indicates a more stable and plausible binding mode. The protein structures of interest were obtained from the UniProt database (https://www.uniprot.org/) [30]. After docking, the three-dimensional (3D) model of the complex was visualized and analyzed using PyMOL (Version 3.0.3) [31], while two-dimensional (2D) interactions were identified and illustrated using LigPlot + [32]. PyMOL primarily identifies and displays hydrogen bonds and conformations in 3D space based on geometric algorithms, whereas LigPlot + generates 2D interaction diagrams using built-in geometric and statistical rules. These two tools complement each other in their representation methods. The docking scores in HDOCK are calculated based on the knowledge-based iterative scoring functions ITScorePP or ITScorePR [33, 34]. Specifically, a more negative docking score indicates a higher likelihood of complex formation. Generally, docking scores for protein–protein or protein–DNA/RNA complexes are approximately –200. Therefore, comparative analysis of lower scores facilitates the identification of the most reasonable binding mode.
Single-cell functional analysis of FSCN1
The Cancer single-cell state Atlas (CancerSEA, http://biocc.hrbmu.edu.cn/CancerSEA/) is an analytic tool for studying cancer cell functions at the single-cell level, containing 14 tumor-related cellular functions of 900 cancer cells from 25 cancers [35]. We obtained correlation data of FSCN1 across 14 functional states in distinct cancers and used the Xiantao Academic (https://www.xiantaozi.com/) online analysis tool to visualize it.
Drug sensitivity analysis
We investigated the relationship between gene expression and drug sensitivity using cancer cell lines data from the Genomics of Drug Sensitivity in Cancer (GDSC) database via the GSCA platform (http://bioinfo.life.hust.edu.cn/GSCA/#/drug) [36]. The correlation between FSCN1 mRNA expression levels and drug IC50 values was assessed using Pearson correlation analysis. Subsequently, leveraging the GDSC database, we predicted the IC50 values for clinically relevant and statistically significant pharmacotherapeutic agents in each lung adenocarcinoma(LUAD) sample from the TCGA database. Differences in IC50 between the low-FSCN1 and high-FSCN1 expression groups were evaluated with the Wilcoxon signed-rank test, and results were visualized in box plots generated by the R packages oncoPredict [37] and ggplot2.
Proliferation and apoptosis analysis of FSCN1
We further investigated the role of FSCN1 knockdown in MESO through vitro cell experiments.
Cell and cell line culture
Human healthy mesothelial cell line MET-5A and MESO cell line NCI-H2452 were obtained from Pricella Life Science&Technology Co.,Ltd, and cultured in M199 medium supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin at 37℃, with saturated humidity at 5% CO2.
Small interfering RNA (siRNA) transfection
Cells were transfected with three siRNAs targeting FSCN1 and with a non-targeting scrambled control si-NC. The sequences (5'-3') were as follows: si-FSCN1 #1: forward GCAAGUUUGUGACCUCCAA, reverse UUGGAGGUCACAAACUUGC. si-FSCN1 #2: forward UCGAGUUCUGCGACUAUAACA, reverse UGUUAUAGUCGCAGAACUCGA. si-FSCN1 #3: forward GCUGCUACUUUGACAUCGAGU, reverse ACUCGAUGUCAAAGUAGCAGC (Baiouni biotechnology). The cells were transfected with siRNAs at a final concentration at 50 nM at 37℃.
Cell Counting Kit-8 (CCK-8) assay and flow cytometry apoptosis assay
To examine the effect of FSCN1 on the proliferative capacity of MESO cells, we used CCK-8 (C0039, Beyotime) assay. Cells from each group were seeded into 96-well plate at a certain density. After 24 h of adhesion in a 37℃, 5% CO2 incubator, 100 µL of prepared CCK-8 solution was added to each well, and the plate was incubated further. After 1 h, the absorbance (OD value) at 450 nm was measured using a microplate reader.
Following transfection, cells were digested with 0.25% trypsin, collected, and resuspended in a 5 mL flow tube. After adding 5 µL of Annexin V-FITC and mixing thoroughly, the cells were incubated in the dark at room temperature for 5 min. Then, The proportion of apoptosis was detected by using DAPI (Beyotime) and Annexin V (elabscience).
Statistical analysis
Wilcoxon rank-sum test was applied to study FSCN1 expression and its correlation with clinical features. Spearman correlation analysis estimated the correlation of FSCN1 with DNA methylation levels. Pearson correlation analysis was performed to study the correlation between FSCN1 and drug IC50. Follow-up correlation analyses were performed using a variety of online analysis websites. All quantitative data were presented as mean ± standard deviation (SD) from at least three times experiments and independent sample t-tests were used for comparisons between groups. For comparisons involving three or more groups, one-way ANOVA followed by Dunnett’s multiple comparison test was applied, with P < 0.05 indicated statistical significance.
Results
Gene expression and subcellular localization analysis of FSCN1 in pan-cancer
We used the Xiantao Academic online analysis tool to analyze the expression levels of FSCN1 in pan-cancer and normal tissues. Based on TCGA data, the results showed that FSCN1 expression was up-regulated in 12 cancers, including BLCA, CHOL, COAD, ESCA, HNSC, KIRC, KIRP, LIHC, LUAD, LUSC, READ, and STAD, while it was down-regulated in KICH (Fig. 1A). For TCGA paired tumor samples and corresponding normal samples, FSCN1 expression was significantly up-regulated in 10 cancer types, including BLCA, CHOL, COAD, HNSC, KIRC, LIHC, LUAD, LUSC, READ, and STAD, while it was down-regulated in KICH (Fig. 1C). In the meantime, the data of tumor and normal samples from TCGA and GTEx database showed that FSCN1 expression was significantly up-regulated in 24 cancer types, including ACC, BLCA, BRCA, CESC, CHOL, COAD, DLBC, ESCA, GBM, HNSC, KIRC, KIRP, LGG, LIHC, LIAD, LUSC, OV, PAAD, READ, STAD, TGCT, THYM, UCEC, and UCS, while it was down-regulated in 3 cancer types, including LAML, PRAD and THCA (Fig. 1B).
Fig. 1.
Expression and subcellular localization of FSCN1. A FSCN1 expression in cancers in TCGA. B FSCN1 expression in cancers in TCGA + GTEx. C FSCN1 expression between tumor and paired normal samples in TCGA. D Immunofluorescence staining of the subcellular localization of FSCN1 in HPA database. (*p < 0.05; **p < 0.01; ***p < 0.001, ns: no statistical differences)
The subcellular localization of FSCN1 was obtained by immunofluorescence localization of nucleus and microtubules in U-251 MG, A-431 and U-2OS cells. The results showed that FSCN1 was found in the plasma membrane and cytosol in all 3 cells (Fig. 1D).
Relationship between FSCN1 and clinicopathologic features
Subsequently, we explored the association between FSCN1 expression and clinicopathologic features. For pathologic stage, FSCN1 had a higher expression in the higher pathologic stage for ACC, LUAD, THCA and TGCT, while a lower expression in the higher pathologic stage for ESCA (Fig. 2A). For the T stage, FSCN1 had a higher expression in the higher T stage for ACC, CESC, COAD, PRAD and TGCT, and a lower expression in the higher T stage for THCA (Fig. 2B). Besides, FSCN1 expression in ACC, KIRC, LUAD and PRAD was higher in patients with lymph node metastasis than without lymph node metastasis. However, the FSCN1 expression level in BLCA, BRCA, ESCA, MESO and THCA was lower in patients with lymph node metastasis than in patients without lymph node metastasis (Fig. 2C).
Fig. 2.
Relationship between FSCN1 and clinicopathologic features. A The relationship of FSCN1 expression to pathologic stage in ACC, ESCA, LUAD, THCA, TGCT. B The relationship of FSCN1 expression to T stage in ACC, CESC, COAD, PRAD, TGCT, THCA. C The relationship of FSCN1 expression to N stage in ACC, BLCA, BRCA, ESCA, KIRC, LUAD, MESO, PRAD, THCA. (*p < 0.05; **p < 0.01; ***p < 0.001)
Prognostic value of FSCN1
Aiming to investigate the association between FSCN1 expression level and prognosis, we performed a survival association analysis for each cancer in the TCGA database, concentrating on overall survival (OS), disease specific survival (DSS) and progress free interval (PFI). Cox proportional hazards model analysis illustrated that the expression level of FSCN1 was associated with OS in ACC (p < 0.001, HR > 1), BLCA (p = 0.023, HR > 1), CESC (p = 0.043, HR > 1), COAD (p = 0.032, HR > 1), HNSC (p = 0.001, HR > 1), LUAD (p < 0.001, HR > 1) and MESO (p < 0.001, HR > 1), indicating that FSCN1 was a significant risk factor for OS in these tumor types (Fig. 3A). Kaplan–Meier survival analysis also demonstrated that among patients with ACC, BLCA, CESC, COAD, HNSC, LUAD and MESO, low FSCN1 expression was associated with better OS (Fig. 3B).
Fig. 3.
The Cox regression and Kaplan–Meier curves for overall survival (OS). A Forest plot of OS associations in pan-cancer. B Kaplan -Meier analysis of the association between FSCN expression and OS in ACC, BLCA, CESC, COAD, HNSC, LUAD, MESO
Moreover, DSS data analysis presented in Fig. 4 reflected associations between high FSCN1 expression and poor prognosis in patients with ACC (p < 0.001, HR > 1), BLCA (p = 0.017, HR > 1), CESC (p = 0.02, HR > 1), COAD (p = 0.016, HR > 1), HNSC (p = 0.009, HR > 1), LUAD (p = 0.049, HR > 1) and MESO (p < 0.001, HR > 1).
Fig. 4.
The Cox regression and Kaplan–Meier curves for disease-specific survival (DSS). A Forest plot of DSS associations in pan-cancer. B Kaplan -Meier analysis of the association between FSCN expression and DSS in ACC, BLCA, CESC, COAD, HNSC, LUAD, MESO
Referring to associations between FSCN1 expression and PFI, high expression of FSCN1 was associated with poor PFI in ACC (p < 0.001, HR > 1), COAD (p = 0.007, HR > 1), LGG (p = 0.006, HR > 1), MESO (p = 0.016, HR > 1), PAAD (p = 0.002, HR > 1), PRAD (p < 0.001, HR > 1), TGCT (p = 0.033, HR > 1) and UVM (p = 0.041, HR > 1) (Fig. 5).
Fig. 5.
The Cox regression and Kaplan–Meier curves for progression-free interval (PFI). A Forest plot of PFI associations in pan-cancer. B Kaplan -Meier analysis of the association between FSCN expression and PFI in ACC, COAD, LGG, MESO, PAAD, PRAD, TGCT, UVM
Considering that differences in some clinicopathologic features between groups may affect the results, we included factors with statistical differences (p < 0.1) in the univariate regression analysis into the multivariate regression analysis, as results shown in Fig. 6. For OS and DSS, high FSCN1 expression was a poor prognostic factor in ACC and MESO. For PFI, high FSCN1 expression was a poor prognostic factor in several tumors, including ACC, COAD, MESO, PAAD and TGCT. These findings suggested that FSCN1 may be an independent prognostic marker for multiple tumor types. More detailed information about univariate and multivariate COX regression analysis were exhibited in Supplementary Table S1-S22.
Fig. 6.
The multivariate COX regression analysis for OS (A), DSS (B), PFI (C)
Immune-related analysis of FSCN1
We explored the association between FSCN1 expression and the infiltration of 24 kinds of immunocytes within the tumor microenvironment (TME) using Spearman correlations. The results indicated that FSCN1 expression was positively or negatively correlated with the level of immune cells in the majority of tumors (Fig. 7A). Especially, FSCN1 was positively related to macrophage and NK cell infiltration levels in almost 33 tumors, by contrast, FSCN1 expression was negatively related to Th17 cell infiltration level in 19 tumors. In addition, ESTIMATE algorithms were utilized to calculate the relationship of FSCN1 with stromal score and immune score for 33 cancers. FSCN1 was positively linked with stromal score and immune score in BRCA, COAD, DLBC, KICH, LGG, LIHC, LUAD, PCPG, PRAD and READ, but negatively associated with stromal score and immune score in ACC, GBM and LAML. Besides, FSCN1 expression had a positive or negative correlation with stromal score or immune score in some cancers. There was no relationship between FSCN1 expression and stromal score and immune score of CESC, CHOL, ESCA, KIRP and PAAD (Fig. 7B).
Fig. 7.
Correlation between FSCN1 and immune cells in pan-cancer. A The heatmap of FSCN1 expression correlation with 24 tumor infiltrating cells. B The heatmap of the correlation between FSCN1 expression and the stromal, immune score
Afterwards, we investigated the relationship between FSCN1 and several immune checkpoint (ICP) genes, including CTLA4, BTLA, PDCD1, SIRPA, TIGIT and VSIR, in multiple cancer types. The results indicated there were significant relationships between these ICP genes and human tumors (Fig. 8A–F). In READ, PRAD, LUAC, LIHC, KICH, COAD and BRCA, there was a positive relationship between FSCN1 expression and ICP genes, suggesting that FSCN1 may be involved in coordinating the activity of these ICP gens through different signal transduction pathways, making it an attractive target for immunotherapy. Conversely, there was a negative relationship between FSCN1 expression and these ICP genes in TGCT, LUSC, HNSC and GBM, which suggested that high FSCN1 expression may predict unsatisfactory immunotherapy results when targeting these genes. In contrast, FSCN1 inhibitors may provide an alternative treatment option.
Fig. 8.
Correlation between FSCN1 expression and immune checkpoint gene expression in pan-caner. A Heatmap shows the correlation between the expression of FSCN1 and 11 immune checkpoint genes. B–G Volcano plots show the results of Spearman’s correlation analysis between the expression of FSCN1 and BTLA, CTLA4, PDCD1, SIGLEC7, SIRPA, VSIR
Genetic alteration analysis of FSCN1
The genetic alteration status of the FSCN1 gene in human cancers was analyzed by the cBioPortal platform. Of all 10,953 patients from the TCGA database, 209 (2%) had FSCN1 gene alteration. Diverse alterations in the FSCN1 gene affected the gene expression (Fig. 9C). As shown in Fig. 9B, the frequency of genetic variation of FSCN1 was highest in CHOL (5.56%) and mutation and amplification were the common types among the different types of genetic alterations. The second and third highest frequency of FSCN1 occurred in BLCA (5.35%) and UCS (5.26%) and was mainly in the form of amplification. In addition, we found that missense mutation was the main type of FSCN1 genetic mutations (Fig. 9A).
Fig. 9.
Mutation characteristics of FSCN1 in TCGA PanCancer atlas. A Sites of different mutation types of FSCN1. B The alteration frequency with mutation types of FSCN1 in all TCGA tumors. C The mRNA expression of FSCN1 putative copy-number alteration (CNA) in pan-cancer tissues
DNA methylation analysis of FSCN1
To reveal the mechanism that contributes to an increased FSCN1 expression, the DNA methylation alteration in the FSCN1 gene promoter region and gene body was analyzed. As shown in Fig. 10A, methylation levels of multiple sites within the FSCN1 promoter region were significantly inversely correlated with mRNA expression levels in > 50% of tumor types, including ACC, BLCA, BRCA, CHOL, CESC, DLBC, ESCA, HNSC, KICH, KIRP, LAML, LGG, LIHC, LUAD, LUSC, MESO, PAAD, PCPG, PRAD, READ, SARC, SKCM, STAD, TGCT, THCA and UCEC, while in the FSCN1 gene body, methylation levels at different sites were significantly positively or negatively correlated with mRNA expression levels in almost all tumor types. Notably, we found that within methylation probe cg15246238, methylation levels were significantly negatively related to mRNA expression levels in nearly all tumor types, except DLBC, KICH, LIHC, OV, TGCT and THYM. The correlation in ACC, BLCA and BRCA between methylation levels and FSCN1 expression can be seen in Fig. 10B–D, respectively.
Fig. 10.
Correlation between FSCN1 expression and DNA methylation. A The Heatmap of FSCN1 expression correlation with 31 DNA methylation sites in pan-cancer. B–D Scatter plots show the results of Spearman’s correlation analysis between the expression of FSCN1 and DNA methylation site ‘cg15246238’ in ACC, BLCA, BRCA
Protein–protein interaction network and genomes enrichment analysis of FSCN1
We further screened out the proteins interacting with FSCN1 through the STRING online tool to explore their molecular mechanism in tumorigenesis. The top 100 co-expressed genes with their expression positively related to FSCN1 were shown in the PPI network (Fig. 11A). Subsequently, we utilized the gene set to perform GO and KEGG pathway enrichment analysis via R software, and the most highly enriched items of biological process (BP), cellular component (CC), molecular function (MF) were shown in Fig. 11B and KEGG pathway were shown in Fig. 11C. BP enrichment analysis showed that FSCN1-related genes were mainly involved in actin filament organization. CC enrichment analysis showed that FSCN1-related genes were enriched in the cell cortex, focal adhesion, cell leading edge and cell-substrate junction. We found that the role of FSCN1 in tumor pathogenesis was related to actin binding, actin filament binding, cadherin binding and structural constituent of cytoskeleton. In addition, KEGG pathway analysis showed that FSCN1 participated in some pathways, including regulation of actin cytoskeleton, proteoglycans in cancer, tight junction and Fc gamma R-mediate phagocytosis.
Fig. 11.
Protein–protein interaction (PPI) analysis and enrichment analysis of 100 co-expressed genes related to FSCN1. A The top 100 co-expressed genes positively related to FSCN1 expression are shown in the PPI network across STRING. B Gene Oncology (GO) enrichment analysis of FSCN1 and 100 co-expressed genes. C Kyoto Encyclopedia of Genes and Genomers (KEGG) enrichment analysis of FSCN1 and 100 co-expressed genes. D Interaction diagram of the binding interface in the protein–protein docking complex of FSCN1 and MMP1. E Interaction diagram of the binding interface in the protein–protein docking complex of FSCN1 and MMP2. F Interaction diagram of the binding interface in the protein–protein docking complex of FSCN1 and MMP9. G Interaction diagram of the binding interface in the protein–protein docking complex of FSCN1 and TGF-β
Molecular docking
FSCN1 formed hydrogen bond interactions with amino acid residues such as ARG-63 and GLN-264 of MMP1, with a docking score of – 281.85 (as shown in Fig. 11D). Similarly, hydrogen bonds were observed between FSCN1 and residues including GLN-566 and GLU-162 of MMP2, with a docking score of – 213.87 (Fig. 11E). FSCN1 also interacted via hydrogen bonds with residues such as GLN-362 and GLU-82 of MMP9, yielding a docking score of – 222.64 (Fig. 11F). In addition, hydrogen bond interactions were formed between FSCN1 and ARG-158 and GLU-313 of TGF-β, with a docking score of – 249.06 (Fig. 11G). In summary, the complexes of FSCN1 with MMP1, MMP2, MMP9, and TGF-β exhibited strong stability, further indicating a close association between FSCN1 and EMT.
Single-cell functional analysis of FSCN1
To further explore the potential role of FSCN1 in tumors, we investigated the function of FSCN1 at the single-cell level using CancerSEA (Fig. 12A). The results displayed that FSCN1 was positively correlated with stemness and cell cycle in high-grade glioma (Fig. 12B). FSCN1 expression was negatively correlated with proliferation in LUAD (Fig. 12C). In colorectal cancer, FSCN1 had a positive relationship with differentiation, inflammation, angiogenesis, metastasis and apoptosis, and a negatively relationship with DNA repair (Fig. 12D). In retinoblastoma, FSCN1 was positively related to differentiation, angiogenesis and inflammation, and was negatively related to DNA repair and cell cycle (Fig. 12E). Besides, there was a negatively relationship between FSCN1 and DNA repair, DNA damage, apoptosis and invasion in UVM (Fig. 12F).
Fig. 12.
The function of FSCN1 in single-cell functional analysis from the CancerSEA database. A Functional status of FSCN1 in different human cancers. B–F Correlation analysis between functional status and FSCN1 in high-grade glioma, LUAD, colorectal cancer, retinoblastoma and UVM. (*p < 0.05; **p < 0.01; ***p < 0.001)
Drug sensitivity analysis
We used GSCA platform to investigate the drug sensitivity of FSCN1 in pan-cancers. As shown in Fig. 13A, FSCN1 expression was positively associated with 50% inhibitory concentration (IC50) of BHG712, GSK690693, I-BET-762, KIN001-102, Methotrexate, NPK76-II-72-1, PHA-793887, Phenformin, PIK-93, TAK-715, THZ-2-49, TPCA-1, WZ3105, YM201636 and ZSTK474, indicating higher FSCN1 expression may lead to drug resistance. Moreover, there was a negatively correlation between FSCN1 expression and IC50 values of 13 types of drug, including 17-AAG, AG-014699, Bleomycin (50 uM), CCT018159, CHIR-99021, Cisplatin, Docetaxel, Elesclomol, Gefitinib, JNK Inhibitor VIII, Midostaurin, RO-3306 and SB 216763, indicating a higher FSCN1 expression may increase drug sensitivity. Further validation of these drugs was made in LUAD samples in the TCGA database. The difference in mean IC50 between the high and low FSCN1-expressing groups was statistically significant in 2 drugs (Fig. 13B). I-BET-762 and Docetaxel were predicted to have better therapeutic effects on high FSCN1-expressing subgroup, as shown by the lower IC50 value.
Fig. 13.
The association of FSCN1 expression and drug sensitivity. A Predictive drugs based on the FSCN1 expression in pan-cancer from the GDSC database. B Sensitivity analysis for medical treatment in FSCN1 high expression groups and low expression groups of LUAD patients. (*p < 0.05; **p < 0.01; ***p < 0.001)
Knockdown of FSCN1 inhibits MESO proliferation and induces apoptosis
To further explore and validate the biological functions of FSCN1 in MESO, we introduced three distinct siRNAs into NCI-H2452 cells. The effects of FSCN1 knockdown on cell proliferation and apoptosis were assessed through CCK-8 and flow cytometry assays. The experimental results demonstrated that the knockdown of FSCN1 inhibited the proliferation of NCI-H2452 cells in si-FSCN1 #1 (p = 0.0006) and si-FSCN1 #2 (p = 0.0002) groups (Fig. 14A), with no statisitical significance in si-FSCN1 #3 group. Moreover, we used the Annexin V-FITC and PI double staining method and observed the apoptosis in NCI-H2452 cells. The results showed that FSCN1 knockdown notably induced apoptosis in si-FSCN1 #1 (p < 0.0001) and si-FSCN1 #2 (p = 0.0036) groups, especially promoting the early apoptosis process (Fig. 14B, C).
Fig. 14.
Proliferation and apoptosis analysis of FSCN1 knockdown in MESO cell. A CCK-8 assay was used to evaluate the effect of FSCN1 knockdown on the proliferation ability of NCI-H2452 cells. B, C Flow cytometry analysis of apoptosis rates in NCI-H2452 cells following FSCN1 knockdown. (*p < 0.05; **p < 0.01; ***p < 0.001)
Discussion
Epithelial-to-mesenchymal transition (EMT) is a dedifferentiation process that converts adherent epithelial cells into singular migrating cells, which are essential for embryonic development, oncogenic progression, and metastasis [38, 39]. Previous studies have shown that FSCN1, as a member of the actin cytoskeletal protein family, participates in the EMT process in multiple tumors, such as breast cancer, lung adenocarcinoma, ovarian cancer, squamous cell carcinoma and gastric cancer [38, 40–44]. FSCN1 is a downstream effector of SNAI2 in the promotion of EMT, and FSCN1 mRNA levels are significantly elevated after the induction of transforming growth factor β (TGF-β) expression [45]. Furthermore, studies have shown that FSCN1 is closely associated with MMP1 [46], MMP2 [47], MMP9 [48], and TGF-β [49]. Based on the potential significance of FSCN1 for the pathogenesis and progression of various tumors, we used a variety databases from UCSC Xena, TCGA, GTEx, HPA, cBioportal, STRING, CancerSEA, GDSC and Xiantao Academic to reveal the molecular characteristics of FSCN1 in pan-cancer from an overall perspective, including gene expression, prognosis, gene alterations, immune infiltration, DNA methylation, single cell function, regulator pathways and drug sensitivity.
Our study confirmed the significant high-expression of FSCN1 in 24 tumors and low-expression in LAML, PRAD and THCA from TCGA plus GTEx databases, while in TCGA paired samples there was a significant low-expression in KICH. The expression of FSCN1 was correlated with the pathologic stage, T stage and N stage. High-expressed FSCN1 in ACC, LUAD and TGCT usually indicated an advanced pathologic stage, T stage or N stage, while low-expressed FSCN1 in ESCA and THCA indicated an early pathologic stage, T stage or N stage. In addition, FSCN1’s high expression had an poor OS, DSS and PFI in ACC, COAD and MESO patients. The results presented above indicated that FSCN1 could serve as a diagnostic and prognostic biomarker for pan-cancer.
Tumor microenvironment denotes the non-cancerous cells and components presented in the tumor, including molecules produced and released by them. The constant interactions between tumor cells and the tumor microenvironment play decisive roles in tumor initiation, progression, metastasis, and response to therapies [50, 51]. Therefore, it’s vitally crucial to discuss the relationship between FSCN1 and tumor-associated immune cell infiltration. We found that FSCN1 expression had a positively association with 23 immune cells except Th17 cell in PRAD and a negatively relationship with 18 immune cells in ACC. Besides, FSCN1 expression had a positively associated with NK cell while a negatively relationship with Th17 cell in almost all tumor types, which might indicate that FSCN1 can promote the invasion of NK cell and inhibit the invasion of Th17 cell through certain pathways. Moreover, immune cells and stromal cells were the two main types of nontumor components and had been proposed to be valuable for the diagnosis and prognosis evaluation of tumors [52]. Our study found that FSCN1 was positively related to stromal score and immune score in 10 tumors and negatively in 3 tumors, suggesting that FSCN1 played an important role in TME. Furthermore, immune checkpoint has become a main target in drug research, and increasing evidence shows that blocking it is the most promising method in cancer immunotherapy [53]. We found that FSCN1 expression was positively or negatively correlated with many immune checkpoints such as BTLA, CTLA4, PDCD1, SIGLEC7, SIRPA and VSIR, indicating that FSCN1 may be a new target for tumor immunotherapy.
DNA methylation, a most common epigenetic modifications, plays an important role in gene expression, genomic stability and tumorigenesis [54]. We observed that in the FSCN1 gene promoter region, DNA mthylation levels always were lower than gene body region, suggesting that high FSCN1 expression was associated with hypomethylation of the gene promoter region. This finding indicated that FSCN1 might promote tumorigenesis through DNA methylation.
GO as well as KEGG enrichment analysis were performed on 100 co-expressed genes with FSCN1. We found that these genes mainly participated in some pathways about actin filament, which further demonstrated that FSCN1 promoted the oncogenic progression through affecting the actin cytoskeleton. Single-cell function analysis showed that FSCN1 was positively related to differentiation, inflammation and DNA repair in some tumors, but the interaction between FSCN1 and these cell functional processes were not completely comprehended and needed to be investigated further in future work. Furthermore, we analyzed the correlation between FSCN1 expression and the IC50 of 265 small molecular drugs using GDSC database. The result suggested that FSCN1 expression was closely related with sensitivity of many drugs, such as Phenformin, Bleomycin (50 uM) and Docetaxel. Further validations in LUAD found that I-BET-762 and Docetaxel showed a better therapeutic effect in the FSCN1 high expression subgroup. In addition, CCK-8 assay and flow cytometry apoptosis assay results demonstrated that FSCN1 knockdown inhibited proliferation and induced apoptosis in MESO. This undoubtedly provided a new perspective on how FSCN1 promotes the occurrence and development of tumors, but the specific molecular pathway mechanism might require more experiments for further verification.
Although we analyzed FSCN1 through a comprehensive and systematic process, using multiple databases and R 4.4.1 to cross-verify, some limitations remain. Firstly, our results were based on bioinformatic analyses, and the biological functions of FSCN1 only confirmed by CCK-8 and flow cytometry array in MESO, so other experimental studies are needed to validate our results. Secondly, although we concluded that FSCN1 expression was associated immune cell infiltration, it remains unclear how FSCN1 regulates immune response, and further study is needed. Thirdly, we combined several databases to analyze the role of FSCN1 in tumorigenesis, which could lead to systematic bias.
Conclusion
Our research systematically investigated that FSCN1 expression was significantly linked with clinical features, prognosis, mutational status, DNA methylation, immunology and drug sensitivity in multiple cancers, which helped us to better understand the potential role of FSCN1 in pan-cancer. However, to confirm the diagnostic and prognostic value of FSCN11, as well as to investigate underlying molecular mechanisms of tumor immunity, further prospective studies are required.
Acknowledgements
Not applicable.
Author contributions
Conceptualization, Q.G. and X.W.; methodology, Q.G. and X.W.; software, X.R. X.W., and D.C.; investigation, X.W. and D.C.; data curation, X.R. and X.W.; writing—original draft preparation, X.R. and X.W.; writing—review and editing, All authors; visualization, X.R. and X.W.; supervision, Q.G.; project administration, Q.G.; funding acquisition, Q.G.. All authors have read and agreed to the published version of the manuscript.
Funding
China Association for Promotion of Health Science and Technology (Grant No. JKHY2023003). Capital Health Development Scientific Research Special Project of Beijing Municipal Health Commission (Grant No. 2024-1-1023). Clinical Key Project of Peking University Third Hospital (Grant No. BYSYRCYJ2023001).
Data availability
Publicy available datasets were analyzed in this study. These data can be found as follows. We downloaded the RNA sequencing data, somatic mutation data, methylation data, as well as clinicopathological and survival data of 33 cancers in TCGA database and GTEx database from UCSC Xena browser (https://xenabrowser.net/datapages/). Immunohistochemistry images of FSCN1 protein expression were obtained from the HPA database (https://www.proteinatlas.org/). Other datasets analyzed are available in following online repositories, including Xiantao Academic (https://www.xiantaozi.com/), cBioPortal (http://www.cbioportal.org/), ICGC (https://www.icgc-argo.org), SMART (http://www.bioinfo-zs.com/smartapp/), STRING (https://cn.string-db.org/), CancerSEA (http://biocc.hrbmu.edu.cn/CancerSEA/) and GSCA (http://bioinfo.life.hust.edu.cn/GSCA/#/drug).
Declarations
Ethics approval and consent to participate
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rui Xu and Wanxin Xu have contribute equally to this work.
References
- 1.Ponting CP, Russell RB. Identification of distant homologues of fibroblast growth factors suggests a common ancestor for all beta-trefoil proteins. J Mol Biol. 2000;302(5):1041–7. 10.1006/jmbi.2000.4087. [DOI] [PubMed] [Google Scholar]
- 2.Hashimoto Y, Skacel M, Adams JC. Roles of Fascin in human carcinoma motility and signaling: prospects for a novel biomarker? Int J Biochem Cell Biol. 2005;37(9):1787–804. 10.1016/j.biocel.2005.05.004. [DOI] [PubMed] [Google Scholar]
- 3.Li Z, Shi J, Zhang N, Zheng X, Jin Y, Wen S, et al. FSCN1 acts as a promising therapeutic target in the blockade of tumor cell motility: a review of its function, mechanism, and clinical significance. J Cancer. 2022;13(8):2528–39. 10.7150/jca.67977. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Roma AA, Prayson RA. Fascin expression in 90 patients with glioblastoma multiforme. Ann Diagn Pathol. 2005;9(6):307–11. 10.1016/j.anndiagpath.2005.07.005. [DOI] [PubMed] [Google Scholar]
- 5.Hwang JH, Smith CA, Salhia B, Rutka JT. The role of Fascin in the migration and invasiveness of malignant glioma cells. Neoplasia. 2008;10(2):149–59. 10.1593/neo.07909. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Al-Alwan MM, Rowden G, Lee TD, West KA. Fascin is involved in the antigen presentation activity of mature dendritic cells. J Immunol. 2001;166(1):338–45. 10.4049/jimmunol.166.1.338. [DOI] [PubMed] [Google Scholar]
- 7.Gao W, Zhang C, Feng Y, Chen G, Wen S, Huangfu H, et al. Fascin-1, Ezrin and Paxillin contribute to the malignant progression and are predictors of clinical prognosis in laryngeal squamous cell carcinoma. PLoS ONE. 2012;7(11):e50710. 10.1371/journal.pone.0050710. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Chen Y, Tian T, Li Z-Y, Wang C-Y, Deng R, Deng W-Y, et al. FSCN1 is an effective marker of poor prognosis and a potential therapeutic target in human tongue squamous cell carcinoma. Cell Death Dis. 2019;10(5):356. 10.1038/s41419-019-1574-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Zhang Y, Liang B, Dong H. Expression of Fascin_1 protein in cancer tissues of patients with nonsmall cell lung cancer and its relevance to patients’ clinicopathologic features and prognosis. J Cancer Res Ther. 2018;14(4):856–9. 10.4103/jcrt.JCRT_732_17. [DOI] [PubMed] [Google Scholar]
- 10.Hashimoto Y, Ito T, Inoue H, Okumura T, Tanaka E, Tsunoda S, et al. Prognostic significance of Fascin overexpression in human esophageal squamous cell carcinoma. Clin Cancer Res. 2005;11(7):2597–605. 10.1158/1078-0432.CCR-04-1378. [DOI] [PubMed] [Google Scholar]
- 11.Zhang H, Xu L, Xiao D, Xie J, Zeng H, Cai W, et al. Fascin is a potential biomarker for early-stage oesophageal squamous cell carcinoma. J Clin Pathol. 2006;59(9):958–64. 10.1136/jcp.2005.032730. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Hashimoto Y, Shimada Y, Kawamura J, Yamasaki S, Imamura M. The prognostic relevance of Fascin expression in human gastric carcinoma. Oncology. 2004;67(3–4):262–70. 10.1159/000081327. [DOI] [PubMed] [Google Scholar]
- 13.Tsai W-C, Jin J-S, Chang W-K, Chan D-C, Yeh M-K, Cherng S-C, et al. Association of Cortactin and Fascin-1 expression in gastric adenocarcinoma: Correlation with clinicopathological parameters. J Histochem Cytochem. 2007;55(9):955–62. 10.1369/jhc.7A7235.2007. [DOI] [PubMed] [Google Scholar]
- 14.Iguchi T, Aishima S, Taketomi A, Nishihara Y, Fujita N, Sanefuji K, et al. Fascin overexpression is involved in carcinogenesis and prognosis of human intrahepatic cholangiocarcinoma: immunohistochemical and molecular analysis. Hum Pathol. 2009;40(2):174–80. 10.1016/j.humpath.2008.06.029. [DOI] [PubMed] [Google Scholar]
- 15.Bi J, Zhu Y, Chen X, Yu M, Zhang Y, Li B, et al. The role of Fascin in migration and invasion of urothelial carcinoma of the bladder. Urol Int. 2013;91(2):227–35. 10.1159/000346559. [DOI] [PubMed] [Google Scholar]
- 16.Jin J-S, Yu C-P, Sun G-H, Lin Y-F, Chiang H, Chao T-K, Tsai W-C, Sheu L-F. Increasing expression of Fascin in renal cell carcinoma associated with clinicopathological parameters of aggressiveness. Histol Histopathol. 2006;21(12):1287–93. 10.14670/HH-21.1287. [DOI] [PubMed]
- 17.Tong G-X, Yee H, Chiriboga L, Hernandez O, Waisman J. Fascin-1 expression in papillary and invasive urothelial carcinomas of the urinary bladder. Hum Pathol. 2005;36(7):741–6. 10.1016/j.humpath.2005.05.005. [DOI] [PubMed] [Google Scholar]
- 18.Franco EF, Rana P, Cruz A, Calderón VV, Azevedo V, Ramos RTJ, et al. Performance comparison of deep learning autoencoders for cancer subtype detection using multi-omics data. Cancers (Basel). 2021;13(9):2013. 10.3390/cancers13092013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Vivian J, Rao AA, Nothaft FA, Ketchum C, Armstrong J, Novak A, et al. Toil enables reproducible, open source, big biomedical data analyses. Nat Biotechnol. 2017;35(4):314–6. 10.1038/nbt.3772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Uhlén M, Fagerberg L, Hallström BM, Lindskog C, Oksvold P, Mardinoglu A, Sivertsson Å, Kampf C, Sjöstedt E, Asplund A, Olsson I, Edlund K, Lundberg E, Navani S, Szigyarto CA-K, Odeberg J, Djureinovic D, Takanen JO, Hober S, Alm T, Edqvist P-H, Berling H, Tegel H, Mulder J, Rockberg J, Nilsson P, Schwenk JM, Hamsten M, von Feilitzen K, Forsberg M, Persson L, Johansson F, Zwahlen M, von Heijne G, Nielsen J, Pontén F. Proteomics. Tissue-based map of the human proteome. Science. 2015;347(6220):1260419. 10.1126/science.1260419. [DOI] [PubMed]
- 21.Detection of immune checkpoint receptors—a current challenge in clinical flow cytometry. https://pubmed.ncbi.nlm.nih.gov/34276685/ (accessed 2025-12-11). [DOI] [PMC free article] [PubMed]
- 22.Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2012;2(5):401–4. 10.1158/2159-8290.CD-12-0095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Baylin SB, Jones PA. Epigenetic determinants of cancer. Cold Spring Harb Perspect Biol. 2016;8(9):a019505. 10.1101/cshperspect.a019505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li Y, Ge D, Lu C. The SMART app: an interactive web application for comprehensive DNA methylation analysis and visualization. Epigenetics Chromatin. 2019;12(1):71. 10.1186/s13072-019-0316-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Szklarczyk D, Gable AL, Lyon D, Junge A, Wyder S, Huerta-Cepas J, et al. STRING V11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019;47(D1):D607–13. 10.1093/nar/gky1131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yu G, Wang L-G, Han Y, He Q-Y. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS. 2012;16(5):284–7. 10.1089/omi.2011.0118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Yan Y, Tao H, He J, Huang S-Y. The HDOCK server for integrated protein-protein docking. Nat Protoc. 2020;15(5):1829–52. 10.1038/s41596-020-0312-x. [DOI] [PubMed] [Google Scholar]
- 28.Yan Y, Zhang D, Zhou P, Li B, Huang S-Y. HDOCK: a web server for protein-protein and protein-DNA/RNA docking based on a hybrid strategy. Nucleic Acids Res. 2017;45(W1):W365–73. 10.1093/nar/gkx407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Yan Y, Wen Z, Wang X, Huang S-Y. Addressing recent docking challenges: a hybrid strategy to integrate template-based and free protein-protein docking. Proteins. 2017;85(3):497–512. 10.1002/prot.25234. [DOI] [PubMed] [Google Scholar]
- 30.UniProt Consortium, T. UniProt: The universal protein knowledgebase. Nucleic Acids Res. 2018;46(5):2699. 10.1093/nar/gky092. [DOI] [PMC free article] [PubMed]
- 31.Seeliger D, de Groot BL. Ligand docking and binding site analysis with PyMOL and Autodock/Vina. J Comput Aided Mol Des. 2010;24(5):417–22. 10.1007/s10822-010-9352-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Laskowski RA, Swindells MB. LigPlot+: Multiple ligand-protein interaction diagrams for drug discovery. J Chem Inf Model. 2011;51(10):2778–86. 10.1021/ci200227u. [DOI] [PubMed] [Google Scholar]
- 33.Huang S-Y, Zou X. A knowledge-based scoring function for protein-RNA interactions derived from a statistical mechanics-based iterative method. Nucleic Acids Res. 2014;42(7):e55. 10.1093/nar/gku077. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Huang S-Y, Zou X. An iterative knowledge-based scoring function for protein-protein recognition. Proteins. 2008;72(2):557–79. 10.1002/prot.21949. [DOI] [PubMed] [Google Scholar]
- 35.Yuan H, Yan M, Zhang G, Liu W, Deng C, Liao G, et al. CancerSEA: a cancer single-cell state atlas. Nucleic Acids Res. 2019;47(D1):D900–8. 10.1093/nar/gky939. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Liu C-J, Hu F-F, Xia M-X, Han L, Zhang Q, Guo A-Y. GSCALite: a web server for gene set cancer analysis. Bioinformatics. 2018;34(21):3771–2. 10.1093/bioinformatics/bty411. [DOI] [PubMed] [Google Scholar]
- 37.Maeser D, Gruener RF, Huang RS. oncoPredict: an R package for predicting in vivo or cancer patient drug response and biomarkers from cell line screening data. Brief Bioinform. 2021;22(6):bbab260. 10.1093/bib/bbab260. [DOI] [PMC free article] [PubMed]
- 38.Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer. 2002;2(6):442–54. 10.1038/nrc822. [DOI] [PubMed] [Google Scholar]
- 39.Liu C, Wang S, Zhang X, Han Y, Tan M, Fan J, et al. The biomechanical signature of tumor invasion. Genes Dis. 2026;13(1):101771. 10.1016/j.gendis.2025.101771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Chiou S-H, Wang M-L, Chou Y-T, Chen C-J, Hong C-F, Hsieh W-J, et al. Coexpression of Oct4 and nanog enhances malignancy in lung adenocarcinoma by inducing cancer stem cell-like properties and epithelial-mesenchymal transdifferentiation. Cancer Res. 2010;70(24):10433–44. 10.1158/0008-5472.CAN-10-2638. [DOI] [PubMed] [Google Scholar]
- 41.Li J, Lu J, Ye Z, Han X, Zheng X, Hou H, Chen W, Li X, Zhao L. 20(S)-Rg3 blocked epithelial-mesenchymal transition through DNMT3A/miR-145/FSCN1 in Ovarian cancer. Oncotarget. 2017;8(32):53375–86. 10.18632/oncotarget.18482. [DOI] [PMC free article] [PubMed]
- 42.FSCN1 is upregulated by SNAI2 and promotes epithelial to mesenchymal transition in head and neck squamous cell carcinoma. https://pubmed.ncbi.nlm.nih.gov/28488774/ (accessed 2025-12-11). [DOI] [PubMed]
- 43.Pan Y, Chen J, Tao L, Zhang K, Wang R, Chu X, Chen L. Long noncoding RNA ROR regulates chemoresistance in docetaxel-resistant lung adenocarcinoma cells via epithelial mesenchymal transition pathway. Oncotarget. 2017;8(20):33144–58. 10.18632/oncotarget.16562. [DOI] [PMC free article] [PubMed]
- 44.Wang G, Gu Y, Lu W, Liu X, Fu H. Fascin1 promotes gastric cancer progression by facilitatingcell migrationand epithelial-mesenchymal transition. Pathol Res Pract. 2018;214(9):1362–9. 10.1016/j.prp.2018.06.018. [DOI] [PubMed] [Google Scholar]
- 45.Keshamouni VG, Jagtap P, Michailidis G, Strahler JR, Kuick R, Reka AK, et al. Temporal quantitative proteomics by iTRAQ 2D-LC-MS/MS and corresponding mRNA expression analysis identify post-transcriptional modulation of actin-cytoskeleton regulators during TGF-beta-induced epithelial-mesenchymal transition. J Proteome Res. 2009;8(1):35–47. 10.1021/pr8006478. [DOI] [PubMed] [Google Scholar]
- 46.Xu D-M, Chen L-X, Xue T, Zhuang X-Y, Wei L-C, Han H, et al. Decoding the impact of MMP1+ malignant subsets on tumor-immune interactions: insights from single-cell and spatial transcriptomics. Cell Death Discov. 2025;11(1):244. 10.1038/s41420-025-02503-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Tian S, Chen X, Li J. Zinc finger transcription factor ZNF24 inhibits colorectal cancer growth and metastasis by suppressing MMP2 transcription. Genes Dis. 2025;12(5):101529. 10.1016/j.gendis.2025.101529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Veljkovic A, Stanojevic G, Brankovic B, Roumeliotis S, Leivaditis K, Djordjevic B, et al. MMP-9 activation via ROS/NF-κB signaling in colorectal cancer progression: molecular insights and prognostic-therapeutic perspectives. Curr Issues Mol Biol. 2025;47(7):557. 10.3390/cimb47070557. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Tu M, Yin X, Zhuang W, Lin X, Xia Y, Huang Z, et al. NSG1 promotes glycolytic metabolism to enhance esophageal squamous cell carcinoma EMT process by upregulating TGF-β. Cell Death Discov. 2023;9(1):391. 10.1038/s41420-023-01694-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Xiao Y, Yu D. Tumor microenvironment as a therapeutic target in cancer. Pharmacol Ther. 2021;221:107753. 10.1016/j.pharmthera.2020.107753. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Sadeghi Rad H, Monkman J, Warkiani ME, Ladwa R, O’Byrne K, Rezaei N, et al. Understanding the tumor microenvironment for effective immunotherapy. Med Res Rev. 2021;41(3):1474–98. 10.1002/med.21765. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Fukumura D, Duda DG, Munn LL, Jain RK. Tumor microvasculature and microenvironment: novel insights through intravital imaging in pre-clinical models. Microcirculation. 2010;17(3):206–25. 10.1111/j.1549-8719.2010.00029.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Postow MA, Callahan MK, Wolchok JD. Immune checkpoint blockade in cancer therapy. J Clin Oncol. 2015;33(17):1974–82. 10.1200/JCO.2014.59.4358. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Pfeifer GP. Defining driver DNA methylation changes in human cancer. Int J Mol Sci. 2018;19(4):1166. 10.3390/ijms19041166. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All originate data downloaded from the Cancer Genome Atlas (TCGA) (https://cancergenome.nih.
gov/) database and and the Genotype-Tissue Expression (GTEx) database. TCGA consists of more than 20,000 primary cancer samples over 33 cancer types [18]. We used R 4.4.1 and GraphPad Prism 8.0.2 for statistical analysis and graphing.
Publicy available datasets were analyzed in this study. These data can be found as follows. We downloaded the RNA sequencing data, somatic mutation data, methylation data, as well as clinicopathological and survival data of 33 cancers in TCGA database and GTEx database from UCSC Xena browser (https://xenabrowser.net/datapages/). Immunohistochemistry images of FSCN1 protein expression were obtained from the HPA database (https://www.proteinatlas.org/). Other datasets analyzed are available in following online repositories, including Xiantao Academic (https://www.xiantaozi.com/), cBioPortal (http://www.cbioportal.org/), ICGC (https://www.icgc-argo.org), SMART (http://www.bioinfo-zs.com/smartapp/), STRING (https://cn.string-db.org/), CancerSEA (http://biocc.hrbmu.edu.cn/CancerSEA/) and GSCA (http://bioinfo.life.hust.edu.cn/GSCA/#/drug).














