Abstract
Objective
This study aimed to investigate the mechanism by which GLP-1 RAs activate the Sema3A/NRP1 signaling pathway to alleviate inflammation and endothelial dysfunction in atherosclerosis (AS).
Methods
Ten 8-week-old male C57BL/6J mice served as controls (CON) and received intraperitoneal injections of saline every 2 days. Forty ApoE−/− mice were fed a 60 kcal% fat high-fat diet for 12 weeks. From weeks 13 to 24, the ApoE−/− mice were randomly divided into 4 groups (n = 10): AS model group (AS, saline injections), low/high-dose GLP-1 RAs group (L/H-GLP-1 RAs, 30/60 μg/kg semaglutide injections) and atorvastatin group (ATO, 1.3 mg/kg atorvastatin injections as a positive control). For rescue experiments, endothelial-specific NRP1 knockout (NRP1EC-KO) mice were generated. Thirty NRP1WT mice were divided into 3 groups (n = 10): NRP1WT control group (NRP1WT CON), the NRP1WT AS model group (NRP1WT AS) and the NRP1WT AS model + high dose GLP-1 RAs group (NRP1WT + H-GLP-1 RAs). While twenty NRP1EC-KO mice were divided into NRP1EC-KO AS and NRP1EC-KO + H-GLP-1 RAs groups (n = 10). Mouse body weight was monitored weekly during interventions, and mice were euthanized with 120 mg/kg pentobarbital sodium at the end of experiments. HUVECs were divided into five groups (n = 3): CON, ox-LDL, L-GLP-1 RAs, H-GLP-1 RAs, ATO. Except for controls, cells were treated with 100 μg/mL ox-LDL for 24 h to establish the model. CCK-8 assays determined low/high semaglutide doses (1/2 μM), while atorvastatin was applied at 10 μM. Rescue experiments included CON, ox-LDL, H-GLP-1 RAs, and NRP1 inhibition + H-GLP-1 RAs groups, with the latter pre-treated with 0.5 μM NRP1 inhibitor EG01377 for 2 h before interventions.
Results
Compared to controls, AS group mice exhibited significant weight gain from week 15 (P < 0.001), while H-GLP-1 RAs and ATO groups showed reduced weight from week 21 (P < 0.05). The AS group had elevated serum TC, LDL-C, IL-6, HDL-C, TNF-α, ET-1, TG levels, and percentage of plaque collagen-positive area (P < 0.001), alongside decreased NO levels (P < 0.001), all of which were improved by GLP-1 RAs (P < 0.05). H&E staining revealed reduced inflammatory cell infiltration in aortic roots of semaglutide- and atorvastatin-treated mice. Aortic tissues from AS group mice showed decreased Sema3A/NRP1 expression and binding (P < 0.05), increased p-ERK1/2/ERK1/2 and p-NF-κB p65/NF-κB p65 ratios (P < 0.05), which were reversed by semaglutide, with higher doses showing greater effects. Immunofluorescence confirmed that Sema3A and NRP1 mainly localized in vascular endothelial cells. In ox-LDL-induced HUVECs, GLP-1 RAs improved cell viability, migration capacity, and tubule numbers (P < 0.05), reduced IL-6 and TNF-α levels (P < 0.05), upregulated eNOS (P < 0.05), and downregulated VCAM-1 and ICAM-1 (P < 0.05). Western blot and co-immunoprecipitation results aligned with in vivo trends. In vitro, EG01377 reversed GLP-1 RAs' protective effects (P < 0.05). In vivo, GLP-1 RAs' therapeutic efficacy was significantly weakened in NRP1EC-KO mice (P < 0.05).
Conclusion
GLP-1 RAs alleviate inflammation and endothelial dysfunction to reduce the atherosclerosis progression by activating the Sema3A/NRP1 pathway and inhibiting downstream ERK1/2-NF-κB signaling.
Keywords: atherosclerosis, GLP-1 receptor agonists, NRP1, Sema3A, semaglutide, vascular endothelium
1. Introduction
Atherosclerosis (AS) represents the primary pathological basis of cardiovascular diseases. It can induce life-threatening complications such as myocardial infarction, cerebral infarction and renal atrophy, and has become a global public health burden (1). Excessive activation of inflammatory response and vascular endothelial dysfunction are the core pathological processes in the development of AS (2). Endothelial dysfunction compromises the integrity of vascular barrier, promoting lipid deposition and inflammatory cell infiltration, while the release of inflammatory factors further amplifies pathological damage and accelerates disease progression (3). The semaphorin (SEMA) family has now been widely recognized as a pivotal regulator of vascular homeostasis in both physiological and pathological contexts (4). Among them, Sema3A as a secreted glycoprotein, binds to the receptor complex composed of NRP1, a transmembrane glycoprotein receptor, and plexin A family members to regulate cell migration, proliferation and fibrosis (5). Evidence indicates that Sema3A expression is downregulated in hemodynamically sensitive regions of atherosclerotic lesions, suggesting that it may act as a potential protective factor (6). Meanwhile, NRP1 has been shown to regulate endothelial vascular permeability signaling (7), promote angiogenesis, and play a critical protective role in AS (8). Another study highlights that Sema3A and NRP1 exerts anti-atherosclerotic effects by maintaining endothelial junction integrity and suppressing pro-inflammatory gene transcription (9). These results collectively demonstrate that the Sema3A/NRP1 pathway may contributes to the regulation of angiogenesis, endothelial cell stability, and inflammatory responses, and is associated with the formation and progression of atherosclerotic plaques. Recent studies have shown that GLP-1 RAs exert cardioprotective effects independent of glucose-lowering effects (10). Research indicates that GLP-1 RAs significantly reduce the risk of adverse cardiovascular events in non-diabetic obese adults (11). The vasodilatory property of GLP-1 RAs improve endothelial function, while their anti-proliferative and anti-inflammatory effects may synergistically inhibit AS progression (12). However, whether the Sema3A/NRP1 signaling pathway mediates the cardiovascular protective effects of GLP-1 RAs remains unclear. Based on this, this study aims to investigate the molecular mechanisms by which GLP-1 RAs activate the Sema3A/NRP1 signaling pathway to alleviate inflammatory response and endothelial dysfunction, ultimately mitigating AS progression. Our findings may provide novel molecular targets for clinical treatment of AS and offer theoretical support for the cardiovascular protective effects of GLP-1 RAs.
2. Materials and methods
2.1. Chemicals and reagents
Semaglutide (HY-114118, CAS: 910463-68-2), atorvastatin (ATO, HY-B0589, CAS: 134523-00-5), NRP1 inhibitor EG01377 (HY-112151, CAS: 2227996-00-9) were purchased from MedChemExpress (Shanghai, China). Ox-LDL with purity ≥ 98% (IO1300) was obtained from Solarbio (Beijing, China). TC (A111-1-1), LDL-C (A113-1-1), IL-6 (H007-1-2), NO (A013-2-1), TG (A110-1-1), TNF-α (H052-1-2), ET-1 (H093-1-2) and HDL-C (A112-1-1) assay kit were procured from Nanjing Jiancheng (Jiangsu, China). H&E staining kit (C0105S), RIPA lysis buffer (P0013B), BCA assay kit (P0010S), antibody crosslink immunoprecipitation kit with protein A + G magnetic beads (P2180S), oil red O staining kit (C0157S), hypersensitive chemiluminescent liquid (ECL) kit (P0018S), DAPI staining solution (C1006) and matrix-gel™ basement membrane matrix (C0372) were procured from Beyotime (Shanghai, China). Anti-Sema3A (ab199475), anti-α-SMA (ab124964), anti-NF-κB p65 (ab32536), anti-ICAM-1 (ab171123), anti-GAPDH (ab181602), anti-p-NF-κB p65 (ab76302), anti-IgG (ab133470), anti-CD31 (ab222783), anti-eNOS (ab199956), anti-VCAM-1 (ab134047) and anti-NRP1 (ab81321) antibody were supplied by Abcam (Shanghai, China). Anti-p-ERK1/2 antibody (4370T) was provided by Cell Signaling Technology (Shanghai, China). PBS (10010023), DMEM (11965092) and 0.25% trypsin digestion solution (25200056) were supplied by ThermoFisher (Shanghai, China). CCK-8 kit (CK04) was sourced from Dojindo (Shanghai, China).
2.2. Animals and treatments
Eight-week-old male C57BL/6J mice and apolipoprotein E deficient (ApoE−/−) mice (20–22 g) were obtained from Charles River (Beijing, China). Experimental animal production license No. SCXK (Jing) 2021-0006. Mice were transferred to an SPF-grade animal facility for a 7-day acclimatization period. During this period, all mice were maintained under a 12-h light/dark cycle with free access to water and standard maintenance diet, and no experimental interventions were performed. After the 7-day acclimatization period, the experiment officially commenced. Ten C57BL/6J mice in the control group (CON) continuing to be fed the standard maintenance diet, while forty ApoE−/− mice were divided into 4 groups (n = 10): the AS model group (AS), the low/high-dose GLP-1 RAs groups (L/H-GLP-1 RAs) and the atorvastatin group (ATO). All ApoE−/− mice was fed a high-fat diet (60 kcal % fat) for the initial 12 weeks of the experiment (13). No drug or vehicle injections were administered to any mice during this period. Only routine feeding, weekly body weight monitoring, and health assessments were conducted. The CON group and the AS group received intraperitoneal injection of normal saline every day during the 13–24 weeks of the experiment. Similarly, the L/H-GLP-1 RAs groups received intraperitoneal injections of 30/60 μg/kg semaglutide every day, respectively (14), while the ATO group received intraperitoneal injection of 1.3 mg/kg/day atorvastatin every 2 days as the positive control (15). The U.S. Food and Drug Administration specifies that the standard dose of semaglutide for adult patients (70 kg) is 1–1.5 mg per week (subcutaneous injection, approximately 0.0020–0.0031 mg/kg/day), with a maximum approved dose of 2.4 mg per week (approximately 0.0049 mg/kg/day). Based on standard animal-to-human dose conversion (mouse conversion factor = 12.3), the corresponding mouse equivalent doses are approximately 25.1–37.7 and 60.2 μg/kg/day, respectively. The dose used in this study is similar to the clinical human equivalent dose. During the intervention period, body weight changes were monitored weekly. On the final day of the experiment, mice were humanely euthanized by intraperitoneal administration of 120 mg/kg sodium pentobarbital, followed by the collection of aortic root tissues and serum samples. All animal experiments were performed in compliance with the animal ethics guidelines of Jiangxi Provincial People's Hospital (The First Affiliated Hospital of Nanchang Medical College), including the ARRIVE 2.0 guidelines and the Chinese National Standard GB/T 35892-2018, Approval number: JX2024092.
2.3. Construction of endothelium-specific NRP1 knockout mice
Tie2-Cre+ mice and NRP1flox/flox mice were obtained from Cyagen Biosciences (Suzhou, China). Experimental animal production license No. SYXK (Yue) 2025-0242. The primers used for mouse genotyping are provided as follows. NRP1flox forward primer: AAGGAGTGGCACAGCATCTT, NRP1flox reverse primer: TCACACCCAAACTTCCTTCC; Tie2-Cre+ forward primer: TAGGAACCAATGAAATGCGAGGT, Tie2-Cre+ reverse primer: AACCAGCGTTTTCGTTCTGC. Endothelial-specific NRP1 knockout (NRP1EC-KO) mice were generated using the Cre/loxP gene editing system through crossbreeding of ApoE−/− mice with NRP1flox/flox; Tie2-Cre+ mice. Successful endothelium-specific NRP1 knockout was confirmed via qPCR and the mice were subsequently used in experiments. Thirty NRP1WT mice were divided into NRP1WT control group (NRP1WT CON), NRP1WT AS model group (NRP1WT AS), and NRP1WT AS model + high-dose GLP-1 RAs group (NRP1WT + H-GLP-1 RAs) (n = 10). Twenty NRP1EC-KO mice were assigned to NRP1EC-KO AS model group (NRP1EC-KO AS) and NRP1EC-KO AS model + high-dose GLP-1 RAs group (NRP1EC-KO + H-GLP-1 RAs) (n = 10). Other intervention procedures followed those described in Section 2.2.
2.4. Cell culture and treatments
HUVECs were cultured in DMEM and maintained in a incubator at 37 °C with 5% CO2. Cells in the control group (CON) received standard culture conditions without additional treatment. Cells in the ox-LDL treatment group (ox-LDL) were exposed to 100 μg/mL ox-LDL for 24 h to induce cellular injury (16). Following successful model establishment, cells were treated with 0.1, 0.5, 1, 2, 5, or 10 μM semaglutide. Cell viability was assessed to determine optimal experimental concentrations. Based on the results, 1 μM semaglutide was selected for the low-dose GLP-1 RAs group (L-GLP-1 RAs) and 2 μM semaglutide for the high-dose GLP-1 RAs (H-GLP-1 RAs) group. The atorvastatin group (ATO) received 10 μM atorvastatin treatment as a positive control after model induction (17). Rescue experiments included the CON group, ox-LDL group, H-GLP-1 RAs group and the NRP1 inhibitor and high-dose GLP-1 RAs combined treatment group (NRP1 inhibition + H-GLP-1 RAs). For the latter group, cells were pretreated with 0.5 μM NRP1 inhibitor EG01377 for 2 h before exposure to ox-LDL and high-dose semaglutide (18). All cell experiments were independently repeated 3 times.
2.5. Biochemical indices inflammation factors and endothelial factor detection
NO, TC, LDL-C, IL-6, TG, TNF-α, ET-1 and HDL-C levels in mouse blood or serum and IL-6, TNF-α levels in HUVECs culture supernatant were measured. Absorbance values were read using Varioskan LUX microplate reader (ThermoFisher, Waltham, USA).
2.6. Oil red O staining
Mouse aortic root sections were stained with Oil Red O and hematoxylin, then mounted. Tissue morphology was observed and images captured under DM3000 optical microscope (Leica, Wetzlar, Germany).
2.7. H&E staining
Paraffin sections were stained with hematoxylin and eosin, then mounted with neutral balsam. Morphology and inflammatory cell infiltration in aortic root plaques were analyzed under an optical microscope.
2.8. WB analysis
Mouse aortic tissues or HUVECs were collected and lysed to prepare protein samples. Following standard blocking procedures, samples were incubated overnight with primary antibodies (1:1000). The next day, secondary antibodies (1:5000) were applied for 1 h, followed by ECL chemiluminescent detection. ImageJ software was used to quantify protein band intensities normalized to GAPDH.
2.9. Co-immunoprecipitation (CO-IP) assay
Protein extracts from mouse aortic tissues or HUVECs were incubated with protein A/G agarose beads and Sema3A antibody, then incubate overnight. The next day, samples were centrifuged at 3,000 rpm at 4 °C for 5 min to collect precipitates, which were then denatured. WB analysis was performed using NRP1 antibody (1:1000), with subsequent steps following those described in Section 2.8.
2.10. Immunofluorescence (IF) assay
Mouse aortic tissues were fixed and sectioned into 8 μm-thick frozen slices. After blocking, sections were incubated with Sema3A, NRP1, CD31 or α-SMA antibody at 4 °C overnight. The following day, corresponding fluorescent secondary antibodies (1:500) were applied for 1 h. Tissues were mounted after nuclear staining with DAPI, then mounted and observed under LSM 880 microscope (Zeiss, Auberkheim, Germany).
2.11. CCK-8 assay
HUVECs were seeded in 96-well plates. CCK-8 reagent was added to each well, followed by incubation for 1 h. The absorbance at 450 nm was measured using a microplate reader.
2.12. Wound healing assay
HUVECs were seeded in 6-well plates. Uniform scratches were created perpendicular to the bottom of the wells using a 200 μL tip, after which the designated treatments were applied. Images of the same field were captured under an optical microscope.
2.13. Tube formation assay
HUVECs were seeded in 96-well plates pre-coated with Matrigel matrix gel and subjected to experimental treatments. Cells were cultured for 6 h. Tube formation was observed under an optical microscope.
2.14. Statistical analysis
All experimental data were analyzed using SPSS 22.0. Quantitative data were expressed as mean ± standard deviation (SD). Pairwise comparisons between groups were conducted using the least significant difference t-test, and comparisons among multiple groups were performed with one-way analysis of variance. Statistical significance was defined as P < 0.05.
3. Results
3.1. GLP-1 RAs ameliorate atherosclerotic phenotypes and inflammatory responses in mice
Figure 1A showed that the body weight of MOD mice exhibited significantly higher body weights compared to CON mice from the 15th week (P < 0.001). Starting from week 21, both high dose semaglutide and ATO-treated mice showed significantly reduced body weights compared to MOD mice (P < 0.05). Figures 1B–L reveal that compared to the CON mice, MOD mice exhibited elevated levels of TC, ET-1, IL-6, TG, TNF-α, LDL-C/HDL-C and percentage of collagen-positive area in plaque (P < 0.001), alongside decreased NO levels (P < 0.001). Following semaglutide treatment at different doses, the above indicators were remarkably improved (P < 0.05). Histopathological analysis of aortic root sections using H&E staining (Figure 1M) revealed inflammatory cell infiltration in the atherosclerotic model mice, characterized by small cell size, deeply blue-stained nuclei, and scant cytoplasm (outlined in yellow), while semaglutide and ATO interventions reduced tissue inflammation.
Figure 1.
Effects of glucagon-like peptide-1 receptor agonists (GLP-1 RAs) on atherosclerotic (aS) phenotypes and inflammatory responses in mice. (A) Mouse body weight. *P < 0.05, **P < 0.01, ***P < 0.001 vs. CON group; #P < 0.05, ##P < 0.01 vs. MOD group; %P < 0.05 vs. L-GLP-1 RAs group. (B) Mouse triglycerides (TG) level. (C) Mouse total cholesterol (TC) level. (D) Mouse low-density lipoprotein cholesterol (LDL-C) level. (E) Mouse high-density lipoprotein cholesterol (HDL-C) level. (F) Mouse LDL-C/HDL-C ratio. (G) Mouse interleukin-6 (IL-6) level. (H) Mouse tumor necrosis factor-alpha (TNF-α) level. (I) Mouse endothelin-1 (ET-1) level. (J) Mouse nitric oxide (NO) level. (K) Percentage of collagen-positive area in mouse plaque. Collagen-positive area (%) = (collagen-positive area/plaque area) × 100%. (L) Oil red O staining of mouse aortic sinus. (M) Hematoxylin and eosin staining of mouse aortic sinus. The area outlined by the yellow box shows inflammatory cell infiltration. All data are presented as mean ± standard deviation. n = 10. CON, control group; AS, AS model group; L-GLP-1 RAs, low-dose GLP-1 RAs (semaglutide) group; H-GLP-1 RAs, high-dose GLP-1 RAs (semaglutide) group; ATO, atorvastatin group. *P < 0.05, **P < 0.01, ***P < 0.001.
3.2. GLP-1 RAs upregulate Sema3A/NRP1 expression and binding levels in aortic tissues of atherosclerotic mice and inhibit downstream ERK1/2 signaling activation
WB analysis (Figures 2A,B) revealed that compared to the CON group, MOD group exhibited significantly reduced Sema3A and NRP1 expression in aortic tissues (P < 0.001), alongside significantly increased p-ERK1/2/ERK1/2 and p-NF-κB p65/NF-κB p65 ratios (P < 0.001). After treatment with GLP-1 RAs, Sema3A and NRP1 levels were significantly upregulated (P < 0.05), while the p-ERK1/2/ERK1/2 ratio was markedly decreased (P < 0.05). In the regulation of Sema3A and NRP1, high-dose GLP-1 RAs demonstrated more pronounced effects compared to low-dose GLP-1 RAs and ATO (P < 0.001). Co-IP results (Figure 2C) demonstrated that Sema3A-NRP1 binding in aortic tissues of atherosclerotic mice was lower compared to normal mice, whereas GLP-1 RAs treatment increased the binding level. IF colocalization (Figures 2D,E) confirmed that Sema3A and NRP1 mainly localized in endothelial cells.
Figure 2.

Effects of glucagon-like peptide-1 receptor agonists (GLP-1 RAs) on the semaphorin 3A (Sema3A)/neuropilin-1 (NRP1) pathway and downstream signaling in mouse aorta tissues. (A,B) Western blot analysis of Sema3A, NRP1, phosphorylated extracellular signal-regulated kinase 1/2 (p-ERK1/2)/ERK1/2, and p-nuclear factor kappa-B p65 (NF-κB p65)/NF-κB p65 protein expression levels in aortic tissues. (C) Co-immunoprecipitation assay to detect Sema3A-NRP1 protein binding in aortic tissues. (D,E) Triple immunofluorescence labeling to assess the colocalization of Sema3A and NRP1 with the endothelial cell marker cluster of differentiation 31 (CD31) and the smooth muscle cell marker alpha smooth muscle actin (α-SMA). All data are presented as mean ± SD. n = 10. CON, control group; AS, atherosclerotic (AS) model group; L-GLP-1 RAs, low-dose GLP-1 RAs (semaglutide) group; H-GLP-1 RAs, high-dose GLP-1 RAs (semaglutide) group; ATO, atorvastatin group. *P < 0.05, **P < 0.01, ***P < 0.001.
3.3. GLP-1 RAs improve vascular endothelial cell function and suppress inflammation in ox-LDL-induced HUVECs
The CCK-8 assay results in Figure 3A showed the treatment of ox-LDL-induced HUVECs with semaglutide at concentrations of 0.1, 0.5, 1, 2, 5, 10 μM. At semaglutide concentrations of 1, 2, 5 and 10 μM, HUVECs cell viability was significantly higher compared to the MOD group (P < 0.05). However, when the semaglutide concentration increased to 10 μM, no further dose-dependent enhancement in viability was observed (P > 0.05). Based on these results, 1 μM semaglutide was selected as the experimental dose for the L-GLP-1 RAs group and 2 μM for the H-GLP-1 RAs group. Figures 3B–H demonstrated that in the ox-LDL-induced HUVECs injury model, high dose GLP-1 RAs and ATO interventions significantly improved cell viability, migration capacity, and tube node number (P < 0.05), while simultaneously decreased IL-6 and TNF-α levels (P < 0.01). WB analysis (Figures 3I,J) revealed that ox-LDL induction markedly suppressed eNOS expression (P < 0.001) and upregulated VCAM-1 and ICAM-1 expression (P < 0.001). The changes in the expression of the above factors were significantly reversed following GLP-1 RAs and ATO treatments (P < 0.05).
Figure 3.
Effects of glucagon-like peptide-1 receptor agonists (GLP-1 RAs) on oxidized low-density lipoprotein (ox-LDL)-induced inflammation and dysfunction in vascular endothelial cells. (A) Human umbilical vein endothelial cells (HUVECs) were treated with 0.1, 0.5, 1, 2, 5, or 10 μM GLP-1 RAs (semaglutide) to assess cell viability and determine low and high doses of semaglutide. (B) Cell viability assay. (C) IL-6 levels in cell culture supernatants. (D) TNF-α levels in cell culture supernatants. (E,F) Wound healing assay. (G,H) Tube formation assay. (I,J) Western blot analysis of endothelial nitric oxide synthase (eNOS), vascular cell adhesion molecule-1 (VCAM-1), and intercellular adhesion molecule-1 (ICAM-1) protein expression levels in cells. All data are presented as mean ± SD. n = 6. CON, control group; ox-LDL, ox-LDL treated group; L-GLP-1 RAs, low-dose GLP-1 RAs (semaglutide) group; H-GLP-1 RAs, high-dose GLP-1 RAs (semaglutide) group; ATO, atorvastatin group. *P < 0.05, **P < 0.01, ***P < 0.001.
3.4. GLP-1 RAs upregulate Sema3A/NRP1 expression and binding levels in HUVECs and inhibit downstream ERK1/2 signaling activation
WB and CO-IP results showed that ox-LDL treatment reduced Sema3A and NRP1 expression (P < 0.001) and Sema3A-NRP1 binding, while significantly increased p-ERK1/2/ERK1/2 and p-NF-κB p65/NF-κB p65 ratios (P < 0.001) in HUVECs (Figures 4A,B). After treatment with GLP-1 RAs, all the above changes were significantly reversed (P < 0.05). The effect of H-GLP-1 RAs group exhibited significantly greater improvements than L-GLP-1 RAs group (P < 0.001).
Figure 4.
Effects of glucagon-like peptide-1 receptor agonists (GLP-1 RAs) on the semaphorin 3A (Sema3A)/neuropilin-1 (NRP1) pathway and downstream signaling in HUVECs. (A,B) Western blot analysis of Sema3A, NRP1, phosphorylated extracellular signal-regulated kinase 1/2 (p-ERK1/2)/ERK1/2, and p-nuclear factor kappa-B p65 (NF-κB p65)/NF-κB p65 protein expression levels in HUVECs. (C) Co-immunoprecipitation assay to detect Sema3A-NRP1 protein binding in HUVECs. All data are presented as mean ± SD. n = 6. CON, control group; ox-LDL, oxidized low-density lipoprotein (ox-LDL) treated group; L-GLP-1 RAs, low-dose GLP-1 RAs (semaglutide) group; H-GLP-1 RAs, high-dose GLP-1 RAs (semaglutide) group; ATO, atorvastatin group. *P < 0.05, **P < 0.01, ***P < 0.001.
3.5. Sema3A/NRP1 pathway is an essential factor for GLP-1 RAs-mediated vascular protective effects in vitro
Figures 5A–E showed that EG01377 significantly reversed the improvements in cell viability, migration capacity and tube formation induced by GLP-1 RAs in ox-LDL-treated HUVECs (P < 0.05). Meanwhile, WB results in Figures 5F,G revealed that EG01377 markedly restored the reduced p-ERK1/2/ERK1/2 and p-NF-κB p65/NF-κB p65 ratios caused by GLP-1 RAs treatment (P < 0.05).
Figure 5.
Rescue experiments confirmed the necessity of the emaphorin 3A (Sema3A)/neuropilin-1 (NRP1) pathway in the in vitro effects of glucagon-like peptide-1 receptor agonists (GLP-1 RAs). (A) Cell viability assay. (B,C) Wound healing assay. (D,E) Tube formation assay. (F,G) Western blot analysis of Sema3A, NRP1, phosphorylated extracellular signal-regulated kinase 1/2 (p-ERK1/2)/ERK1/2, and p-nuclear factor kappa-B p65 (NF-κB p65)/NF-κB p65 protein expression levels in HUVECs. All data are presented as mean ± SD. n = 6. CON, control group; ox-LDL, oxidized low-density lipoprotein (ox-LDL) treated group; H-GLP-1 RAs, high-dose GLP-1 RAs (semaglutide) group; NRP1 inhibition + H-GLP-1 RAs, NRP1 inhibitor (EG01377) and high-dose GLP-1 RAs (semaglutide) combined treatment group. *P < 0.05, **P < 0.01, ***P < 0.001.
3.6. Vascular endothelial-specific NRP1 knockout confirms the critical role of Sema3A/NRP1 pathway in GLP-1 RAs-mediated alleviation of AS
qPCR analysis confirmed the successful model construction, showing virtually no NRP1 mRNA expression in the vascular endothelial tissues of NRP1EC-KO mice, while non-endothelial tissues (represented by liver tissue) exhibited comparable NRP1 mRNA levels to those in NRP1WT mice (P > 0.05, Figure 6A). Figures 6B–J showed that compared with the NRP1WT model group, the levels of TG, LDL-C and ET-1 in mice of the NRP1EC-KO model group were increased (P < 0.05), and the level of NO was significantly decreased (P < 0.001). Oil red O and H&E staining results (Figures 6K–M) revealed that NRP1EC-KO model mice displayed higher collagen-positive area percentages in plaque (P < 0.05) and more severe inflammatory infiltration (outlined in yellow) compared to NRP1WT model mice. These findings indicate that endothelial NRP1 deficiency may exacerbates AS. Among the 3 groups of NRP1WT mice, the changing trends of all the above indicators were consistent with observations in Sections 3.1 and 3.2, where high-dose GLP-1 RAs significantly improved atherosclerotic phenotypes (P < 0.05). However, in NRP1EC-KO mice, the therapeutic effects of high-dose GLP-1 RAs were significantly weakened. TG, LDL-C/HDL-C, TNF-α, ET-1 levels, plaque collagen-positive area percentages, p-ERK1/2/ERK1/2, and p-NF-κB p65/NF-κB p65 ratios remained significantly higher in NRP1EC-KO + H-GLP-1 RAs group compared to NRP1WT + H-GLP-1 RAs group (P < 0.05). Additionally, NO levels and the expression of Sema3A and NRP1 were significantly lower (P < 0.05), and aortic inflammatory infiltration showed no notable improvement.
Figure 6.

Generation of endothelium-specific neuropilin-1 (NRP1) knockout (NRP1EC-KO) mice demonstrates the critical role of the emaphorin 3A (Sema3A)/NRP1 signaling pathway in glucagon-like peptide-1 receptor agonists (GLP-1 RAs) alleviating atherosclerosis (aS). (A) Quantitative real-time polymerase chain reaction analysis of NRP1 mRNA expression level in vascular endothelial and non-vascular endothelial tissues. (B) Mouse triglycerides (TG) level. (C) Mouse total cholesterol (TC) level. (D) Mouse low-density lipoprotein cholesterol (LDL-C) level. (E) Mouse high-density lipoprotein cholesterol (HDL-C) level. (F) Mouse LDL-C/HDL-C ratio. (G) Mouse interleukin-6 (IL-6) level. (H) Mouse tumor necrosis factor-alpha (TNF-α) level. (I) Mouse endothelin-1 (ET-1) level. (J) Mouse nitric oxide (NO) level. (K) Percentage of collagen-positive area in mouse plaque. Collagen-positive area (%) = (collagen-positive area/plaque area) × 100%. (L) Oil red O staining of mouse aortic sinus. (M) Hematoxylin and eosin staining of mouse aortic sinus. The area outlined by the yellow box shows inflammatory cell infiltration. (N,O) Western blot analysis of Sema3A, NRP1, phosphorylated extracellular signal-regulated kinase 1/2 (p-ERK1/2)/ERK1/2, and p-nuclear factor kappa-B p65 (NF-κB p65)/NF-κB p65 protein expression levels in aortic tissues. All data are presented as mean ± SD. n = 10. NRP1WT CON: NRP1WT control group; NRP1WT AS: NRP1WT AS group; NRP1WT + H-GLP-1 RAs: NRP1WT + high-dose GLP-1 RAs (semaglutide) group; NRP1EC-KO AS: NRP1EC-KO AS group; NRP1EC-KO + H-GLP-1 RAs: NRP1EC-KO + high-dose GLP-1 RAs (semaglutide) group. *P < 0.05, **P < 0.01, ***P < 0.001.
4. Discussion
The pathological process of AS is complex, mainly characterized by endothelial dysfunction and persistent inflammatory responses that drive atherosclerotic plaque formation and progression (19). Current targeted interventions for inflammation and endothelial dysfunction remain insufficient, necessitating the exploration of novel regulatory mechanisms and therapeutic targets. As a class of novel antidiabetic drugs, GLP-1 RAs have been validated by multiple trials to exert clear anti-atherosclerotic effects (20). However, the specific molecular mechanisms underlying these effects remain incompletely elucidated, limiting their application and optimization in AS prevention and treatment. This study systematically investigates the molecular mechanisms by which GLP-1 RAs alleviate inflammatory responses and endothelial dysfunction in AS via the Sema3A/NRP1 pathway.
ApoE−/− mice induced by high-fat diet exhibit significant weight gain, dyslipidemia and inflammatory factor release, which makes them a classical model for clinical AS research (21). The model group mice in this study showed similar changes in related indicators, indicating successful establishment of the AS model. This study also found that GLP-1 RAs could improve pathological phenotypes, restore endothelial function, and suppress inflammatory responses in atherosclerotic mice. These effects include reductions in body weight, lipid levels, inflammatory factors, and ET-1 levels, increased NO levels, reduced plaque collagen-positive area, and decreased inflammatory cell infiltration. These findings are consistent with previous studies. Existing animal experiments have confirmed that GLP-1 RAs can reduce body weight, blood glucose and lipid levels in Sprague-Dawley rats (22, 23), and inhibit serum inflammatory markers in obese mice (24, 25). Additional preclinical studies indicate that GLP-1 RAs exert direct effects on vascular endothelium to alleviate vascular dysfunction (26). A study in rats demonstrated that liraglutide can mediate vasodilation under conditions of reduced ET-1 levels, thereby improving coronary microcirculation (27). The above results of this study further confirm that the anti-atherosclerotic effects of GLP-1 RAs operate through dual mechanisms: lipid metabolism regulation and inflammatory response suppression, potentially independent of their hypoglycemic effects. The regulation of mouse body weight by GLP-1 RAs may also exert indirect cardiovascular protective effects by reducing vascular metabolic burden. This corresponds with the findings of Galasso et al. (28), which indicate that GLP-1 RAs not only have hypoglycemic effects but also can improve fat accumulation and metabolic parameters. Although this study did not examine vasodilation in mice, it did assess endothelial-related factors, specifically ET-1 and NO levels. The significant improvement in both of both factors were consistent with the trends observed in the studies by Liu (29) and Jonik et al. (30). In addition, this study observed that the effects of high-dose GLP-1 RAs were comparable to those of the positive control drug atorvastatin, with only a relatively significant difference exists in the improvement of collagen-positive plaque area. This provides experimental evidence supporting GLP-1 RAs as a potential alternative therapeutic approach for AS.
On this basis, this study explored the regulatory effect of GLP-1 RAs on the Sema3A/NRP1 pathway and found that GLP-1 RAs can upregulate the expression of Sema3A and NRP1 in aortic tissues of atherosclerotic mice, enhance their binding levels, and simultaneously inhibit the activation of downstream ERK1/2 and NF-κB signaling pathways. This finding is consistent with previous research on the vascular protective functions of the Sema3A/NRP1 pathway. Existing studies indicates that the Sema3A/NRP1 pathway is a critical regulatory pathway for vascular homeostasis and can regulate pathological neovascularization (31, 32). Clinical studies indicate that Sema3A protein expression levels in AS patients are significantly lower than in healthy controls (6). In animal models exhibiting atherosclerotic plaques, Sema3A regulates endothelial cell apoptosis by activating the downstream Nrp/plexin signaling pathway, thereby further modulates angiogenesis (33). The ERK1/2-NF-κB signaling axis is a key pathway mediating inflammatory responses and vascular cell injury (34). Wu et al. (9) reported that Sema3A primarily suppresses aortic angiogenesis and inflammation by binding to NRP1 on endothelial cells and inhibiting downstream ERK signaling. Previous studies have identified that GLP-1 RAs can inhibit the ERK and NF-κB pathways, exerting protective effects in type 2 diabetes and obesity (35, 36). However, this study firstly associates the regulation of GLP-1 RAs with the Sema3A/NRP1 pathway, elaborates the multiple mechanisms by which GLP-1 RAs influence vascular homeostasis, subsequently modulate downstream inflammatory pathways, and exert cardiovascular protective effects. This study further confirmed through IF that Sema3A and NRP1 are localized in both smooth muscle and endothelial cells. This result is consistent with the study by Wu et al. (9). Other studies have also shown that NRP1 can be expressed by various cell types, including neurons, endothelial cells, smooth muscle cells, and immune cells (8). However, our results indicate that Sema3A and NRP1 are more predominantly localized in vascular endothelial cells.
To further verify the cellular effects of this regulatory mechanism, experiments were conducted using an ox-LDL-induced HUVECs injury model. The results confirmed that GLP-1 RAs could improve cell viability, migration capacity, and tubule formation ability in damaged HUVECs, while reducing IL-6 and TNF-α levels. These findings align with the trends observed in vivo experiments and corroborate previous studies demonstrating that GLP-1 RAs possess cytoprotective (37) and anti-inflammatory (38) properties. Endothelial dysfunction involves decreased NO bioavailability resulting from reduced eNOS expression, as well as enhanced leukocyte recruitment and inflammatory responses driven by elevated VCAM-1 and ICAM-1 levels (39). This study also found that GLP-1 RAs can reverse the decreased expression of eNOS and the increased expression of VCAM-1 and ICAM-1 induced by ox-LDL. Similar observations were reported by Oh et al. (40), who noted that liraglutide alleviated eNOS phosphorylation-related injuries in HUVECs under high-glucose conditions. A study by Punjabi et al. (41) showed that liraglutide reduced vascular endothelial VCAM-1 level in atherosclerotic mice independently of glucose regulation. Another clinical study pointed out that ICAM-1 levels in diabetic patients with AS were higher than those in healthy controls, and semaglutide treatment improved glycemic control, blood pressure, and liver steatosis biomarkers but further elevated ICAM-1 levels (42). Although this outcome is contrary to the findings of this study, both results confirm that GLP-1 RAs therapy modulates molecular changes that are conducive to cardiovascular risk control and vascular endothelial homeostasis.
To determine whether the Sema3A/NRP1 pathway is essential for the protective effects of GLP-1 RAs, this study conducted in vitro rescue experiments using the NRP1-specific inhibitor EG01377. Results showed that inhibiting NRP1 function significantly reversed the protective effects of GLP-1 RAs, including improvements in cell viability, migration capacity, tubule formation ability, and suppression of the ERK/NF-κB pathway. This result confirms the indispensability of the Sema3A/NRP1 pathway in the in vitro vascular protective effects of GLP-1RAs. To further verify the role of this pathway at the genetic level in vivo, endothelial-specific NRP1 knockout (NRP1EC-KO) mice were generated. Previous study using this model have confirmed that endothelial-specific NRP1 deficiency exacerbates atherosclerotic pathology in hypercholesterolemic mice without affecting survival (43). In this study, NRP1EC-KO mice exhibited more severe dyslipidemia, endothelial dysfunction, and inflammatory infiltration, which confirms the endogenous protective role of vascular endothelial NRP1. It is well established that endothelial NRP1 is crucial for maintaining the integrity of the vascular endothelial barrier (7). Damage to the vascular endothelial barrier can accelerate the infiltration and deposition of circulating lipids into the vascular intima (44). We hypothesize that the loss of NRP1 in endothelial cells exacerbates endothelial dysfunction, thereby aggravating vascular inflammation and metabolic burden, which in turn disrupts the balance of lipid metabolism. The results of this study also indicate that the effect of GLP-1 RAs in NRP1EC-KO mice were significantly diminished, showing no notable improvement in pathological damage. Meanwhile, the p-ERK1/2/ERK1/2 ratio were restored to higher levels. These findings were mutually consistent with the in vitro rescue experiments, collectively demonstrating from both in vitro and in vivo perspectives that GLP-1 RAs exert anti-atherosclerotic effects by protecting endothelial cells and suppressing inflammation through the Sema3A/NRP1 pathway.
This study still has certain limitations. For example, only semaglutide was selected as a representative of GLP-1 RAs for experiments, without verifying the regulatory effects of other GLP-1 RAs such as liraglutide and dulaglutide on the Sema3A/NRP1 pathway. Additionally, experiments were conducted in mouse models and HUVECs, lacking validation in diverse cell/animal types or clinical samples from atherosclerotic patients. Future studies could incorporate clinical samples to compare multiple GLP-1 RAs and further explore the regulatory interactions between the Sema3A/NRP1 pathway and other downstream signaling pathways of the GLP-1 receptor. The finding in this study that endothelial NRP1 knockout can influence the lipid profile to a certain extent is also worthy of further validation and investigation of its underlying mechanisms in future studies.
5. Conclusion
In conclusion, this study combined in vivo and in vitro experiments to clarify the molecular mechanism by which GLP-1 RAs alleviate inflammation and endothelial dysfunction in AS through activating the Sema3A/NRP1 pathway and suppressing downstream ERK1/2-NF-κB signaling.
Funding Statement
The author(s) declared that financial support was received for this work and/or its publication. 2026 Scientific Research Project of Jiangxi Provincial Health Commission (Contract Number: 202610129).
Footnotes
Edited by: Hongxue Shi, Louisiana State University Health Science Center Shreveport, United States
Reviewed by: Chih-Feng Lien, National Defense Medical Center, Taiwan
Eui Jung Jung, Columbia University Medical Center, United States
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.
Ethics statement
The animal study was approved by the animal Ethics Committee of Jiangxi Provincial People's Hospital (The First Affiliated Hospital of Nanchang Medical College). The study was conducted in accordance with the local legislation and institutional requirements.
Author contributions
LH: Conceptualization, Formal analysis, Investigation, Methodology, Visualization, Writing – original draft, Writing – review & editing. SL: Data curation, Investigation, Methodology, Validation, Writing – review & editing. XD: Conceptualization, Funding acquisition, Project administration, Resources, Supervision, Writing – review & editing. ZZ: Formal analysis, Investigation, Software, Validation, Writing – review & editing. LY: Data curation, Methodology, Visualization, Writing – review & editing. BL: Data curation, Project administration, Resources, Supervision, Writing – review & editing.
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher's note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
- 1.Sarzani R, Spannella F, Di Pentima C, Giulietti F, Landolfo M, Allevi M. Molecular therapies in cardiovascular diseases: small interfering RNA in atherosclerosis, heart failure, and hypertension. Int J Mol Sci. (2023) 25(1):328. 10.3390/ijms25010328 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Gomez Toledo A, Golden GJ, Cummings RD, Malmström J, Esko JD. Endothelial glycocalyx turnover in vascular health and disease: rethinking endothelial dysfunction. Annu Rev Biochem. (2025) 94(1):561–86. 10.1146/annurev-biochem-032620-104745 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Wang K, Yin Z, Zhang Y, Wu X, Fan L. From bench to clinic: advances in anti-inflammatory therapies for atherosclerotic coronary artery disease. FASEB J. (2025) 39(18):e71056. 10.1096/fj.202502269R [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Schrenk S, Sherpa C, Bischoff LJ, Cai Y, Boscolo E. Semaphorin 3A and 3F promote lumen expansion in TIE2-mutated venous malformation. Arterioscler Thromb Vasc Biol. (2025) 45(12):2243–60. 10.1161/ATVBAHA.125.323387 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Qamar T, Misra DP, Kar S. Semaphorins and its receptors: emerging cellular biomarkers and therapeutic targets in autoimmune and inflammatory disorders. Life Sci. (2025) 361:123281. 10.1016/j.lfs.2024.123281 [DOI] [PubMed] [Google Scholar]
- 6.Hou J, Zheng L, Li X, Sun Y. CircZNF609 sponges miR-135b to up-regulate SEMA3A expression to alleviate ox-LDL-induced atherosclerosis. Mol Cell Biochem. (2025) 480(2):1105–20. 10.1007/s11010-024-05031-y [DOI] [PubMed] [Google Scholar]
- 7.Domingues A, Fantin A. Neuropilin 1 regulation of vascular permeability signaling. Biomolecules. (2021) 11(5):666. 10.3390/biom11050666 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Chikh A, Raimondi C. Endothelial neuropilin-1: a multifaced signal transducer with an emerging role in inflammation and atherosclerosis beyond angiogenesis. Biochem Soc Trans. (2024) 52(1):137–50. 10.1042/BST20230329 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wu LF, Zhang JJ, Zhang X, Wang DP, Zheng ZF, Shen J, et al. Semaphorin 3A protects against thoracic aortic aneurysm dissection by suppressing aortic angiogenesis. Angiogenesis. (2025) 28(3):39. 10.1007/s10456-025-09992-6 [DOI] [PubMed] [Google Scholar]
- 10.Park B, Bakbak E, Teoh H, Krishnaraj A, Dennis F, Quan A, et al. GLP-1 receptor agonists and atherosclerosis protection: the vascular endothelium takes center stage. Am J Physiol Heart Circ Physiol. (2024) 326(5):H1159–76. 10.1152/ajpheart.00574.2023 [DOI] [PubMed] [Google Scholar]
- 11.Stefanou MI, Palaiodimou L, Theodorou A, Safouris A, Fischer U, Kelly PJ, et al. Risk of major adverse cardiovascular events and all-cause mortality under treatment with GLP-1 RAs or the dual GIP/GLP-1 receptor agonist tirzepatide in overweight or obese adults without diabetes: a systematic review and meta-analysis. Ther Adv Neurol Disord. (2024) 17:17562864241281903. 10.1177/17562864241281903 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wang T, Ding J, Cheng X, Yang Q, Hu P. Glucagon-like peptide-1 receptor agonists: new strategies and therapeutic targets to treat atherosclerotic cardiovascular disease. Front Pharmacol. (2024) 15:1396656. 10.3389/fphar.2024.1396656 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.He L, Chen Q, Wang L, Pu Y, Huang J, Cheng CK, et al. Activation of Nrf2 inhibits atherosclerosis in ApoE(-/-) mice through suppressing endothelial cell inflammation and lipid peroxidation. Redox Biol. (2024) 74:103229. 10.1016/j.redox.2024.103229 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ma YL, Kong CY, Guo Z, Wang MY, Wang P, Liu FY, et al. Semaglutide ameliorates cardiac remodeling in male mice by optimizing energy substrate utilization through the Creb5/NR4a1 axis. Nat Commun. (2024) 15(1):4757. 10.1038/s41467-024-48970-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Wang J, Zhang Y, Feng X, Du M, Li S, Chang X, et al. Tanshinone IIA alleviates atherosclerosis in LDLR(-/-) mice by regulating efferocytosis of macrophages. Front Pharmacol. (2023) 14:1233709. 10.3389/fphar.2023.1233709 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ma X, Zhang L, Gao F, Jia W, Li C. Salvia miltiorrhiza and tanshinone IIA reduce endothelial inflammation and atherosclerotic plaque formation through inhibiting COX-2. Biomed Pharmacother. (2023) 167:115501. 10.1016/j.biopha.2023.115501 [DOI] [PubMed] [Google Scholar]
- 17.Tan H, Liu L, Qi Y, Zhang D, Zhi Y, Li Y, et al. Atorvastatin attenuates endothelial cell injury in atherosclerosis through inhibiting ACSL4-mediated ferroptosis. Cardiovasc Ther. (2024) 2024:5522013. 10.1155/2024/5522013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Powell J, Mota F, Steadman D, Soudy C, Miyauchi JT, Crosby S, et al. Small molecule neuropilin-1 antagonists combine antiangiogenic and antitumor activity with immune modulation through reduction of transforming growth factor beta (TGFβ) production in regulatory T-cells. J Med Chem. (2018) 61(9):4135–54. 10.1021/acs.jmedchem.8b00210 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Tasouli-Drakou V, Ogurek I, Shaikh T, Ringor M, DiCaro MV, Lei K. Atherosclerosis: a comprehensive review of molecular factors and mechanisms. Int J Mol Sci. (2025) 26(3):1364. 10.3390/ijms26031364 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Psaltis JP, Marathe JA, Nguyen MT, Le R, Bursill CA, Marathe CS, et al. Incretin-based therapies for the management of cardiometabolic disease in the clinic: past, present, and future. Med Res Rev. (2025) 45(1):29–65. 10.1002/med.22070 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.van der Vaart JI, van Eenige R, Rensen PCN, Kooijman S. Atherosclerosis: an overview of mouse models and a detailed methodology to quantify lesions in the aortic root. Vasc Biol. (2024) 6(1):e230017. 10.1530/VB-23-0017 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Yan H, Yao W, Li Y, Li T, Song K, Yan P, et al. Cardiometabolic modulation by semaglutide contributes to cardioprotection in rats with myocardial infarction. Drug Des Devel Ther. (2024) 18:5485–500. 10.2147/DDDT.S491970 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Zou Q, Li L, Ye H, Chen Q, Li B, Wei L. Liraglutide mitigates renal injury in diabetic kidney disease by suppressing podocyte cholesterol accumulation through mTOR/VMP1-regulated autophagy. FASEB J. (2025) 39(22):e71229. 10.1096/fj.202502041RRR [DOI] [PubMed] [Google Scholar]
- 24.da Silva RS, de Paiva IHR, Mendonça IP, de Souza JRB, Lucena-Silva N, Peixoto CA. Anorexigenic and anti-inflammatory signaling pathways of semaglutide via the microbiota-gut–brain axis in obese mice. Inflammopharmacology. (2025) 33(2):845–64. 10.1007/s10787-024-01603-y [DOI] [PubMed] [Google Scholar]
- 25.Zhang Y, Yang X, Yang P, Sun H, Chen L, Zhang X, et al. Effect of liraglutide on the dysglycemia, inflammation, and gut microbiota in prediabetic KKay mice. Front Pharmacol. (2025) 16:1714859. 10.3389/fphar.2025.1714859 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Le R, Nguyen MT, Allahwala MA, Psaltis JP, Marathe CS, Marathe JA, et al. Cardiovascular protective properties of GLP-1 receptor agonists: more than just diabetic and weight loss drugs. J Clin Med. (2024) 13(16):4674. 10.3390/jcm13164674 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Sukumaran V, Tsuchimochi H, Sonobe T, Waddingham MT, Shirai M, Pearson JT. Liraglutide treatment improves the coronary microcirculation in insulin resistant Zucker obese rats on a high salt diet. Cardiovasc Diabetol. (2020) 19(1):24. 10.1186/s12933-020-01000-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Galasso M, Caporusso M, Volatile A, Verde L, Esposito K, Giorgino F, et al. Pharmacological management of diabesity: current and emerging therapies. Curr Obes Rep. (2026) 15(1):5. 10.1007/s13679-025-00681-5 [DOI] [PubMed] [Google Scholar]
- 29.Liu Z. Efficacy of metformin combined with liraglutide on the glucose and lipid metabolism, vascular endothelial function, and oxidative stress of patients with T2DM and metabolic syndrome. Pak J Med Sci. (2024) 40(1Part-I):26–30. 10.12669/pjms.40.1.7936 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Jonik S, Marchel M, Grabowski M, Opolski G, Mazurek T. Gastrointestinal incretins-glucose-dependent insulinotropic polypeptide (GIP) and glucagon-like peptide-1 (GLP-1) beyond pleiotropic physiological effects are involved in pathophysiology of atherosclerosis and coronary artery disease-state of the art. Biology. (2022) 11(2):288. 10.3390/biology11020288 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Sivaprasad S, Cheung CMG, Gliem M, Wykoff CC, Zippel N, Ishida S, et al. New targets in diabetic retinopathy: addressing limitations of current treatments through the Sema3A/Nrp1 pathway. Eye. (2025) 39(18):3209–17. 10.1038/s41433-025-03835-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Sawai T, Yamanegi K, Nishiura H, Futani H, Tachibana T. Sodium valproate enhances semaphorin 3A-mediated anti-angiogenesis and tumor growth inhibition in human osteosarcoma cells. Anticancer Res. (2023) 43(6):2539–50. 10.21873/anticanres.16421 [DOI] [PubMed] [Google Scholar]
- 33.Yuan J, Huang R, Nao J, Dong X. The role of semaphorin 3A in the pathogenesis and progression of Alzheimer’s disease and other aging-related diseases: a comprehensive review. Pharmacol Res. (2025) 215:107732. 10.1016/j.phrs.2025.107732 [DOI] [PubMed] [Google Scholar]
- 34.Wang M, Xie JW, Zheng YW, Wang XT, Yi DY, Lin Y, et al. Tp47-induced monocyte-derived microvesicles promote the adherence of THP-1 cells to human umbilical vein endothelial cells via an ERK1/2-NF-κB signaling cascade. Microbiol Spectr. (2023) 11(4):e0188823. 10.1128/spectrum.01888-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Wawrzak-Pienkowska K, Pienkowski T, Golonko A, Krupa A, Warpechowski M, Plonski AF, et al. Incretin signaling at the crossroads of metabolism, inflammation, and tumorigenesis: implications for obesity patients. Eur J Pharmacol. (2025) 1007:178290. 10.1016/j.ejphar.2025.178290 [DOI] [PubMed] [Google Scholar]
- 36.Alharbi SH. Anti-inflammatory role of glucagon-like peptide 1 receptor agonists and its clinical implications. Ther Adv Endocrinol Metab. (2024) 15:20420188231222367. 10.1177/20420188231222367 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Xi L, Du J, Lu Y, Xue W, Xia Y, Chen T, et al. Dulaglutide accelerates diabetic wound healing by suppressing Nrf2-dependent ferroptosis in diabetic mice. Peptides. (2025) 185:171366. 10.1016/j.peptides.2025.171366 [DOI] [PubMed] [Google Scholar]
- 38.Wong CK, McLean BA, Baggio LL, Koehler JA, Hammoud R, Rittig N, et al. Central glucagon-like peptide 1 receptor activation inhibits toll-like receptor agonist-induced inflammation. Cell Metab. (2024) 36(1):130–43.e5. 10.1016/j.cmet.2023.11.009 [DOI] [PubMed] [Google Scholar]
- 39.Engin A. Endothelial dysfunction in obesity and therapeutic targets. Adv Exp Med Biol. (2024) 1460:489–538. 10.1007/978-3-031-63657-8_17 [DOI] [PubMed] [Google Scholar]
- 40.Oh EY, Suh SH, Byeon S, Lee J, Lee YH, Choi SK. Liraglutide alters gut microbiota and improves endothelium-dependent relaxation in db/db mice. Biomed Pharmacother. (2026) 196:119042. 10.1016/j.biopha.2026.119042 [DOI] [PubMed] [Google Scholar]
- 41.Punjabi M, Kosareva A, Xu L, Ochoa-Espinosa A, Decembrini S, Hofmann G, et al. Liraglutide lowers endothelial vascular cell adhesion molecule-1 in murine atherosclerosis independent of glucose levels. JACC Basic Transl Sci. (2023) 8(2):189–200. 10.1016/j.jacbts.2022.08.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Hachuła M, Basiak M, Kosowski M, Okopień B. Effect of GLP-1RA treatment on adhesion molecules and monocyte chemoattractant protein-1 in diabetic patients with atherosclerosis. Life. (2024) 14(6):690. 10.3390/life14060690 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Bosseboeuf E, Chikh A, Chaker AB, Mitchell TP, Vignaraja D, Rajendrakumar R, et al. Neuropilin-1 interacts with VE-cadherin and TGFBR2 to stabilize adherens junctions and prevent activation of endothelium under flow. Sci Signal. (2023) 16(786):eabo4863. 10.1126/scisignal.abo4863 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Goldberg IJ, Cabodevilla AG, Younis W. In the beginning, lipoproteins cross the endothelial barrier. J Atheroscler Thromb. (2024) 31(6):854–60. 10.5551/jat.RV22017 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.




