Targeting TLR4/non-canonical NF-κB pathway by Bushen Bitong recipe enhances BMSCs-based cartilage repair in osteoarthritis

Abstract

Bushen Bitong Recipe (BSBT) is a traditional Chinese medicine used clinically for osteoarthritis, while bone marrow mesenchymal stromal cell (BMSCs) therapy is increasingly applied for its immunomodulatory and anti-inflammatory properties. However, their combined effects on osteoarthritis have not been investigated. In this study, BSBT containing serum reversed IL-1β induced apoptosis and improved the viability of BMSCs and chondrocytes. Co-treatment with BSBT and BMSCs further enhanced chondrocyte viability and migration, as shown by CCK-8 and Transwell assays. In vivo, X-ray imaging and histological staining (H&E and toluidine blue) demonstrated that the combined therapy preserved joint space, reduced osteophyte formation, and maintained cartilage structure with a more organized arrangement of chondrocytes.

At the mechanistic level, TUNEL staining revealed that the combined treatment markedly reduced chondrocyte apoptosis in articular cartilage compared with osteoarthritic controls. These findings were consistent with Western blot analysis, which showed decreased expression of pro-apoptotic proteins Bax and cleaved caspase-3 after co-treatment. Immunofluorescence staining further demonstrated reduced tissue level expression of TLR4, MyD88, and phosphorylated RelB (p-RelB), indicating attenuation of TLR4/non-canonical NF-κB signaling. Western blot and ELISA analyses supported these observations, showing suppression of TLR4/p-RelB and a concomitant decrease in pro-inflammatory cytokines and oxidative stress. Overall, these results suggest that BSBT and BMSCs exert synergistic protective effects on cartilage by reducing chondrocyte apoptosis and dampening inflammatory signaling, representing a promising therapeutic strategy for knee osteoarthritis.

Highlights

• •BSBT enhances BMSC therapy by reducing chondrocyte apoptosis.
• •BSBT + BMSCs combination improve cartilage structure and cell alignment in KOA rats.
• •Combination therapy promotes chondrocyte viability and migration.
• •Protection involves inhibition of TLR4/non-canonical NF-κB signaling.

1. Introduction

Knee osteoarthritis (KOA) is a chronic degenerative joint disease mainly caused by mechanical and biological factors such as excessive joint loading, inflammation and age-related changes [1]. The pathological features of KOA include articular cartilage degeneration, synovial inflammation, subchondral bone remodeling and osteophyte formation [2]. KOA affects more than 300 million people worldwide [3,4]. In China, 46% of men and up to 61% of women over the age of 50 are radiographically diagnosed with KOA [5]. This growing disease burden not only affects quality of life but also causes significant socioeconomic costs [6]. Current treatment strategies for KOA are primarily aimed at alleviating symptoms with anti-inflammatory and analgesic agents; however, in advanced stages, joint replacement is the main option. Therefore, elucidating the underlying mechanisms of action of KOA pathogenesis and developing new, effective cartilage repair strategies are of great importance.

In the cartilage matrix, the anabolic and catabolic processes are mainly disrupted by aging, mechanical overload, trauma, and metabolic disorders [2,7]. These factors cause excessive expression of matrix-degrading enzymes such as matrix metalloproteinases (MMPs), disintegrin, and metalloproteinase with thrombospondin motifs (ADAMTSs) [8,9]. These enzymes degrade key components of the extracellular matrix, including type II collagen and proteoglycans, thereby accelerating chondrocyte apoptosis, cartilage erosion, and joint dysfunction [10]. Recent advances in regenerative medicine have emphasized the therapeutic potential of mesenchymal stem cells (MSCs) in cartilage repair [11,12]. MSCs exert chondroprotective effects through immunomodulation, anti-inflammatory signaling, and paracrine activity, and also possess the ability to differentiate into chondrocytes and recruit progenitor cells to injured sites [13]. Bone-derived mesenchymal stem cells (BMSCs) are widely used among other types of MSCs due to their multipotent differentiation capacity, low immunogenicity, and ease of isolation [[14], [15], [16]]. Growth factors such as bFGF enhance the proliferation of BMSCs [17], however, their clinical application is limited due to their high cost.

Traditional Chinese Medicine (TCM), which consists of several components, has been used for thousands of years to prevent, diagnose and treat diseases. In recent decades, TCM or the active components of TCM have been shown to have promising effects on the proliferation and differentiation of BMSCs [18]. TCM offers an independent theoretical framework and application approach in stem cell research that emphasizes holism and syndrome differentiation in treatment [19]. TCM not only modulates stem cell behavior, but also improves the local microenvironment by enhancing blood circulation, reducing blood viscosity and inhibiting platelet aggregation. Bushen Bitong Recipe (BSBT), a classic TCM formulation, is often used to treat KOA. In chondrocytes, activation of TLR4 triggers the downstream NF-κB signaling cascades [20]. A key adaptor protein of TLR4 signaling, myeloid differentiation primary response 88 (MyD88), facilitates NF-κB activation, thereby promoting the release of pro-inflammatory cytokines and inducing apoptosis of chondrocytes [21]. Therefore, the TLR4/MYD88/NF-κB signaling pathway exerts multiple regulatory functions, including control of chondrocyte proliferation, apoptosis, pyroptosis, and cartilage metabolism. Inhibition of TLR4 activation and its downstream signaling cascade in chondrocytes could therefore suppress the release of inflammatory mediators and attenuate cartilage degeneration in KOA. However, it remains unclear whether the combined use of BSBT and BMSCs exerts a synergistic effect on cartilage repair in KOA. Therefore, it is of great importance to investigate the therapeutic potential of BSBT in combination with BMSCs.

In this study, we hypothesized that BSBT could enhance the therapeutic efficacy of BMSCs in knee osteoarthritis (KOA). The aim was to investigate the synergistic effect of BSBT and BMSCs on cartilage protection and repair while elucidating the underlying molecular mechanisms. This approach combines traditional Chinese medicine with stem cell-based therapeutic strategies and aims to improve treatment options for KOA.

2. Materials and methods

2.1. Materials

The following antibodies were purchased from proteintech: BAX (1:1500, Cat. 60267-1-Ig), Bcl2 (1:1500, Cat. 68103-1-Ig), Cleaved-Caspase-3 (1:1500, Cat. 19677-1-AP), GAPDH (1:1000, Cat. 60004-1-Ig). TLR4 (1:1500, Cat. 66350-1-Ig), MyD88 (1: 1000, Cat. AF5195), RelB (1:1000, Cat. A0519), and p-RelB (1:1000, Cat. PA5-36837) were obtained from Thermo Fisher Scientific. Unless otherwise specified, anti-mouse and anti-rabbit IgG secondary antibodies, along with other chemicals, were obtained from Sigma-Aldrich (Burlington, MA, USA).

2.2. Cell culture and animal

The primary rat bone marrow mesenchymal stem cells (BMSCs, PC-093) and rat chondrocytes (PC-078) cells were purchased from Procell (Wuhan, China). Cells were cultured in Alpha- Modified Eagle Medium (α-MEM) supplemented with 10% fetal bovine serum (FBS), 100 units/ml penicillin, and 50 μg/ml streptomycin. Cells were maintained at 37 °C in a humidified incubator with 5% CO2, and the medium was refreshed every 2-3 days.

Eight-week-old male Sprague-Dawley (SD) rats (specific pathogen-free, SPF grade) were obtained from the Laboratory Animal Center of Xinjiang Medical University (Production License No. SCXK[Xin]2023-0002). All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of Xinjiang Medical University and conducted in accordance with relevant ethical guidelines and regulations.

2.3. Preparation of BSBT-containing serum

Bushen Bitong Recipe (BSBT) was provided by the Traditional Chinese Medicine Hospital, Xinjiang Medical University. The formula consists of the following traditional Chinese medicinal herbs: Pheretima (9 g), Achyranthis Bidentatae Radix (15 g), Rehmanniae Radix Praeparata (15 g), Eucommiae Cortex (15 g), Spatholobi Caulis (15 g), Drynariae Rhizoma (15 g), Astragali Radix (15 g), Chuanxiong Rhizoma (12 g), Saposhnikoviae Radix (12 g), Angelicae Sinensis Radix (12 g), Angelicae Pubescentis Radix (12 g), and Carthami Flos (12 g). The human-equivalent dose was converted to a rat dosage of 16.35 g kg⁻¹ d⁻¹ based on body surface area according to the established procedure [22]. Rats were gavaged twice daily for 7 days. Two hours after the final administration, the rats were anesthetized with intraperitoneal sodium pentobarbital (20 mg/kg). Blood samples were collected aseptically from the abdominal aorta, allowed to clot for 1 h, and centrifuged at 1500 rpm for 20 min. The obtained serum (BSBT-containing serum) was heat-inactivated at 56 °C for 30 min and stored at −80 °C until use.

3. Effect of BSBT-containing serum on the proliferation of BMSCs and chondrocytes

To determine the optimal therapeutic concentration, BSBT-containing serum was prepared at various concentrations (0%, 5%, 10%, 15%, 20%, 25%, 30%). First, the effects of different BSBT-containing serum concentrations on the viability of BMSCs were evaluated. Subsequently, chondrocytes were pretreated with IL-1β (10 ng/mL) for 24 h to establish an osteoarthritic chondrocyte injury model. After model induction, the cells were treated with different concentrations of BSBT-containing serum, with or without IL-1β, to assess its effects on chondrocyte proliferation and viability.

3.1. Co-culture and cell viability assay

BMSCs and chondrocytes were cultured in a non-contact Transwell system using 24-well inserts with 0.4-μm pores, allowing exchange of soluble factors while preventing direct cell contact. Both chambers were supplied with the same complete medium to ensure uniform culture conditions. To establish an injury model, chondrocytes were pretreated with 10 ng/mL IL-1β for 24 h. After stimulation, 1 × 10⁵ chondrocytes were seeded in the lower chamber and 1 × 10⁵ BMSCs in the upper chamber. Cells were assigned to the following groups: control, IL-1β, IL-1β + BSBT, IL-1β + BMSCs, and IL-1β + BSBT + BMSCs. After 24 h of indirect co-culture, chondrocyte viability was evaluated using a CCK-8 assay. Briefly, the medium was replaced with fresh medium containing CCK-8 reagent and incubated for 2 h at 37 °C, followed by absorbance measurement at 450 nm. Blank wells were included for background correction. All experiments were performed in triplicate and analyzed statistically.

3.2. Cell migration assay

Chondrocytes pre-treated with IL-1β (10 ng/mL) were seeded into the upper chamber of a Transwell plate. According to the experimental groups, BMSCs and/or BSBT-containing serum were added to the lower chamber. After 24 h of incubation, the cells were fixed with 4% paraformaldehyde (PFA) for 10 min, and non-migrated cells on the upper surface of the membrane were gently removed with a cotton swab. Migrated cells on the lower surface were stained with crystal violet, visualized under an inverted microscope, and quantified using Image J software.

3.3. Determination of apoptosis

After the indicated treatments, chondrocytes were harvested and washed twice with pre-chilled PBS. Following centrifugation, the cells were resuspended in 100 μL of 1 × binding buffer. Then, 5 μL of Annexin V-FITC and 2 μL of propidium iodide (PI) were added, gently mixed, and incubated for 15 min at room temperature in the dark. After incubation, 300 μL of binding buffer was added to each sample, and cell apoptosis was analyzed using a flow cytometer (CytoFLEX S, Beckman Coulter, USA).

3.4. Knee Osteoarthritis (KOA) model establishment, grouping, and intervention

Rats were anesthetized with intraperitoneal sodium pentobarbital (20 mg/kg), and knee osteoarthritis (KOA) was induced using the modified Hulth method. The animals were randomly assigned to four groups (n = 10 per group): (1) Sham, (2) OA, (3) OA + BSBT, (4) OA + BMSCs, and (5) OA + BMSCs + BSBT. After successful model establishment, rats in the Sham and OA groups received intra-articular injections of 100 μL sterile saline, while rats in the OA + BMSCs and OA + BMSCs + BSBT groups received intra-articular injections of 100 μL BMSC suspension (200 cells/μL) once weekly. Additionally, rats in the OA + BMSCs + BSBT group were administered BSBT by oral gavage (16.35 g kg⁻¹ d⁻¹, twice daily). All interventions lasted 4 weeks, after which the rats were deeply anesthetized and euthanized by an overdose of sodium pentobarbital, and knee joint samples were subsequently collected for histological analysis.

3.5. Histopathological analysis of articular cartilage

Before fixation, knee joints were examined by X-ray to assess joint space narrowing, osteophyte formation, and overall structural changes across treatment groups. After imaging, bone samples were fixed in 10% paraformaldehyde (PFA) and decalcified in 14% EDTA for 21 days. Knee joint specimens were then dehydrated, embedded in paraffin, and sectioned at 4 μm. Sections were stained with hematoxylin and eosin (H&E) and toluidine blue following standard protocols. Cartilage morphology and pathological alterations were evaluated under a light microscope. Representative images were acquired, and all assessments were performed in a blinded manner.

3.6. ELISA assay

To clarify the anti-inflammatory and chondroprotective effects of the combination therapy, cytokine levels were measured both in vitro and in vivo. For the in vitro experiments, cell culture supernatants were collected from the following groups: Control, IL-1β, IL-1β + BSBT, IL-1β + BMSCs, and IL-1β + BSBT + BMSCs. For the in vivo studies, rats were assigned to the Sham, OA, OA + BSBT, OA + BMSCs, and OA + BMSCs + BSBT groups. Cytokine levels, including TNF-α, IL-1β, IL-6, and TGF-β1, were measured in serum samples. Additionally, cartilage repair and degradation biomarkers, including IGF-1, bFGF, and CTX-II, as well as oxidative stress markers such as superoxide dismutase (SOD), malondialdehyde (MDA), and glutathione (GSH), were quantified. All measurements were performed using commercially available ELISA kits according to the manufacturer's instructions.

3.7. Immunostaining and TUNEL apoptosis assay

To further assess molecular changes in the joint, immunofluorescence staining (IF) was performed on paraffin-embedded knee sections. After deparaffinization and antigen retrieval, sections were incubated with primary antibodies against TLR4, MyD88, and phosphorylated RelB to evaluate the effects of each intervention on the expression of key signaling targets at the tissue level. GFP fluorescent secondary antibodies were applied, and nuclei were counterstained with DAPI. Fluorescence signals were examined under an epifluorescence microscope, and images were acquired using identical exposure settings across groups, with quantification of the mean fluorescence intensity (MFI).

In addition, chondrocyte apoptosis was assessed using a TUNEL assay following the manufacturer's instructions. The proportion of TUNEL-positive cells within articular cartilage was quantified to determine whether the treatments (BSBT with/without BMSCs) mitigated OA-related chondrocyte apoptosis. All analyses were conducted in a blinded manner.

3.8. Western blot analysis

Cartilage tissues were homogenized, and total proteins were extracted using RIPA buffer. Protein concentrations were determined and normalized with a BCA protein assay. Equal amounts of protein were loaded and separated by SDS-PAGE, then transferred onto PVDF membranes. The membranes were blocked and incubated overnight at 4 °C with primary antibodies. After three washes with TBST, the membranes were incubated with secondary antibody (1:20,000) for 1 h at room temperature. Protein signals were visualized using ECL reagent (Cat. NCI5079, Thermo Fisher Scientific, USA) and quantified with ImageJ software.

3.9. Real-time quantitative polymerase chain reaction (RT-qPCR)

Cartilage tissues were homogenized in 1 mL TRIzol reagent, and total RNA was extracted using chloroform and precipitated with isopropanol. RNA concentration and purity were determined with a NanoDrop spectrophotometer. One microgram of RNA was reverse-transcribed into cDNA, and RT-qPCR was performed using SYBR Green chemistry with specific primers under the following cycling conditions: 95 °C for 10 s and 72 °C for 15 s for 40 cycles. Gene expression levels were normalized to GAPDH, and relative expression was calculated using the 2^−ΔΔCt method. All primers were synthesized by Wuhan Xavier Biotechnology Co., Ltd. (primer sequences are listed in Table 1).

Table 1.

Primer sequence list.

Gene	Primer sequence (5′-3′)	length/bp
GAPDH	F: ACTCCCATTCTTCCACCTTTG	105bp
	R: CCCTGTTGCTGTAGCCATATT
TLR4	F: TTATCCAGAGCCGTTGGTGT	171bp
	R: CCCACTCGAGGTAGGTGTTT
MyD88	F: GCTTTTCGACGCCTTCATCT	196bp
	R: AGAAACAACCACCACCATGC
Relb	F: CGGTCAACGTGTTCTTGCAG	112bp
	R: CGCTTTCGCTTCTTGTCCAC

3.10. Statistical analysis

All data were analyzed using SPSS 27.0 software (IBM, USA). Data with a normal distribution are presented as mean ± standard deviation (M ± SD), while non-normally distributed data are expressed as median (interquartile range). Comparisons among multiple groups were performed using one-way ANOVA followed by the LSD post hoc test, while comparisons between two groups were conducted using the student's t-test. A p value < 0.05 was considered statistically significant. Graphs were generated using GraphPad Prism 9.0 (GraphPad Software, USA).

4. Result

4.1. BSBT-containing serum stimulates cell proliferation of BMSCs and enhances IL-1β inhibited proliferation of osteoarthritic chondrocytes

To investigate the effects of BSBT on the biological activity of bone marrow-derived mesenchymal stem cells (BMSCs) and osteoarthritic chondrocytes, both cell types were treated with BSBT-containing serum at graded concentrations (0%, 5%, 10%, 15%, 20%, 25% and 30%) for 24 h. To determine the optimal BSBT concentration, cell proliferation activity was measured using the CCK-8 assay. We found that at a concentration of 10% and 15% BSBT containing serum, proliferation of BMSCs was significantly increased compared to control (Fig. 1A). In contrast, high concentrations such as 20% and 30% significantly decreased cell viability (Fig. 1A). Previous studies have reported that IL-1β inhibits the proliferation of osteoarthritic chondrocytes. So, we were interested in investigating whether BSBT-containing serum can rescue IL-1β inhibited chondrocyte proliferation. Interestingly, we found that BSBT-containing serum significantly reversed IL-1β inhibited proliferation of chondrocytes at concentrations of 5, 10 and 15%. The maximum effect was observed at 15%, while proliferation decreased at 20 and 25% (Fig. 1B).

Fig. 1.

Effects of BSBT on proliferation and migration of BMSCs and chondrocytes. (A) Effects of different concentrations of BSBT on the viability of BMSCs, compared with the control group (0%). ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001. (B) Effects of different concentrations of BSBT on the viability of chondrocytes after expose to IL-1β. ∗∗P < 0.01 vs. blank control group; #P < 0.05, ##P < 0.01, ###P < 0.001 vs. IL-1β group. (C) Cell viability of chondrocytes treated with BSBT and/or BMSCs in the presence of IL-1β. (D) Representative Transwell images showing chondrocyte migration in each group, bar = 25 μm. (E) Quantitative analysis of relative chondrocyte migration area in each group. ∗∗∗P < 0.001 vs. control group; ##P < 0.01, ###P < 0.001 vs. IL-1β group; △P < 0.05, ▲P < 0.01 vs. combine group.

As shown in Figs. 1B and 15% BSBT-containing serum optimally restored BMSC proliferation suppressed by IL-1β. Next, we were interested in investigating the combined effect of 15% BSBT-containing serum and BMSCs. To this end, we divided the chondrocytes into five groups and treated the cells with or without IL-1β as well as with BSBT and BMSCs alone and the combination of BSBT and BMSCs. Our results showed that both the 15% serum-containing BSBT and BMSCs groups alone significantly reversed the IL-1β induced cell proliferation effect (Fig. 1C). Interestingly, we found that the mixture of BSBT with 15% serum and BMSCs significantly abolished the cell proliferation inhibited by IL-1β compared with the BSBT and BMSCs groups alone (Fig. 1C). These results suggest that both BSBT and BMSCs promote chondrocyte proliferation under inflammatory conditions, with the combination of BSBT and BMSCs having the stronger effects. Next, we were interested in testing the cellular effects of BSBT and BMSCs after IL-1β inhibited cell proliferation. To this end, we first focused on cell migration and found that both BSBT and BMSC groups alone significantly maintained cell migration inhibited by IL-1β, analyzed by the Transwell migration assay. Interestingly, the combined treatment of BSBT and BMSCs showed a significantly greater effect than BSBT and BMSCs alone (Fig. 1D and E), suggesting that the combined application has the most robust protective and reparative effect on osteoarthritic chondrocytes.

4.2. Co-treatment with BSBT and BMSCs rescues chondrocytes from IL-1β induced apoptosis

Previous studies have shown that IL-1β induces apoptosis in chondrocytes [23], so we next focused on apoptosis and investigated whether BSBT and BMSCs rescue IL-1β induced apoptosis. Our results showed that both BSBT and BMSCs alone significantly reversed IL-1β induced apoptosis as determined by flow cytometry (Fig. 2A and B). Importantly, co-treatment with BSBT and BMSCs exhibited a stronger inhibitory effect on apoptosis than treatment of BSBT or BMSCs groups alone after introduction of IL-1β (Fig. 2A and B). Protein analysis by Western blotting also showed that IL-1β treatment induced pro-apoptotic Bax, reduced anti-apoptotic Bcl2, and induced the expression of cleaved caspase-3. In contrast, BSBT, BMSCs and the combination of BSBT and BMSCs significantly reversed IL-1β induced apoptosis markers. Significantly, the efficacy of apoptosis inhibition was higher in the group with BSBT and BMSCs than in the group with BSBT or BMSCs alone after IL-1β induction (Fig. 2C and D).

Fig. 2.

BSBT and BMSC co-treatment effectively attenuated IL-1β induced apoptosis in chondrocytes. (A, B) BSBT and BMSC treatments significantly reduced IL-1β induced apoptosis in chondrocytes, while the combination of BSBT and BMSCs exerted a stronger anti-apoptotic effect than either treatment alone analyzed by flow cytometry. (C) Western blot analysis of apoptosis-related proteins. Treatment with BSBT, BMSCs, or their combination reversed IL-1β induced apoptosis effects, with co-treatment eliciting the most pronounced anti-apoptotic response. (D) Quantification of protein expression levels of apoptosis-related proteins. ∗∗P < 0.01, ∗∗∗P < 0.001 vs. control; #P < 0.05, ##P < 0.01, ###P < 0.001 vs. IL-1β group; △P < 0.05, ▲P < 0.01 vs. combine group.

4.3. Combined therapy reduces inflammation and cartilage degradation in vitro and in vivo

To investigate the effect of the combined treatment on inflammation and cartilage degradation, we first performed an enzyme immunoassay (ELISA) to determine the levels of pro- and anti-inflammatory cytokines. We found that the culture medium incubated with IL-1β significantly increased the secretion of pro-inflammatory cytokines such as TNF-α and IL-6, while the secretion of anti-inflammatory cytokines such as TGFβ1 decreased (Fig. 3A). The medium supplemented with BSBT, BMSCs and BSBT + BMSCs significantly inhibited proinflammatory cytokines while inducing anti-inflammatory cytokines (Fig. 3A). Interestingly, the combined treatment had a robust inhibitory effect on pro-inflammatory cytokines and an inducing effect on anti-inflammatory cytokines (Fig. 3A). In addition, we found that the combined therapy promoted cartilage degradation markers such as IGF1 and bFGF and suppressed repair-associated factors such as CTX-ΙΙ compared to monotherapy after IL-1β induction (Fig. 3B). In agreement with the in vitro results, the outcomes of our in vivo experiment also showed that the combined therapy significantly inhibited pro-inflammatory cytokines and induced anti-inflammatory cytokines (Fig. 3C), while promoting cartilage degradation markers such as IGF1 and bFGF and suppressing repair-associated factors such as CTX-ΙΙ compared to monotherapy (Fig. 3D and E). In addition, we observed that both monotherapy and combination therapy enhanced oxidative defense by inhibiting MDA expression and inducing SOD and GSH expression (Fig. 3F). Most importantly, the enhancement of oxidative defense by combination therapy was significantly higher than that by monotherapy, suggesting that BMSC together with BSBT exerted a greater therapeutic effect.

Fig. 3.

BSBT and BMSC co-treatment mitigates inflammation and cartilage degradation in vitro and in vivo. (A) ELISA analysis of pro- and anti-inflammatory cytokines (TNF-α, IL-6, and TGF-β1) in chondrocyte culture supernatants following BSBT and/or BMSC treatment. (B) ELISA assessment of cartilage degradation- and repair-associated markers (IGF-1, bFGF, and CTX-II) after BSBT and/or BMSC treatment. (C) Changes in proinflammatory and anti-inflammatory cytokines in serum after BSBT and/or BMSC treatments in vivo. (D-E) Changes in expression levels of cartilage degradation- and repair-related markers in serum after BSBT and/or BMSC treatments. (F) Changes in expression of oxidative stress-related markers in serum after BSBT and/or BMSC treatments, including MDA, SOD, and GSH. Compared with the Sham group, ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001; compared with the OA group, #P < 0.05, ##P < 0.01, ###P < 0.001; compared with the OA + BSBT + BMSCs combine group, ΔP<0.05, ▲P < 0.01).

4.4. Combined BSBT and BMSC treatment enhances cartilage morphology by inhibiting apoptosis via TLR4/non-canonical NF-κB signaling pathway

To investigate whether the combined treatments with BSBT and BMSCs promotes cartilage repair and preserves joint integrity, we performed X-ray imaging followed by histologic staining, including hematoxylin–eosin (H&E) and toluidine blue. The X-ray results showed that the OA group exhibited the most pronounced joint space narrowing and prominent osteophyte formation, whereas treatment with either BSBT or BMSCs partially alleviated these radiographic changes. Notably, the combined BSBT + BMSCs intervention produced the greatest structural improvement, with a wider and more uniform joint space and reduced marginal bony outgrowths.

Histologic analyses provided further detail. In the Sham group, cartilage architecture was well preserved, with uniformly sized chondrocytes arranged in an orderly pattern and displaying normal morphology. The articular surface was smooth, the tide line remained intact, and the subchondral bone showed moderate thickness with continuous integration between cartilage and underlying bone. In contrast, the osteoarthritis (OA) group displayed marked degenerative alterations, including chondrocyte hypertrophy and heterogeneity, disorganized cellular arrangement, and evident morphological abnormalities. The cartilage surface was irregular and rough, with fissures and surface undulations; the tide line was blurred or absent, and the subchondral bone exhibited thinning or focal thickening with disrupted continuity.

Both BMSCs and BSBT treatments significantly attenuated cartilage degeneration and preserved overall histoarchitecture compared with the OA group. Importantly, the combined BSBT + BMSCs treatment produced more substantial histological improvement than BMSCs alone, characterized by smoother cartilage surfaces, more organized chondrocyte distribution, and restoration of subchondral bone structure, indicating superior therapeutic efficacy (Fig. 4B and C).

Fig. 4.

Co-treatment with BSBT and BMSCs restores cartilage structure. (A) Representative X-ray images of OA established knee joint, groups include Sham, OA, OA + BSBT, OA + BMSCs, and OA + BSBT + BMSCs, bar = 500 μm. (B–C) knee joint cartilage at 20 × magnification, stained with H&E (B) and Toluidine Blue (C), illustrating cartilage damage after surgery and the protective effects of BSBT and/or BMSC treatment, bar = 100 μm.

To clarify the impact of the treatments on chondrocyte apoptosis, we first assessed cell death at the tissue level using TUNEL staining (Fig. 5G and H). The OA group displayed a marked increase in TUNEL-positive chondrocytes within the articular cartilage, indicating extensive apoptosis compared with the Sham group. Treatment with either BSBT or BMSCs alone reduced the proportion of TUNEL-positive cells, whereas the combined BSBT + BMSC therapy produced the most pronounced decrease, suggesting a stronger protective effect on chondrocyte survival(Fig. 5H). These observations were corroborated by Western blot analysis (Fig. 6A and C), which showed that the OA group had elevated levels of the pro-apoptotic proteins BAX, cleaved caspase-3, and cleaved caspase-9, along with reduced expression of the anti-apoptotic protein Bcl-2. Both BSBT and BMSC monotherapies partially normalized these apoptotic markers, while the combination treatment exerted the greatest inhibitory effect on pro-apoptotic signaling and most effectively restored Bcl-2 expression. Together, the TUNEL and Western blot data indicates that BSBT and BMSCs, particularly in combination, significantly attenuated chondrocyte apoptosis in OA cartilage.

Fig. 5.

TUNEL assay and immunostaining evaluate BSBT/BMSCs combined therapy attenuates chondrocyte apoptosis and mediate signaling pathway. (A-B) Representative immunostaining images of knee joints from OA models subjected to different interventions, along with higher-magnification views of articular cartilage showing TLR4 expression. Quantification of mean fluorescence intensity is shown in (B). (C-D) Representative immunostaining images of knee joint sections from OA models, with corresponding higher-magnification views of articular cartilage showing MyD88 expression. Quantification of mean fluorescence intensity is shown in (D). (E-F) Representative immunostaining images of knee joint sections from OA models, with corresponding higher-magnification views of articular cartilage showing p-RelB expression. Quantification of mean fluorescence intensity is shown in (F). (G-H) Representative TUNEL staining images of knee joint sections from OA models under different interventions. The percentage of apoptotic chondrocytes is quantified in (H). Scale bars = 400 μm (upper panels) and 100 μm (lower panels). (compared with the Sham group, ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001; compared with the OA group, #P < 0.05, ##P < 0.01, ###P < 0.001; compared with the OA + BMSCs group, ΔP<0.05, ▲P < 0.01).

Fig. 6.

BSBT/BMSCs combined therapy suppresses the TLR4/non-canonical NF-κB signaling pathway in KOA. (A) Western blot analysis of non-canonical NF-κB pathway related proteins and apoptotic associated genes in different interventions. Representative images are shown, GAPDH was used as the loading control. (B) Quantification of relative protein expression levels of non-canonical NF-κB pathway related proteins. (C) Quantification of relative protein expression levels of apoptotic related proteins. (D) RT-qPCR analysis of non-canonical NF-κB pathway related gene expression under different interventions. (∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001 vs. Sham; #P < 0.05, ##P < 0.01, ###P < 0.001 vs. OA; ΔP < 0.05, ▲P < 0.01 vs. OA + BSBT + BMSCs).

We next examined whether these protective effects were associated with modulation of the TLR4/non-canonical NF-κB signaling pathway. Immunofluorescence staining of knee joint sections (Fig. 5) revealed strong signals for TLR4(A-B), MyD88(C-D), and phosphorylated RelB(E-F) in the OA group, indicating robust activation of this pathway at the tissue level. In contrast, BSBT or BMSC treatment alone visibly reduced the fluorescence intensity of these targets, while the combined BSBT + BMSC therapy led to the most pronounced attenuation of TLR4, MyD88, and p-RelB fluorescence intensity. Consistent with these findings, Western blot (Fig. 6A and B) and mRNA analyses (Fig. 6D) showed that both protein and transcriptional levels of TLR4, MyD88, and phosphorylated RelB were significantly upregulated in the OA group (P < 0.05) and were markedly decreased following treatment. Again, the combination therapy produced a greater suppressive effect than either monotherapy. Overall, these results suggest that BSBT in combination with BMSCs effectively inhibits activation of the TLR4/non-canonical NF-κB pathway, which likely contributes to the observed reduction in chondrocyte apoptosis and improved cartilage preservation in OA.

5. Discussion

In the management of KOA, various methods are employed, including physical therapy, pharmacotherapy, rehabilitation, acupuncture, massage, surgery, and herbal treatments [24]. These methods have different mechanisms, but most are associated with mediating inflammatory factors to alleviate KOA [25]. For example, acupuncture represses the activity of the MAPK pathway, and herbs modulate the Wnt/β-catenin and p38-MAPK signaling pathways to protect articular cartilage by promoting chondrocyte proliferation and preserving proteoglycans and collagen II [26]. The potential mechanism for treating KOA is more complex due to interactions among various factors within the knee joint. Nevertheless, the precise mechanisms of various TCM treatments have yet to be fully understood [27].

BMSCs are widely used in orthopedic regenerative medicine because of their self-renewal capacity and multilineage differentiation potential [28]. Under appropriate induction conditions, they can differentiate into osteoblasts, chondrocytes, adipocytes, and even neurons [29]. Accumulating evidence indicates that BMSCs can migrate to sites of tissue injury, where they exert immunomodulatory and paracrine effects that facilitate cartilage repair [30]. However, their clinical application is hindered by low post-transplantation survival and limited long-term efficacy. Emerging evidence highlights the regulatory roles of TCM formulations and compounds on BMSCs. For example, Duan et al. reported that Kidney-Tonifying traditional Chinese medicine improves the balance between bone and adipogenic differentiation of BMSCs [31]. In addition, Dong et al. demonstrated that TCM compounds such as puerarin and tetrandrine are involved in BMSC cartilage differentiation and regulate the expression of cartilage differentiation-related genes such as Col2a1, Mmp13, Tgfb1, and Sox-9, as well as proteins such as COL2A1, COL10A1, MMP13, and SOX-9 [32]. Studies have shown that Zuogui Wan alleviates BMSC senescence by modulating the Wnt/β-catenin signaling pathway [33]. Consistent with these findings, our findings provide preliminary evidence that BSBT-containing serum has therapeutic potential in enhancing BMSC function and contributing to cartilage protection. However, the absence of chemical profiling and batch-to-batch consistency assessment limits its translational applicability. Without identifying the major active constituents or verifying serum uniformity, it remains difficult to ensure reproducibility or consider clinical extension. Therefore, serum metabolomics or standardized quality-control assays, such as HPLC-based characterization of key components, represent important directions for future work to clarify the pharmacologically relevant constituents and improve the reliability of BSBT-containing serum in subsequent studies.

Chondrocyte apoptosis is a central pathological feature of KOA and plays a pivotal role in cartilage degradation [34]. The NF-κB signaling pathway, consisting of both canonical and non-canonical pathways, is a key contributor to KOA pathogenesis, as it regulates inflammatory responses, chondrocyte apoptosis, and extracellular matrix degradation [35,36]. IL-1β is a potent activator of NF-κB, suppressing chondrocyte proliferation and enhancing catabolic processes [37]. Notably, inhibition of NF-κB signaling has been shown to alleviate cartilage damage and promote regeneration in OA models [38]. In this study, we showed that the traditional Chinese medicine Bushen Bitong Recipe (BSBT) protects BMSCs from apoptosis and enhances their chondroprotective capacity, thereby improving the therapeutic efficacy of BMSC-based treatment for osteoarthritis. We also found that BSBT exerts direct anti-inflammatory and anti-apoptotic effects on IL-1β stimulated chondrocytes. For the first time, we demonstrated that the combination of BSBT and BMSCs produces synergistic effects in reducing cartilage damage and inflammation, indicating therapeutic potential for cartilage regeneration and osteoarthritis treatment. We also showed that BSBT or BMSCs alone enhance chondrocyte proliferation and migration while reducing apoptosis; notably, co-culture of BSBT with BMSCs produced a superior effect.

Taken together, BSBT enhances the therapeutic effect of BMSCs by modulating TLR4/non-canonical NF-κB signaling, thereby suppressing chondrocyte apoptosis and promoting cartilage repair in KOA. However, the specific contributions of BSBT and BMSCs to pathway regulation remain unclear. It is not yet known whether BSBT directly interacts with TLR4 or whether BMSCs, through paracrine factors, potentiate the inhibitory effect of BSBT on this pathway. These possibilities warrant further investigation to clarify the mechanistic division of labor between the two interventions. In addition, our study assessed non-canonical NF-κB activation primarily through RelB phosphorylation, upstream regulators such as NIK and IKKα phosphorylation were not examined. This represents a limitation, and future studies should include these upstream components to more comprehensively validate pathway involvement. A further limitation is the lack of identification of the specific bioactive compounds responsible for the observed effects. Future investigations employing metabolomics or network pharmacology are warranted to identify the active constituents underlying these mechanisms. Additionally, need to evaluate the translational potential of targeting this pathway, either alone or in combination with BSBT-derived bioactive compounds, to improve clinical outcomes in KOA.

6. Conclusions

The combination of BSBT and BMSCs may exert synergistic protective effects against KOA by suppressing chondrocyte apoptosis and promoting articular cartilage repair and regeneration. These effects are likely mediated, at least in part, through regulation of the TLR4/non-canonical NF-κB signaling pathway. Targeting the TLR4/non-canonical NF-κB axis may therefore represent a promising therapeutic strategy to inhibit chondrocyte apoptosis and improve clinical outcomes in the management of KOA.

Ethical approval

All procedures involving experimental animals were conducted in strict accordance with institutional guidelines for animal care and use and complied with the ARRIVE guidelines. The experimental protocol was approved by the Ethics Committee for Animal Experimentation of Xinjiang Medical University (Approval No. IACUC-20240227-58).

Funding

This research was funded by the Leading Talents of Scientific and Technological Innovation in Xinjiang Uygur Autonomous Region-High-level Leading Talents Project (2022TSYCLJ0007) , the Second Batch of the “Tianshan Talent” Youth Supporting Talent Program (Project No. 2023TSYCQNTJ0050), National Natural Science Foundation of China (grant no. 82371600) and by the Fundamental Research Funds for the Central Universities of Central South University (grant number 2023ZZTS0558).

CRediT authorship contribution statement

Wenyuan Xiang: Investigation, Resources, Validation, Visualization, Writing – original draft. Cheng Xiang: Data curation, Formal analysis, Investigation, Validation, Writing – original draft. Atikul Islam: Data curation, Writing – review & editing. Lin Yi: Validation, Visualization, Writing – original draft. Zhengxiao Ouyang: Project administration, Writing – review & editing. Rui Fang: Conceptualization, Funding acquisition, Methodology, Project administration, Writing – review & editing.

Declaration of competing interest

The authors claim no competing interests. All the authors have read and approved this manuscript.

Appendix A. Supplementary data

The following is the Supplementary data to this article:

Data availability

All data generated or analyzed during this study are included in this published article and its Supplementary Materials.