Silencing Clusterin Could Attenuate the Cell Properties of HCV Core Protein-Expressing HCC Cell Line

Abstract

Background and Objective

Global cancer statistics position HCC as the sixth most common malignancy, with mortality rates placing it third. Notably, stress-induced cytoprotective factor CLU is frequently upregulated in HCC, where it has been mechanistically linked to disease progression. Our previous studies demonstrated that CLU is significantly upregulated in the plasma and neoplastic tissues of HCV-induced HCC patients and HCV core protein-expressing HCC cell lines. Our purpose is to elucidate the function and mechanisms of CLU in HCC, particularly in the context of HCV-associated HCC, while also assessing its potential as a drug target.

Methods

The relationship between CLU and genes associated with apoptosis and invasion was analyzed using clinical databases (GEPIA). CLU knockdown-induced alterations in apoptosis and invasion were characterized in HCV core protein-expressing HCC cell lines employing multiple experimental approaches including western blotting, flow cytometry, and transwell assays.

Results

CLU expression was positively correlated with anti-apoptotic and pro-invasive genes in HCC. Significant apoptosis induction was achieved through CLU knockdown, mediated by three key molecular changes: pro-apoptotic genes (BAX, PARP, Caspase3, and Caspase9) were upregulated, the anti-apoptotic gene Bcl2 was downregulated, and AKT phosphorylation was inhibited. Additionally, CLU silencing inhibited cellular invasion by diminishing the expression of matrix metalloproteinase 2 (MMP2), N-cadherin and Vimentin.

Conclusions

CLU-mediated regulation of apoptosis and invasion pathways emerges as a critical mechanism in HCC progression according to our data. Our findings demonstrated that CLU is a promising therapeutic target for HCV-associated HCC, providing novel perspectives for developing targeted treatments against this aggressive cancer.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10620-025-09560-4.

Introduction

Hepatocellular carcinoma (HCC) is the sixth most common malignant tumor worldwide and the third leading cause of cancer-related deaths [1]. Chronic hepatitis C virus (HCV) infection interrelates with its development, which induces persistent hepatic inflammation and cellular damage. This will create a microenvironment conducive to tumorigenesis [2]. Although there are obvious developments in understanding the molecular mechanisms of HCC, it remains a major clinical challenge because of its high recurrence rate, limited therapeutic options, and poor prognosis. Therefore, identifying key molecular drivers of HCC progression is crucial for developing effective diagnostic and therapeutic strategies, particularly under the premise of HCV infection.

Clusterin (CLU) is a highly conserved heterodimeric glycoprotein, which is ubiquitously expressed in various tissues and bodily fluids [3]. It plays diverse roles in physiological processes, including tissue remodeling, lipid transport, complement regulation, and apoptosis [4]. In pathological contexts, CLU has been implicated in neurodegenerative diseases, inflammatory conditions, and cancer. Notably, CLU is considered a vital cancer regulator. CLU supports cancer growth and recurrence by controlling cancer cell proliferation, stemness, survival, metastasis, epithelial-mesenchymal transition, therapy resistance and inhibition of programmed cell death [5]. It also contributes to tumorigenesis by promoting angiogenesis [6]. In HCC, secretory CLU has been identified as a potential diagnostic and prognostic biomarker [7]. A meta-analysis suggests that CLU is a more superior biomarker than AFP in diagnosing HCC. The combined use of CLU and AFP enhanced diagnostic performance [8]. Rasmy HS showed that CLU was a useful diagnostic and prognostic marker for HCC after locoregional treatment with 73.33% sensitivity and 75% specificity at a cutoff of ≥ 86.6 mg/L, and it also demonstrated a sensitivity of 95.24% and a specificity of 77.78% for detecting tumor progression at a cutoff of ≥ 146.6 mg/L based on the mRECIST scoring system [9]. However, the precise molecular mechanisms how CLU influences HCC progression remain poorly understood, particularly in HCV-associated HCC.

Although CLU has been recognized as a key player in HCC, most studies to date have focused on its general role in tumor biology rather than its specific functions in HCV-induced HCC. Furthermore, the relationship between CLU and critical pathways involved in apoptosis and invasion in HCC has not been thoroughly investigated. Addressing these gaps is essential for elucidating the molecular basis of HCV-associated HCC and identifying novel therapeutic targets.

This study systematically investigated CLU's specific role in HCV-associated HCC and evaluated its therapeutic potential. We utilized clinical databases (e.g., GEPIA) to examine correlations between CLU expression and apoptosis/invasion-related genes. Functional analyses through CLU knockdown were performed in HCV core protein-expressing HCC cell lines.

Materials and Methods

Analysis of CLU of HCC Patients from Clinical Databases

Using clinical databases (www.cbioportal.org; GEPIA, http://gepia.cancer-pku.cn/), we analyzed CLU expression in liver hepatocellular carcinoma (LIHC) patients versus healthy controls to elucidate its role in HCC. Additionally, we examined the correlation between CLU and pivotal genes implicated in the apoptosis and invasion progress of HCC.

Cell Culture

In this investigation, HepG2 and SMMC7721were employed. These cell models were acquired from the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). For cell maintenance, Dulbecco’s Modified Eagle’s Medium (DMEM; Hyclone, Logan, Utah, USA) served as the basal culture medium, which enriched with 10% fetal bovine serum (FBS; BI, Kibbutz Beit Haemek, Israel). Additionally, the medium contained penicillin (100 U/ml) and streptomycin (100 μg/ml) to prevent bacterial contamination. The cells were incubated under standardized conditions at 37 °C in a humidified 5% CO₂ atmosphere to ensure optimal growth and physiological functionality.

Establishment of Stable Cell Lines with HCV Core Protein Infection

The plasmids pcDNA3.1(-)-HCV core (containing the full coding sequence of the HCV core protein, Genotype 1b) and the empty vector control pcDNA3.1(-)-NC were generously provided by Professor Jun Cheng (Institute of Infectious Diseases, Beijing Ditan Hospital, Capital Medical University, China). Using established protocols [10–12], we generated stable transfectants of HepG2 and SMMC7721 cells including the HCV core plasmid (referred to as HepG2-CORE and SMMC7721-CORE) and the control vector (designated HepG2-NC and SMMC7721-NC). In addition, further verification was conducted through Western blot analysis (Fig. S1).

Cell Transfection with CLU siRNA

HepG2-CORE and SMMC7721-CORE cells were plated in 6-well plates (2 × 10⁵ cells/well) in antibiotic-free DMEM and allowed to adhere for 24 h prior to transfection. Transfection was performed using Lipofectamine 2000 (Invitrogen) with either 100 nM CLU-targeting siRNA (si-CLU, Gema, Jiangsu, China) or a negative control siRNA (si-NC). Si-NC is a non-targeting 20–25 nt siRNA (Sense 5’-UUC UCC GAA CGU GUC ACG UTT-3’; Antisense 3’-ACG UGA CAC GUU CGG AGA ATT-5’). The two sequences of si-CLU were as following: si-CLU -1 (Sense 5’-CCA GAC GGU CUC AGA CAA UTT-3’; Antisense 3’-AUU GUC UGA GAC CGU CUG GTT-5’), and si-CLU-2 (Sense 5’-CCC GCC AAC AGA AUU CAU ATT-3’; 3’-UAU GAA UUC UGU UGG CGG GTT-5’). All experiments and subsequent measurements were conducted in triplicate.

Quantitative Real-Time PCR (qRT-PCR)

Based on manufacturer’s direction, using Trizol reagent (Invitrogen) extracts Total RNA. For cDNA synthesis, M-MLV Reverse Transcriptase (Takara) was employed with gene-specific primers or random hexamers. Gene expression analysis was carried out on an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) and SYBR Green master mixture (Takara). Glyceraldehyde-phosphate dehydrogenase (GAPDH) served as the endogenous control. The RNA expression levels were determined via the 2^−ΔΔCt method. Each assay was performed in triplicate, with three replicates. The sequences of primers are provided in Table 1.

Table 1.

Primers used in PCR analysis

Gene name	Primer sequences (5’-3’)	Gene name	Primer sequences (5’-3’)
BAX	F: ACAGGGGCCCTTTTGCTTC R: CTTGGTGGACGCATCCTGAG	Bcl2	F: ATGTGTGTGGAGAGCGTCAA R: GGGCCGTACAGTTCCACAA
PARP	F: GCCCTAAAGGCTCAGAACGA R: CTACTCGGTCCAAGATCGCC	AKT	F: GGACAAGGACGGGCACATTA R: CGACCGCACATCATCTCGTA
Caspase3	F: GCTATTGTGAGGCGGTTGTAG R: GGCACACCCACCGAAAAC	Caspase9	F: GAGCTGTTCAGGCCCCATA R: GCTTGCCTGTTAGTTCGCAG
MMP2	F: ATGACAGCTGCACCACTGAG R: AGTTCCCACCAACAGTGGAC	TIMP1	F: ACATCCGGTTCGTCTACACC R: TGATGTGCAAGAGTCCATCC
E-cadherin	F: CACCACGGGCTTGGATTTTG R: TGGGGGCTTCATTCACATCC	N-cadherin	F: TGGGAAATGGAAACTTGATGGC R: AATCTGCAGGCTCACTGCTC
vimentin	F: CAGGACTCGGTGGACTTCTC R: GTCGATGTAGTTGGCGAAGC	GAPDH	F: GGCATGGACTGTGGTCATGAG R: TGCACCACCAACTGCTTAGC

Western Blot

Extracting proteins from cells uses radio-immunoprecipitation assay buffer (RIPA). An equivalent amount of denatured proteins were separated on 10% SDS-PAGE and analyzed by immunoblotting with primary antibodies against BAX (1:1000; Abcam, USA), Bcl2 (1:4000; Abcam), PARP (1:1000; Proteintech), AKT (1:1000; Proteintech), p-AKT (1:1000; Abcam), caspase 3 (1:1000; Proteintech), caspase-9 (1:1000; Proteintech), MMP2 (1:1000; Abcam), TIMP-1 (1:1000; Proteintech), E-cadherin (1:1000; Proteintech), N-cadherin (1:1000; Proteintech), vimentin (1:1000; Proteintech), β-actin (1:10,000; Proteintech). After the incubation with HRP-conjugated secondary antibodies, the signals were finally detected using an ECL system (Thermo Fisher Scientific).

Clonogenic Assay

For proliferation assessment, HepG2-core and SMMC7721-core cells were seeded in 6-well plates (1 × 10⁴ cells/well) and transfected with either si-CLU or si-NC. The culture medium was replaced every 72 h throughout the 10 days. Following fixation with methanol, colonies were visualized by 0.1% crystal violet staining. Quantitative analysis was conducted by counting colony numbers and capturing representative images. This was performed three times.

Flow-Cytometric Analysis of Cell Cycle and Apoptosis

After 48 h of transfection with CLU siRNA, we harvested cells and evaluated cell cycle and apoptosis simultaneously. Cells underwent fixation in cold 70% ethanol and a subsequent incubation at 4 °C for a minimum of 30 min for further assessing the cell cycle. Following a dual wash with PBS to eliminate ethanol, cells were treated with RNase and stained with propidium iodide (PI). In parallel, apoptosis was evaluated by washing the cells twice with phosphate-buffered saline and resuspending them gently in annexin-V-binding buffer. The cells were then incubated with PI and annexin V-Fluorescein isothiocyanate, supplied by Vazyme Biotech Co., Nanjing, China, in darkness for 15 min. According to the manufacturer's operation manual, all flow cytometric analyses were conducted on a Beckman Coulter FC 500 system (Fullerton, CA, USA).

Transwell Invasion

HepG2-core and SMMC7721-core cells were plated onto the upper wells of Transwell inserts pre-coated with Matrigel (1 μg/ml; Sigma-Aldrich, USA) after transfection. The lower chambers had a culture medium supplemented with 10% FBS as a chemotactic stimulus.

Following a 24-h incubation period, non-migratory cells were gently removed from the upper surface using a cotton swab. Migratory cells that traversed the membrane were fixed with methanol and stained with 0.1% crystal violet. The cells that successfully migrated were quantified under a microscope (Olympus, Tokyo, Japan).

Immunofluorescence (IFC) Staining

Cells grown on glass coverslips and subjected to siRNA transfection for 48 h. Subsequently, they were fixed with 4% formaldehyde at ambient temperature for 30 min, permeabilized with 0.1% Triton-X in PBS for 10 min, and blocked with 10% goat serum in PBS for 1 h. The coverslips were incubated with primary antibodies against E-cadherin, N-cadherin, and Vimentin overnight at 4 °C, followed by a 30-min incubation with FITC-conjugated donkey anti-rabbit IgG. After thorough PBS washing, cells were counterstained with DAPI. Fluorescent signals were observed by Olympus Microscope.

Statistical Analysis

Data were described in the form of mean ± standard deviation. The Student t test was used to analyze the difference between two groups, while the difference among multiple groups was assessed using one-way analysis of variance, with the least significant difference test (LSD-t) test for post-hoc comparison. All statistical tests were two-tailed, with significance defined as p < 0.05. SPSS software (version 26.0) was used to analyze datas.

Results

CLU Was Increased in LIHC Patients and Negative Related with Pro-apoptosis and Positive Related with Pro-invasion Genes

In our preceding investigation, we discerned a marked upregulation of the CLU gene in both the plasma and neoplastic tissues of HCV-HCC patients, as well as in HCC cell lines with stable expression of the HCV core protein [12]. In addition, we investigated the function of CLU in HCC with clinical databases (gepia.cancer-pku.cn). The results demonstrated that CLU was dramatically increased in patients of LIHC (indicated by the red box in Fig. 1A) than that in normal control (indicated by the gray box in Fig. 1A). Further examination of relationship between CLU and genes involved in apoptotic and invasive processes revealed an inverse correlation with the pro-apoptotic BAX (Fig. 1B) and the invasion-inhibiting TIMP1 ( Fig. 1C), alongside a positive association with the invasion-promoting CDH2 (Fig. 1D).

Fig. 1.

Investigate CLU expression in LIHC and examinate the relationship between CLU, apoptosis and invasion-related genes. A Expression of CLU in patients of LIHC; B–D Correlation between CLU and BAX, TIMP1 and CDH2

Knockdown of CLU Could Regulate Cell Cycle and Inhibit Proliferation of HepG2-Core and SMMC7721-Core Cells

Investigating the impact of cell cycle dynamics and cellular proliferation on the progression of HCC, we assessed that how CLU to influence these processes in HepG2-core and SMMC7721-core cells. We utilized the previously established si-CLU-1 and si-CLU-2, which can efficiently reduce CLU expression in HepG2-CORE and SMMC7721-CORE cells and repeated the relative Western blot and qRT-PCR experiment to verify the knockout efficiency (Fig. S2) [12]. Our results indicate that silencing CLU through siRNA-mediated knockdown (si-CLU-1 and si-CLU-2) led to an accumulation of cells in the G0/G1 phase and a simultaneously decline in the G2/M phase population ( Fig. 2A-C). Furthermore, this knockdown was connected with a decrease in cell proliferation rates ( Fig. 2D-E) and colony formation capabilities ( Fig. 2F-G).

Fig. 2.

Silencing CLU could regulate cell cycle and inhibit colony formation of HepG2-core and SMMC7721-core cells. A–C Cell cycle of HepG2-core and SMMC7721-core cells transfected by si-NC, si-CLU-1 and si-CLU-2 was detected by flow cytometry; D–E Cell proliferation of HepG2-core and SMMC7721-core cells was determined by CCK-8 assay; F–G Cell colony formation assay showed knockdown CLU inhibit the colon formation; *: P < 0.05 vs controls, **: P < 0.01 vs controls

Knockdown of CLU Promote Apoptosis of HepG2-Core and SMMC7721-Core Cells

Apoptotic activity within HepG2-core and SMMC7721-core cells was quantified post-transfection using Flow Cytometry, with apoptosis-related gene expression assessed via quantitative RT-PCR and Western blot analysis. Notably, early apoptotic events were augmented in cells transfected with si-CLU-1 and si-CLU-2 (Fig. 3A-C). However, late-stage apoptosis did not show a similar increase. Gene expression analysis revealed a significant upregulation of pro-apoptotic genes such as BAX, PARP, Caspase3, and Caspase9 in the two groups, while the anti-apoptotic gene Bcl2 was diminished and phosphorylation of AKT (p-AKT) was inhibited ( Fig. 3D-H). These findings suggest that CLU knockdown may enhance apoptotic processes in hepatocellular carcinoma cells.

Fig. 3.

Knockdown of CLU promote apoptosis of HepG2-core and SMMC7721-core Cells. A–C Cell apoptosis of siRNA transfected HepG2-CORE and SMMC7721-CORE cells was detected by flow cytometry; D–E mRNA expression of Bax, Bcl2, PARP, AKT, caspase 3 and caspase 9 in siRNA transfected HepG2-CORE and SMMC7721-CORE cells was detected by qRT-PCR, respectively; F–H Protein expression of Bax, Bcl2, PARP, AKT, p-AKT, caspase 3 and caspase 9 in siRNA transfected HepG2-CORE and SMMC7721-CORE cells was detected by Western blot; *: P < 0.05 vs controls, **: P < 0.01 vs controls

Knockdown of CLU Suppress Invasion of HepG2-Core and SMMC7721-Core Cells

Investigations into CLU’s role on the invasive capabilities of HCC cells were conducted by using Transwell assays and gene expression analyses at both mRNA and protein levels. In HepG2-core and SMMC7721-core cells, transfection with si-CLU-1 and si-CLU-2 resulted in a significant reduction in invasive activity (Fig. 4A-B). Correspondingly, genes known to facilitate invasion, such as MMP2, N-cadherin, and Vimentin exhibited downregulation post-transfection, while there was an upregulation of TIMP-1 and E-cadherin at the mRNA and protein levels ( Fig. 4C-G). Subsequent immunofluorescence characterization of E-cadherin, N-cadherin, and Vimentin reinforced the findings (Fig. 4H). Overall, these data indicate that CLU knockdown markedly diminishes the invasion potential of HepG2-core and SMMC7721-core cells.

Fig. 4.

Knockdown of CLU suppress invasion of HepG2-core and SMMC7721-core cells. A–B Cell invasion ability detected by Transwell assay; C–D mRNA expression of MMP2, TIMP-1, E-cadherin, N-cadherin and Vimentin in siRNA transfected HepG2-CORE and SMMC7721-CORE cells was detected by qRT-PCR, respectively; E–G Protein expression of MMP2, TIMP-1, E-cadherin, N-cadherin and Vimentin in siRNA transfected HepG2-CORE and SMMC7721-CORE cells was detected by Western blot; H The expression of E-cadherin, N-cadherin and Vimentin was also examined by immunofluorescence cytochemistry; *: P < 0.05 vs controls, **: P < 0.01 vs controls

Discussion

HCC is still a major global cause of cancer-related mortality, particularly among individuals with chronic HCV infection. The absence of reliable early diagnostic biomarkers and effective therapeutic targets continues to pose significant challenges in clinical management, contributing to the persistently poor prognosis of HCC patients. This study systematically elucidates the role of CLU in HCV-associated HCC, demonstrating its critical involvement in tumor progression through the regulation of apoptosis, proliferation, and invasion. These results enhance our understanding of HCV-induced HCC pathogenesis and identify CLU as a promising therapeutic target candidate.

Our results indicate that CLU knockdown significantly promotes apoptosis and inhibits proliferation in HepG2-core and SMMC7721-core cells. These findings align with previous studies, which showed that CLU acts as an anti-apoptotic protein by interacting with BAX and inhibiting mitochondrial apoptosis [13]. Additionally, CLU has been reported to activate the Akt and NF-κB pathways, which are crucial for cancer cell survival [14-17]. Our study extends these observations by demonstrating that CLU silencing upregulates pro-apoptotic genes (e.g., BAX) and downregulates anti-apoptotic genes (e.g., Bcl-2). This further supports its role in apoptosis regulation. These results suggest that targeting CLU could restore apoptotic pathways in HCC cells. It may be a promising strategy for therapeutic intervention.

However, during the research process, we discovered an interesting phenomenon: At the protein level, BAX expression does not follow the same trend as mRNA. We have carefully re-examined our raw data and confirmed this discrepancy. Such a lack of perfect concordance between mRNA and protein levels is not uncommon in cell biology and can be attributed to several well-established post-transcriptional and post-translational regulatory mechanisms [18]- [19]. The translation efficiency of BAX mRNA can be modulated by microRNAs or RNA-binding proteins, which may be differentially active in the two siRNA knockdown conditions. The stability and half-life of the BAX protein itself could be altered indirectly upon CLU knockdown. It is plausible that the cellular environment in si-CLU2 cells promotes a faster degradation rate of the BAX protein, preventing its accumulation despite higher mRNA levels. Complex feedback loops within the apoptotic signaling pathway might be activated to tightly regulate the levels of this critical pro-apoptotic protein at the post-translational level.

In addition to its role in apoptosis and proliferation, CLU also plays a significant role in HCC invasion and metastasis. Our data show that CLU knockdown reduces the expression of key invasion-related proteins, including MMP2, N-cadherin, and vimentin. These findings are consistent with previous studies linking CLU to a metastatic phenotype in HCC through the regulation of MMP2, MMP-9, VEGF, and E-cadherin [20–23]. Furthermore, CLU has been proved to promote metastasis via the EIF3I/Akt/MMP13 signaling pathway [24]. Our study corroborates these findings and provides additional evidence that CLU silencing impedes cellular invasion, and emphasize its potential as a therapeutic target for metastatic HCC.

We observed that the knockdown effect of the CLU gene (particularly on the expression of Caspase-9 and E-cadherin) exhibits certain variations across different cell lines. We think this is attributed to the fact that different HCC cell lines (such as HepG2 and SMMC7721) originate from distinct tumor backgrounds and possess unique genetic and molecular signatures [25]-[26]. For instance: The SMMC7721 cell line is known to be more invasive and mesenchymal-like, which might explain its particularly strong response in invasion assays and the more pronounced shift in E-cadherin upon CLU knockdown. Conversely, the HepG2 cell line exhibits a more epithelial and well-differentiated phenotype, which could account for the differences in the apoptotic (Caspase-9) and EMT (E-cadherin) pathways activation upon CLU loss.

Related literature revealed that CLU expression is significantly elevated in HCC patients and correlates with poor survival outcomes [27]. This is consistent with previous reports that identify CLU as an independent prognostic marker for HCC [28]. Our findings suggest that CLU could serve as both a diagnostic biomarker and a therapeutic target for HCV-associated HCC. CLU can modulate multiple oncogenic pathways, including apoptosis, proliferation, and invasion, which makes it a particularly attractive target for combination therapies aimed at addressing the multifactorial nature of HCC.

Custirsen (OGX-011) is a second-generation antisense oligonucleotide (ASO) featuring 2'-methoxyethyl (MOE) modifications and a phosphorothioate backbone. It is a 21-nucleotide complement to the translation initiation site of exon II mRNA of the CLU gene, containing a characteristic CpG motif. By specifically inhibiting secretory CLU production, it has entered clinical evaluation for various malignancies [29].

In the human renal cell carcinoma model, the use of OGX-011 enhanced pro-apoptotic activity and significantly attenuated the autophagy pathway induced by temsirolimus. The combined use of OGX-011 and emsirolimus enhanced cytotoxic activity of temsirolimus against renal cell carcinoma[30].

OGX-011 has been shown to be a promising therapeutic agent in the treatment of hepatoma. Chen showed that OGX-011 knocking down Secreted CLU led to a significant increase in E-cadherin expression and a decrease in MMP2 gene transcription [24]. Wang observed that knocking down CLU with OGX-011 significantly inhibited EIF3I/Akt/MMP13 signaling to affect HCC metastasis in tail vein injected model (SMMC7721) and an orthotopic model (HCCLM3) [27]. Another article by summarizing the current research status of aggregators concluded that custirsen is a valuable therapeutic agent to overcome anti-cancer resistance in advanced HCC [29]. Yao's research demonstrated that OGX-011 can silence hepatic sCLU at the mRNA level, inhibit cancer cell proliferation, increase cell apoptosis, induce cell cycle arrest, reverse MDR, alter cell migration or invasion behavior, and reduce GSK-3β or AKT phosphorylation levels. The growth of xenografts was significantly inhibited by down-regulating the expression of β-catenin, p-GSK3β and cyclinD1 [31].

While previous studies have established CLU as a key player in HCC progression, our research is the first to systematically analyze its role in the context of HCV-induced HCC. By integrating bioinformatics analysis with experimental validation, we provide a comprehensive understanding of how CLU contributes to HCV-associated HCC. Our findings are consistent with earlier reports on CLU's anti-apoptotic and pro-invasive functions but extend these observations by highlighting its specific role in HCV-related tumorigenesis. This distinction is critical, because HCV-associated HCC represents a high-risk subgroup with unique molecular characteristics and limited treatment options.

However, This study has several limitations. First, the findings are based solely on cytological experiments and lack validation through in vivo animal studies. Second, while we observed changes in related apoptosis and invasion genes by knocking down CLU, we did not perform complementary CLU overexpression experiments to further establish causality. Third, we did not further use the CLU knockout (KO) cells model, which could provide additional validation basis for the research. The generation and characterization of CLU-KO models constitute an important next step for our ongoing and future research projects. Additionally, if future experiments employing sphere formation assays are conducted to evaluate the effect of CLU on cancer stemness, it would be a valuable extension of the current work.

Conclusions

In summary, this work demonstrates CLU as a central mediator of HCC progression in HCV infection, modulating three fundamental cancer hallmarks: apoptotic resistance, proliferative capacity, and invasive potential. CLU silencing not only enhances apoptosis and inhibits proliferation but also reduces the invasive potential of HCC cells. The study identifies CLU as a candidate biomarker for targeted therapy development in HCV-related HCC, particularly in patients with advanced disease. Future studies should focus on developing CLU-targeted therapies and evaluating their efficacy in preclinical and clinical settings. By addressing the critical need for effective treatments in HCV-associated HCC, our work contributes to the growing body of research aimed at improving outcomes for HCC patients.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

HCC

Hepatocellular carcinoma

HCV

Hepatitis C virus

CLU

Clusterin

MMP2

Matrix metalloproteinase 2

qRT-PCR

Quantitative real-time polymerase chain reaction

DMEM

Dulbecco’s modified Eagle’s medium

FBS

Fetal bovine serum

RIPA

Radio-immunoprecipitation buffer

GAPDH

Glyceraldehyde-phosphate dehydrogenase

IFC

Immunofluorescence

HRP

Horseradish peroxidase

PI

Propidium iodide

LSD-t

Least significant difference test

Author Contributions

F.H., C.J.C. and J.C. conceived of the study, participated in the design and interpretation of the data, performing the statistical analysis and drafting the manuscript. S.X.Z. and Z.Z.Z. conducted the experiment and revised the manuscript critically. W.G.R. and Q.S.Z. participated in its design and interpretation and helped to draft the manuscript. L.D.L. and S.M.D. participated in its design and interpretation. N.F. helped to revise the manuscript critically and provide financial support. Y.M.N. participated in the project administration and supervision.

Funding

The study was supported by grants from Government-funded Project for Outstanding Talents in Clinical Medicine in 2024 (ZF2024072), Cultivation project of Precision Medicine Joint Fund of Natural Science Foundation of Hebei Province (H2025206096), China Zhongguancun Precision Medicine Science and Technology Foundation SAILING Clinical Research Project (SAILING-2024008), 2016 Hebei Provincial Natural Science Foundation for Young Scholars in Higher Education Institutions (QN2016174), and 2025 Research Project Plan for Traditional Chinese Medicine Studies (2025320).

Data Availability

The data used in support of the findings are included within the article.

Declarations

Conflict of interest

The authors declare no competing interests.

Ethical approval

This study received ethical approval from the institutional review board of The Third Hospital of Hebei Medical University No. 1/016/2014 and was performed in accordance with the Declaration of Helsinki (as revised in 2013). Written informed consent was obtained prior to sample collection which from each patient included in the study.