Spontaneously formed mesenchymal stem cell spheroids enhance alveolar bone regeneration and suppress inflammation following tooth autotransplantation

Abstract

Objectives

This study aimed to evaluate the effects of spontaneously formed mesenchymal stromal cells (MSCs) spheroids on alveolar bone regeneration and inflammatory responses following tooth autotransplantation in a murine model.

Methods

Spontaneous spheroids were generated from mouse calvaria-derived MC3T3-E1 cells using a low-adhesion culture system. Extracted molars were transplanted with spheroids embedded in a collagen-based scaffold. Monolayer cells, scaffold, and tooth-only groups served as controls. Bone regeneration was assessed by micro-CT and histological analyses at 1, 2, and 4 weeks post-transplantation. Gene expression related to osteogenesis and inflammation was analyzed by quantitative PCR.

Results

In vitro analyses demonstrated that MC3T3-E1 spheroids exhibited significantly increased alkaline phosphatase activity, mineralization, and expression of pluripotency and osteogenesis related genes compared with monolayer cells. In vivo, the spheroid group showed significantly enhanced new bone formation, with higher bone volume fraction (BV/TV) throughout the observation period (p < 0.05). Expression of osteogenic markers, including osteocalcin (OCN) and collagen type I, was significantly upregulated, whereas inflammatory cytokines IL-6 and TNF-α were consistently suppressed. Histological evaluation revealed organized collagen fiber alignment suggestive of periodontal ligament-like tissue regeneration.

Conclusions

MSC-derived spontaneous spheroids promote alveolar bone regeneration and suppress inflammatory responses following tooth autotransplantation. This spheroid-based strategy may improve regenerative outcomes in tooth autotransplantation.

1. Introduction

Autotransplantation of teeth is widely recognized as a biologically rational treatment option for tooth loss [1,2]. By utilizing non-functional autogenous teeth as donor teeth, this procedure can restore functional and esthetic outcomes comparable to those of natural teeth when favorable healing is achieved [3]. Compared with other prosthetic treatment modalities, tooth autotransplantation exhibits superior biocompatibility, contributes to alveolar bone preservation particularly in growing patients and demonstrates favorable esthetic and functional outcomes [4,5]. In addition, it offers high cost-effectiveness compared with dental implants and fixed partial dentures [6].

Despite its wide applicability across various age groups [[7], [8], [9]], the success of tooth autotransplantation is influenced by multiple factors, including the developmental stage of the donor tooth, recipient site morphology, surgical technique, and the biological condition of periodontal tissues during healing [10]. Adequate alveolar bone volume at the transplantation site and early alveolar bone regeneration are particularly critical for the long-term stability of the transplanted tooth [6,11]. Surgical trauma associated with transplantation induces inflammatory responses and vascular disruption, which may impair the function of periodontal ligament cells and osteoblasts [12,13]. Therefore, appropriate regulation of early inflammatory responses is essential for promoting periodontal healing and alveolar bone regeneration [14].

In recent years, stem cell–based therapeutic strategies have attracted increasing attention in bone regenerative medicine, with bone marrow–derived mesenchymal stromal cells (BM-MSCs) being predominantly utilized [15,16]. However, the invasive nature of bone marrow harvesting poses certain limitations for clinical application in dentistry. In contrast, cortical bone–derived mesenchymal stromal cells have emerged as a promising alternative because of their high proliferative and osteogenic potential, as well as the feasibility of obtaining sufficient cell numbers from small bone fragments. We previously demonstrated new bone formation using a tooth–cell–scaffold complex composed of cortical bone–derived mesenchymal stromal cells in an ectopic transplantation model [17,18]. Nevertheless, the newly formed bone exhibited a sparse trabecular structure, indicating the need for further improvement in bone quality to enhance the stability of transplanted teeth.

Mesenchymal stromal cell (MSC) spheroids, which form three-dimensional cellular aggregates, more closely mimic the in vivo microenvironment and promote physiological cellular behavior [19]. MSC spheroids have been reported to exhibit enhanced anti-inflammatory properties [20], tissue repair capacity [21], and osteogenic potential [[22], [23], [24]]. Our previous studies also demonstrated that MSC spontaneously formed spheroids under low-adhesion culture conditions showed higher expression of osteogenic differentiation related genes and greater bone forming ability than monolayer cultured cells [24,25]. Notably, even in the absence of osteogenic induction, bone-derived stem cell spheroids exhibit osteogenic potential in vivo [24].

However, these findings are primarily based on ectopic transplantation models, and investigations under intraosseous conditions that more closely resemble clinical situations remain limited. In particular, the effects of bone-derived stem cell spheroids on post-transplantation inflammatory responses and alveolar bone regeneration have not been fully elucidated. Therefore, the present study aimed to investigate whether bone-derived stem cell spheroids suppress inflammatory cytokine expression, enhance osteogenic marker expression, and promote alveolar bone regeneration within the transplanted periodontal environment. Through these evaluations, we sought to clarify the therapeutic potential of bone-derived stem cell spheroids in improving healing outcomes after tooth autotransplantation.

2. Materials and methods

An overview of the experimental protocol is shown in Fig. 1.

Fig. 1.

Experimental protocol. Schematic illustration of spheroid and monolayer cell delivery using an octacalcium phosphate/collagen (OCP/Col) scaffold. A circular bone defect with a diameter of 2.0 mm was created at the mandibular angle of 8-week-old C57BL/6 mice. Teeth (maxillary first or second molars) were transplanted into the right mandibular angle defect either alone or in combination with monolayer cells, spontaneously spheroids, and/or the OCP/Col scaffold. M1: maxillary first molar; M2: maxillary second molar.

2.1. Animals

Male C57BL/6J mice (3 and 6 weeks old) were obtained from Japan SLC (Hamamatsu, Japan) and housed under controlled temperature and humidity conditions with a 12-h light/dark cycle and ad libitum access to food and water. All animals were acclimatized for 1 week prior to experimentation. All animal procedures were approved by the Matsumoto Dental University Committee on Institutional Animal Care and Use (approval nos. 269 and 318) and were conducted in accordance with the guidelines of the National Institutes of Health (NIH), USA.

2.2. Preparation of spontaneous spheroids from the MC3T3-E1 cell line

Mouse calvaria-derived MC3T3-E1 osteoblast-like cells were cultured in α-minimum essential medium (α-MEM; Wako, Osaka, Japan) supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, Tokyo, Japan), 100 U/mL penicillin, and 100 μg/mL streptomycin (Sigma, Tokyo, Japan) at 37 °C in a humidified atmosphere containing 5% CO₂. Upon reaching 80–90% confluence, cells were detached using 0.05% trypsin–EDTA and seeded at a density of 1.5 × 10⁴ cells/cm² onto low-attachment culture dishes (60-mm diameter; artience, Japan). After 24 h of incubation, the resulting cell aggregates were defined as spontaneous spheroids. Cells seeded at the same density onto conventional two-dimensional culture dishes (60-mm diameter; Corning, Arizona, USA) and cultured for 24 h served as monolayer cells controls.

2.3. ALP and Alizarin Red S staining

MC3T3-E1 cells (5.0 × 10⁴ cells/well) were seeded into 24-well plates (Corning, Arizona, USA) and cultured for 24 h. Spontaneously formed spheroids were seeded onto separate 24-well plates and allowed to attach for 6 h. Cells were fixed with ethanol (95%) for 10 min at room temperature and stained using an alkaline phosphatase staining kit (Kosmo Bio, Tokyo, Japan) to evaluate ALP activity or with 2% Alizarin Red S solution (pH 4.2; FUJIFILM, Tokyo, Japan) to assess mineralized matrix formation. Staining was performed at 37 °C for 20 min. Samples were observed under a light microscope (BX70; Olympus, Tokyo, Japan).

2.4. Preparation of tooth–cell–scaffold constructs

A collagen-based artificial bone scaffold composed of octacalcium phosphate and collagen (OCP/Col; Bonarc® disk, Toyobo, Osaka, Japan) was used. The scaffold was trimmed to dimensions of 2.0 × 2.0 mm, and a pit measuring 1.0 × 1.5 mm was created to accommodate the extracted tooth. Maxillary first and second molars were extracted from 3-week-old male C57BL/6J mice euthanized by pentobarbital overdose. Extracted teeth were rinsed with α-MEM and maintained in the same medium until use.

Teeth were placed onto the scaffolds and seeded with either monolayer-cultured MC3T3-E1 cells (1 × 10⁶ cells suspended in 20 μL of α-MEM) or spheroids generated from the same number of cells, forming the monolayer cell group and spheroid group, respectively. Teeth placed onto cell-free scaffolds with an equivalent volume of α-MEM constituted the scaffold group, while teeth transplanted without scaffolds served as the control group. Prior to transplantation, all constructs were incubated at 37 °C in 5% CO₂ for 30 min to allow cell attachment.

2.5. Mandibular angle bone defect model and transplantation

Male C57BL/6J mice (8 weeks old; Japan SLC, Hamamatsu, Japan) were anesthetized by intraperitoneal injection of a medetomidine–midazolam–butorphanol mixture. Under local anesthesia with 2% lidocaine, a unilateral circular defect (2 mm in diameter) was created at the right mandibular angle using a round bur. Tooth–cell–scaffold constructs were implanted into the defect, followed by layered wound closure.

Animals were sacrificed at 1, 2, and 4 weeks postoperatively (n = 8 per group per time point). Harvested specimens were either snap-frozen in liquid nitrogen for molecular analysis or fixed in 4% paraformaldehyde for histological evaluation.

2.6. Real-time quantitative PCR (RT-qPCR)

Total RNA was extracted from MC3T3-E1 spheroids, monolayer cells, and transplanted tissues using TRIzol reagent (Invitrogen, Tokyo, Japan) according to a previously described method [24]. cDNA was synthesized using oligo(dT)₁₂-₁₈ primers, dNTPs, and ReverTra Ace (Toyobo, Osaka, Japan). Reverse transcription was performed at 42 °C for 60 min, followed by enzyme inactivation at 95 °C for 5 min.

RT-qPCR was performed using SYBR Premix Ex Taq II on a Thermal Cycler Dice Real-Time System II (Takara Bio, Shiga, Japan). The cycling conditions consisted of 40 cycles at 95 °C for 5 s and 60 °C for 30 s. Expression levels of pluripotency markers (SSEA1, Nanog, Oct4, and Sox2), osteogenic markers (Runx2, Sp7, OCN, OPN, and collagen type I, Peroistin), and inflammatory cytokines (IL-1β, IL-6, and TNF-α) were normalized to β-actin and analyzed using the ΔΔCt method. All experiments were performed in triplicate, and data are presented as the mean ± SD. Primer sequences are listed in Table 1.

Table 1.

Primer sequences for PCR.

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)
SSEA1	GCAGGGCCCAAGATTACTGAC	AAGCGCCTGGGCCTAAGAA
Nanog	CACCCACCCATGCTAGTCTT	ACCCTCAAACTCCTGGTCCT
Oct4	CTTCCCTCCAACCAGTTGCCCCAAAC	GACAGGGGGAGGGGAGGAGCTAGG
Sox2	GCGGAGTGGAAACTTTTGTCC	CGGGAAGCGTGTACTTATCCTT
Runx2	CTGCAAGCAGTATTTACAACAGAGG	GGCTCACGTCGCTCATCTT
Sp7	AGGCCTTTGCCAGTGCCTA	GCCAGATGGAAGCTGTGAAGA
OCN	TGAACAGACTCCGGCG	GATACCGTAGATGCGTTTG
OPN	CCCGGTGAAAGTGACTGATT	TTCTTCAGAGGACACAGCATTC
Type1 collagen	TCGGTCTTCCCGGTCAGAGAG	TTCAGCACCAGGGGATCCCTCACGTC
IL-6	CTGGGGATGTCTGTAGCTCA	CTGTGAAGTCTCCTCTCCGG
TNF-α	CACCATGAGCACAGAAAGCA	TAGACAGAAGAGCGTGGTGG
IL-1β	ACTCATTGTGGCTGTGGAGA	TTGTTCATCTCGGAGCCTGT
Periostin	ATCTGACATCATGACGACAAATGGT	GAAGGTGCTGCCACGAACAA

2.7. Micro-CT analysis

Specimens were analyzed using micro-CT (CosmoScan GX, Rigaku, Japan) at 90 kV and 88 μA, with a pixel size of 36 μm, a field of view of 18 mm, and a spatial resolution of 10.4 μm/pixel. The scanned images were reconstructed and analyzed using TRI/3D BON64 software (Ratoc, Tokyo, Japan). In each specimen, a cubic region of interest (ROI; 1.5 × 1.5 × 1.5 mm) was defined, centered on the mandibular angle bone defect and adjusted according to the position of the transplanted tooth. Within the ROI, total tissue volume (TV) and bone volume (BV) were measured, and the bone volume fraction (BV/TV) was calculated as an index of new bone formation.

2.8. Histological and immunohistochemical analyses

Tissue specimens were fixed in 4% formaldehyde for 48 h, decalcified in 10% EDTA (pH 7.4), and embedded in paraffin according to standard histological procedures. Sections (6 μm thickness) were prepared for histological and immunohistochemical analyses.

Hematoxylin and eosin (H&E) staining was performed to evaluate inflammatory responses and periodontal tissue regeneration at the transplantation site. Masson's trichrome staining was used to assess the distribution and organization of collagen fibers following transplantation.

Immunohistochemical staining was conducted to evaluate bone formation–related markers and local inflammatory responses. Primary antibodies included anti-Periostin/OSF-2 (1:200; bio-techne, Japan; AF2995), anti-Sp7 (1:250; GeneTex, CA, USA; GTX02884), anti-collagen type I (1:250; Abcam, Japan; ab21286), anti-OCN (1:250; Abcam, Japan; ab93876), and anti-IL-6 (1:250; Funakoshi, Japan; PAB16165). Immunoreactivity was visualized using ImmPRESS® anti-rabbit IgG (MP-7401; Vector Laboratories, Burlingame, CA, USA), ImmPRESS® anti-mouse IgG (MP-7402; Vector Laboratories) and ImmPACT® DAB (SK-4105; Vector Laboratories) according to the manufacturer's instructions. Sections were counterstained with hematoxylin, dehydrated, cleared in xylene, and mounted.

2.9. Statistical analysis

Statistical analysis was performed using Graphpad Prism 9 software (GraphPad Company, SnDiego, CA, USA). All data were retrieved from independent samples or observations. Values are presented as the mean ± standard deviation for each group. The normality of the data distribution was tested using the Shapiro-Wilk test and Brown-Forsythe test was used to assess homogeneity of variance. For two compared groups, statistical significance was evaluated by Student's t-test if the homogeneity of variance was consistent or evaluated by Satterthwaite's t-test if the homogeneity of variance was not equal.

Comparisons among four groups were conducted using one-way analysis of variance (ANOVA), followed by the Tukey post hoc test if the homogeneity of variance was consistent. If the homogeneity of variance was not equal, Kruskal-Wallis test was used to evaluate the statistical significance for multiple comparisons. P < 0.05 was considered statistically significant.

3. Results

3.1. Clinical findings

No visible signs of inflammation or infection were observed at the surgical sites in any mice, and all animals showed an uneventful postoperative course. No significant differences in body weight changes due to growth were observed among the groups throughout the experimental period.

3.2. Characteristics of spontaneously formed MC3T3-E1 spheroids

MC3T3-E1 cells exhibited a typical fibroblast-like spindle-shaped morphology (Fig. 2A), and neither alkaline phosphatase (ALP) nor Alizarin Red S staining was detected in monolayer cultures (Fig. 2B and C). In contrast, after 24 h of culture on low-adhesion dishes, spontaneous spheroid formation was observed (Fig. 2A). Strong ALP-positive staining was detected in the central region of the spheroids (Fig. 2B), and Alizarin Red S staining revealed intense mineral deposition, indicating the formation of calcified nodules within the spheroids (Fig. 2C).

Fig. 2.

Characteristics of monolayer cultures and spontaneously spheroids of MC3T3-E1 cells. Images of MC3T3-E1 cells cultured under monolayer conditions or as spontaneously formed spheroids are shown (A), together with ALP staining (B) and Alizarin Red S staining (C). Compared with monolayer cells, spontaneously spheroids exhibited a pronounced increase in ALP-positive cells and Alizarin Red S–positive mineralized areas. RT–qPCR analysis revealed significantly elevated expression of pluripotency markers (D), as well as osteogenic differentiation markers (E) in spontaneously spheroids relative to monolayer cells. All values represent the mean ± SD of triplicate experiments, Scale bar: 50μm. ∗p < 0.05, ∗∗p < 0.01.

The expression levels of pluripotency-related markers, including Oct4, Sox2, SSEA1, and Nanog, were significantly higher in spheroid cultures than in monolayer cultures (p < 0.05; Fig. 2D). Similarly, the expression of osteoblast-related genes, Runx2 and Sp7, was significantly upregulated in spheroid cultures compared with monolayer cultures (p < 0.05; Fig. 2E).

3.3. Micro–CT analysis

At 1 week after transplantation, radiopaque bone-like tissue formation around the root region was observed in the spheroid group, whereas minimal or no radiopaque tissue was detected in the monolayer cell, scaffold, and control groups (Fig. 3A). Quantitative micro-CT analysis demonstrated that the newly formed bone volume (BV/TV) in the spheroid group was significantly higher than that in the other three groups, particularly compared with the monolayer group (p < 0.05; Fig. 3B).

Fig. 3.

Evaluation of bone regeneration by micro–CT. Representative micro-CT reconstructed images of each group at 1, 2, and 4 weeks after transplantation (A). In the spheroid group, newly formed bone around the root region was observed at earlier time points and was more prominent than in the other groups. Quantitative analysis showed that the new bone volume (BV/TV) was significantly higher in the spheroid group than in the other groups throughout the observation period (B). Data are presented as mean ± SD, n = 6.

At 2 weeks after transplantation, bone-like tissue formation surrounding the root region was observed in all groups (Fig. 3A). Notably, the BV/TV value in the spheroid group remained significantly higher than those in the control (p < 0.0001) and scaffold groups (p < 0.05; Fig. 3B).

At 4 weeks after transplantation, radiopaque bone-like tissue formation was further increased in all groups compared with that at 1 and 2 weeks (Fig. 3A). The BV/TV value in the spheroid group continued to be significantly higher than those in the control (p < 0.0001) and scaffold groups (p < 0.05; Fig. 3B). Moreover, compared with the monolayer cell group, the spheroid group exhibited significantly greater bone formation, as indicated by higher BV/TV values, consistent with the pattern observed at 2 weeks.

3.4. Histological findings

Hematoxylin and eosin (H&E) staining at 1 week after transplantation revealed scattered inflammatory cell infiltration in all four groups. In the monolayer cell group, transplanted cells were clearly identifiable. In the spheroid group, transplanted spheroids were observed (red arrowheads in Fig. 4A), and osteoblasts were detected around newly formed bone (yellow arrowheads in Fig. 4A).

Fig. 4.

Histological analysis. Hematoxylin and eosin (H&E) staining showed evident new bone formation in the spheroid group at 2 and 4 weeks post-implantation(A). Masson's trichrome staining at 4 weeks post-implantation showed that some collagen fibers were continuous with newly formed bone or bone-like tissue and oriented obliquely or perpendicularly in the spheroid group(B). POSTN-positive staining was observed around the transplanted tooth in all groups at 4 weeks post-transplantation (C). RT–qPCR at 2 weeks post-implantation showed significantly higher POSTN expression in the spheroid group than in the control, scaffold, and monolayer groups (D). All values represent the mean ± SD of triplicate experiments. B: newly formed bone; D: dentin; Red arrowheads: spheroids; Yellow arrowheads: osteoblasts; Black arrowheads: osteoclasts; Red arrows: foreign body giant cell. Black arrows: POSTN; Scale bar: 500 μm (low magnification), 50 μm (high magnification).

At 2 weeks after transplantation, fibroblast-like cells were present in all groups. In the spheroid group, progression of new bone formation was evident, and osteoblasts (yellow arrowheads in Fig. 4A) and osteoclasts (black arrowheads in Fig. 4A) were observed at the margins of the newly formed bone.

At 4 weeks after transplantation, fibroblasts were observed around the transplanted tooth in all groups. Inflammatory cells were present in the scaffold and monolayer cell groups, and multinucleated foreign body giant cells were additionally detected in these groups (red arrows in Fig. 4A). Newly formed bone was observed in the spheroid and monolayer cell groups (Fig. 4A).

Masson's trichrome staining demonstrated densely stained collagen fibers surrounding the transplanted tooth in all groups at 4 weeks after transplantation (Fig. 4B). Although most collagen fibers exhibited a random orientation, the spheroid and monolayer cell groups showed partially oblique or vertically oriented fibers connecting newly formed bone or cementum-like tissue, suggestive of a periodontal ligament–like structure. In contrast, the control group (tooth only) exhibited fewer vertically oriented fibers, with most fibers arranged parallel to the root surface.

To investigate the effect of spheroids on periostin expression, immunohistochemical staining for periostin was performed in each group at 4 weeks. Strong periostin immunoreactivity was observed in all groups, particularly in regions where it was deposited along thick collagen fibers (Fig. 4C). RT–qPCR analysis demonstrated that periostin expression in the spheroid groups peaked at 2 weeks and was significantly higher than in the other groups (p < 0.01; Fig. 4D). Moreover, periostin levels in the spheroid group were consistently elevated compared with those in the monolayer groups at all examined time points.

3.5. Osteogenic marker expression

Immunohistochemical staining for Sp7 revealed numerous strongly positive cells around the transplanted tooth in the spheroid group at 1 and 2 weeks after transplantation, indicating higher osteogenic activity compared with the other groups (Fig. 5A). No marked differences in Sp7 immunoreactivity were observed among the groups at 4 weeks after transplantation. RT-qPCR analysis showed that Sp7 expression was highest in the spheroid group at 1 week; however, at 2 and 4 weeks, its expression was significantly lower than that in the monolayer cell group (p < 0.01; Fig. 5D).

Fig. 5.

Expression of osteogenic markers after transplantation. In the spheroid group after transplantation, immunohistochemical staining showed increased Sp7-positive cells around the transplanted tooth at 1 and 2 weeks (A). Collagen type I staining was strongest at 1 week (B), while OCN staining was more intense at 2 and 4 weeks (C). RT-qPCR analysis demonstrated that Sp7 expression was highest at 1 week (D), collagen type I expression was significantly higher at 2 weeks (E), and OCN and OPN expression levels were significantly elevated at 2 and/or 4 weeks (F, G). All values represent the mean ± SD of triplicate experiments. Scale bar: 500 μm (low magnification), 50 μm (high magnification).

Immunohistochemical staining for collagen type I showed the strongest positivity in the spheroid group at 1 week after transplantation compared with the other groups, whereas no apparent differences were observed at 2 and 4 weeks (Fig. 5B). RT-qPCR analysis revealed that collagen type I expression was highest in the control group at 1 week after transplantation but decreased at later time points. In contrast, collagen type I expression in the spheroid group was significantly higher than that in the monolayer cell and control groups at 2 weeks after transplantation (p < 0.05). At 4 weeks, collagen type I expression in the spheroid group was lower than that in the monolayer cell group, with no statistically significant difference (Fig. 5E).

Immunohistochemical staining for OCN demonstrated stronger positivity in the spheroid group at 2 and 4 weeks after transplantation compared with the other groups (Fig. 5C). Consistently, RT-qPCR analysis showed that OCN expression reached its highest level at 2 weeks after transplantation in the spheroid group, and was significantly higher than that in the monolayer cell groups at 2 weeks after transplantation (p < 0.05; Fig. 5F). Furthermore, OPN expression in the spheroid group was significantly higher than that in the monolayer cell group at both 2 weeks (p < 0.05) and 4 weeks (p < 0.01) after transplantation (Fig. 5G), indicating enhanced osteogenic activity.

3.6. Inflammatory cytokine expression

Immunohistochemical staining for IL-6 demonstrated the strongest positive reactions in the scaffold group at all examined time points (1, 2, and 4 weeks after transplantation) compared with the other groups (Fig. 6A). Consistent with these findings, RT-qPCR analysis showed that IL-6 expression in the spheroid group was significantly lower than that in the control and scaffold groups. In contrast, the scaffold group exhibited significantly higher IL-6 expression at 1 and 2 weeks after transplantation than the other groups (p < 0.05; Fig. 6B).

Fig. 6.

Expression of inflammatory cytokines after transplantation. Immunohistochemical staining for IL-6 is shown (A). The scaffold group exhibited the strongest IL-6–positive staining at all examined time points (1, 2, and 4 weeks after transplantation) compared with the other groups. Quantitative analysis demonstrated that IL-6 expression levels in the spheroid group were significantly lower than those in the control and scaffold groups (B). In contrast, IL-6 expression in the stent group was significantly higher than in the other groups at 1 and 2 weeks after transplantation. TNF-α expression (C) in the spheroid group was the lowest at 1 week after transplantation and remained stable at 2 and 4 weeks, with no significant fluctuations. All values represent the mean ± SD of triplicate experiments. Scale bar: 500 μm (low magnification), 50 μm (high magnification).

Regarding TNF-α expression, the spheroid group showed the lowest levels at 1 week after transplantation, and these low levels were maintained at 2 and 4 weeks, with no marked temporal changes. In contrast, the monolayer cell group exhibited significantly higher TNF-α expression at 4 weeks after transplantation compared with the spheroid group (p < 0.05). The scaffold group also showed significantly elevated IL-6 and TNF-α expression at 1 and 2 weeks after transplantation (Fig. 6C).

These results indicate that inflammatory cytokine expression was consistently suppressed in the spheroid group, whereas the scaffold group exhibited a transient increase in pro-inflammatory cytokine expression during the early post-transplantation period.

4. Discussion

In the present study, we comprehensively investigated the effects of spontaneously formed spheroids derived from the mouse osteoblast-like cell line MC3T3-E1 on the bone microenvironment during the healing process following tooth autotransplantation. Comparisons were performed among the spheroid group, monolayer cell group, scaffold group, and control group (tooth only), focusing on inflammatory responses, bone formation, and histological changes at the transplantation site. The spheroid group exhibited pronounced bone-like tissue and fibrous tissue formation from the early stages after transplantation, accompanied by suppressed expression of inflammatory cytokines. These findings suggest that MSC spheroids may improve the post-transplantation healing environment and thereby promote periodontal tissue regeneration.

With respect to bone regeneration promoting effects, spontaneously formed MC3T3-E1 spheroids demonstrated enhanced osteoblastic lineage activation and mineralized matrix formation in vitro compared with monolayer cells. Consistent with these findings, in vivo analyses using micro-CT and histological evaluation clearly demonstrated that the spheroid group exhibited more efficient bone regeneration. In particular, the significantly increased newly formed bone volume (BV/TV) observed at 1 and 2 weeks after transplantation compared with the other groups indicates that spheroids strongly promote early-stage bone formation within the post-transplantation bone microenvironment.

Spontaneously formed MC3T3-E1 spheroids exhibited significantly higher expression levels of pluripotency-associated markers (SSEA1, Nanog, Oct4, and Sox2) as well as osteogenesis related markers (Runx2 and Sp7) compared with monolayer cells. These results suggest that spontaneous spheroid formation may maintain and enhance stem cell multipotency. Moreover, increased cell density and enhanced intercellular signaling within spheroids may contribute to improved cell survival and osteogenic potential, potentially through the establishment of a favorable microenvironment within the spheroid [26,27].

Immunohistochemical staining and RT-qPCR analyses demonstrated that the expression of osteogenesis-related markers, including Periostin, OCN and OPN, was upregulated at early time points in the spheroid group, with particularly pronounced expression at 2 weeks after transplantation. These findings indicate enhanced osteoblast activation and accelerated bone matrix formation in the spheroid group. In contrast, although Sp7 expression was initially higher in the spheroid group, its expression at 2 and 4 weeks after transplantation was higher in the monolayer cell group. This difference may be attributed to more rapid progression of osteoblast differentiation in the spheroid group, resulting in an earlier transition to a mature osteoblastic stage and a relative decrease in Sp7 expression during later phases.

The presence and orientation of collagen fibers are critical determinants of functional periodontal ligament regeneration, as they contribute to load transmission and tissue integration. Masson's trichrome staining revealed partially vertically oriented collagen fibers in the spheroid group, extending between newly formed bone and cementum like structures, suggesting a more physiologically organized reconstruction of periodontal ligament like tissue. In contrast, the control group exhibited limited vertically oriented collagen fibers, indicating a less organized extracellular matrix architecture.

Periostin is a matricellular protein that plays a pivotal role in periodontal regeneration by regulating collagen fibrillogenesis, extracellular matrix organization, and cell–matrix interactions [28]. In the present study, periostin expression in the spheroid group peaked at 2 weeks and was significantly higher than in the other groups. Particularly periostin levels in the spheroid group remained consistently elevated compared with those in the monolayer group at all examined time points. This sustained upregulation of periostin may facilitate the alignment and maturation of collagen fibers, thereby promoting the formation of a functionally oriented periodontal ligament like structure. Collectively, these findings indicate that periodontal tissue regeneration in the spheroid group more closely approximated functional periodontal morphology.

Although bone formation was also observed in the monolayer cell group, its extent was limited compared with that in the spheroid group. This difference may be explained by the increased susceptibility of two-dimensionally cultured cells to apoptosis under acute inflammatory conditions following transplantation, leading to reduced cell survival after implantation [29].

The present study further demonstrated the utility of spheroids in modulating the inflammatory microenvironment. Analysis of inflammatory cytokine expression revealed that the scaffold group exhibited a pronounced inflammatory response at 1 and 2 weeks after transplantation, while the monolayer cell group showed a significant increase in TNF-α expression at a later stage (4 weeks). In contrast, the spheroid group consistently maintained low levels of inflammatory cytokine expression throughout the entire observation period. This pattern suggests that spheroid formation contributes to sustained immunomodulation at the transplantation site, thereby creating a microenvironment favorable for bone regeneration.

IL-6 plays a central role in the early inflammatory phase following transplantation, and excessive IL-6 expression has been reported to suppress osteoblast function and promote bone resorption [30,31]. In the present study, IL-6 expression was significantly suppressed in the spheroid group at 1 and 2 weeks after transplantation, indicating that spheroids may regulate acute post-transplantation inflammation. Appropriate control of inflammation is critical for alveolar bone regeneration, as excessive inflammatory responses can lead to increased bone resorption and delayed healing.

In addition to improved cell survival, MSC spheroids have been reported to secrete increased levels of immunomodulatory cytokines and to induce macrophage polarization toward the M2 phenotype [32]. These anti-inflammatory effects are considered key contributors to improved regenerative outcomes in autologous tooth transplantation. Consistent with this concept, TNF-α expression—an inflammatory cytokine known to inhibit stem cell proliferation—was maintained at low levels throughout the entire observation period in the spheroid group. These findings suggest that spontaneously formed spheroids may regulate the early inflammatory microenvironment after transplantation and help maintain conditions favorable for bone formation.

The experimental model used in this study involved tooth transplantation into a mandibular angle bone defect in mice and does not fully replicate the clinical conditions of autologous tooth transplantation in humans. Nevertheless, this model closely reflects key pathological aspects relevant to evaluating alveolar bone regeneration and periradicular healing. It is well established that the success of autologous tooth transplantation depends on effective control of early post-transplantation inflammation, survival of periodontal ligament cells, and rapid regeneration of surrounding bone [10].

In the present study, suppression of inflammatory responses, induction of osteogenesis related markers, and enhanced bone regeneration were observed, suggesting that MSC-derived spontaneous spheroids may have potential as an adjunctive therapeutic strategy for promoting periodontal tissue regeneration following tooth autotransplantation. Taken together, these findings support the possibility that the adjunctive use of MSC-derived spontaneous spheroids could contribute to improved periodontal healing and alveolar bone regeneration, and may help to enhance the predictability and long-term stability of tooth autotransplantation.

5. Conclusion

Spontaneously spheroids derived from the mouse osteoblast-like cell line MC3T3-E1 effectively suppressed early inflammatory responses and promoted bone formation following tooth autotransplantation, resulting in improved periodontal tissue regeneration. Compared with conventional monolayer cell transplantation, spheroid-based cell delivery demonstrated clear regenerative advantages, highlighting the critical role of three-dimensional cellular organization in modulating the post-transplantation healing microenvironment. These findings provide a strong biological rationale for the application of spontaneous spheroids in autologous tooth transplantation and support their potential as a versatile platform for cell-based regenerative therapies. Further optimization and validation in large-animal models, including determination of optimal seeding density and appropriate cell sources for spheroid formation, will be necessary to facilitate future clinical translation.

CRediT authorship contribution statement

Zhu Wen: Writing-original draft, Methodology, Formal analysis. Xianqi Li: Conceptualization, Project administration, Supervision, Resources, Data curation, Formal analysis, Writing-review & editing. Lei Yue, Jingjing Kong, Lingli Lan and Naoto Oguchi: Conducted part of the experiments and collected the data. Katsumitsu Shimada: contributed to formal analysis. Jing Yang, Bingjian Lyu and Yuji Kurihara: Methodology, Formal analysis, Study design. Michiko Yoshizawa: Conceptualization, Methodology, Supervision, Resources, Funding acquisition, Writing-review & editing.

Funding

This study was supported by JSPS KAKENHI Grant Numbers JP24K13121 and JP25K13074.

Declaration of competing interest

The authors state that there is no conflict of interest regarding this manuscript.