Anti-proliferative performance of nano-chitosan and nano-silver Moringa oleifera on breast cancer cells through the Wnt signalling pathway

Abstract

Background

The global prevalence of breast cancer has been notably high in recent years. Increased awareness, better screening practices, and access to health services are essential to address this disparity and improve the well-being of women worldwide. Moringa oleifera is one such herbal candidate drug material with potential antioxidant, antibacterial, antiedema, antifungal, antitumor, and anti-cancer properties. Therefore, an innovation is needed to enhance the effectiveness of Moringa extract's compounds using nanoparticles.

Objectives

This study used silver nanoparticles and chitosan, which have been extensively studied for their efficacy, especially against breast cancer cells.

Methods

An in vitro study of MCF-7 and NIH-3T3 cells compared the effectiveness of both treatments viz. nano-silver (MOA) and nano-chitosan (NCM) using the MTT Assay. Both used IC50 doses based on previous studies. Further molecular (Wnt, TGFβ, and Ki-67 signaling) examination was also performed via RT-qPCR and Immunofluorescence Staining.

Results

The treatment effectively alleviated the growth of MCF-7 breast cancer cells. This was confirmed at the molecular level by inhibiting the expression of several genes (Wnt-βcatenin, CyclinD1, Ki-67) that contribute to the proliferation pathway and metastasis signaling genes (Snail and TGFβ).

Conclusions

MOA and NCM, as antiproliferative green nanomaterials, have successfully suppressed gene expression in the Wnt signaling pathway. This study's results indicate that both materials are potential drug candidates for breast cancer treatment.

1. Introduction

Breast cancer remains the most prevalent malignancy worldwide, accounting for 47.8% of all cancer cases, with Asia contributing more than 45% of the global burden [1,2]. Mortality rates also remain high, with approximately 6.6 million deaths recorded globally [2]. The number of newly diagnosed cases is projected to reach 2.7 million by 2030, accompanied by an estimated 0.87 million deaths annually [3]. These figures highlight substantial geographic disparities, influenced by differences in awareness, screening access, and quality of care, underscoring the urgency of improving both prevention and treatment strategies.

Biologically, breast cancer is a heterogeneous disease driven by complex interactions among genetic, cellular, and microenvironmental factors [4,5]. Two major signaling pathways play central roles in its progression: Wnt/β-catenin, which regulates proliferation, migration, and invasion [[6], [7], [8], [9], [10], [11]], and TGF-β/Smad/Snail, which promotes epithelial–mesenchymal transition (EMT) and metastasis [12,13]. Dysregulation of these pathways contributes significantly to tumor growth, invasiveness, and therapeutic resistance, making them important molecular targets for anticancer interventions.

Despite substantial advances in breast cancer therapy, current treatment options, including surgery, chemotherapy, and radiotherapy, often cause severe side effects, such as acute toxicity and neurological complications (e.g., encephalopathy and radiation-induced necrosis) [14,15]. These limitations highlight the need for safer, more effective therapeutic alternatives. Natural or plant-derived compounds have emerged as promising candidates due to their lower toxicity profiles and diverse bioactive properties.

Among these, Moringa oleifera (MO) has gained attention for its antioxidant, antibacterial, anti-inflammatory, and anticancer activities [16,17]. MO contains several phytochemicals, such as flavonoids, phenolics, terpenoids, and sterols, that interfere with cancer progression by inducing apoptosis and disrupting cell-cycle regulation [18]. However, despite its therapeutic potential, MO's clinical applicability remains limited by poor solubility and low bioavailability, which reduce its biological effectiveness [19]. These challenges provide a strong rationale for developing strategies that can optimize the delivery of MO-derived compounds.

Nanoparticle-based delivery systems offer one such approach by improving compound stability, solubility, and cellular uptake [20,21]. Nanoencapsulation has demonstrated enhanced stability within the gastrointestinal tract and favorable characteristics for drug delivery [[22], [23], [24], [25]]. In this context, we selected two distinct nanocarrier systems, nanoparticle chitosan extract of Moringa oleifera seeds (NCM) and nanoparticle silver - Moringa oleifera leaf powder (MOA), to improve the delivery and anticancer performance of MO extracts. Nano-chitosan was chosen for its biocompatibility and ability to facilitate electrostatic interactions with negatively charged cancer cell membranes, thereby supporting improved internalization of poorly soluble phytochemicals [[26], [27], [28]]. Meanwhile, nano-silver was included due to its intrinsic anticancer properties, particularly its capacity to generate reactive oxygen species, disrupt mitochondrial function, and impair membrane integrity [29,30]. These mechanistic differences provide a clear rationale for comparing both nanocarriers, as each may influence MO's biological performance in unique ways.

Therefore, this study aimed to compare the antiproliferative effects of Moringa-based nano-chitosan (NCM) and nano-silver (MOA) formulations on MCF-7 breast cancer cells, while assessing their impact on key molecular pathways, including Wnt/β-catenin and TGF-β/Smad/Snail. The toxicity toward normal NIH-3T3 fibroblasts was also evaluated to determine biocompatibility differences between the two nanocarriers.

2. Material and methods

2.1. Synthesis of nano-chitosan Moringa (NCM)

Moringa oleifera seeds and leaves were collected from Sumenep City, East Java, Indonesia. After drying and sorting, the dried seeds and leaves were ground and extracted with ethanol to synthesize Nanochitosan-Moringa seeds (NCM) and MOA (Silver (Ag) Nanoparticle-Moringa oleifera leaf powder/MOLP). The extract was filtered using a rotary evaporator at 50 °C. Then, the crude extract obtained was mixed with acetic acid, sodium tripolyphosphate (STTP), and chitosan was added for the synthesis of chitosan nanoparticles [31,32]. The synthesis of nano-chitosan Moringa (NCM) was carried out using a modified ionic gelation method. Chitosan powder (1.5% w/v) was first dissolved in 1% (v/v) acetic acid under continuous stirring for 3 h until a clear solution was obtained. Moringa seed extract was then mixed with the chitosan solution at a 1:2 (extract:polymer) ratio. Sodium tripolyphosphate (TPP, 0.5% w/v) was added dropwise as a cross-linking agent while maintaining constant stirring at room temperature. Nanoparticle formation was allowed to proceed for 45 min. The suspension was then centrifuged at 12,000 rpm for 20 min. The resulting pellets were washed twice with distilled water to remove residual acetic acid and unbound phytochemicals. Finally, the nanoparticles were freeze-dried and stored at 4 °C until use.

2.2. Synthesis of Silver–Moringa nanoparticles (MOA)

MOA was synthesized by mixing 20 g of Moringa leaf powder with 100 mL of distilled water at 60 °C for 30 min. After filtration, 1 mM AgNO₃ solution was added to the extract at a 1:50 (v/v) ratio. The reaction mixture was heated to 70 °C and stirred continuously for 1 h. A color change from pale yellow to dark brown indicated the formation of AgNPs. The nanoparticle suspension was centrifuged at 10,000 rpm for 25 min. The pellets were washed three times with distilled water to eliminate excess silver ions and plant residues. The purified nanoparticles were then freeze-dried and stored at 4 °C.

2.3. Basic characterization of particle size

Particle size distribution, polydispersity index (PDI), and zeta potential of the nanoformulations were analyzed to evaluate their hydrodynamic size, size uniformity, and colloidal stability. Measurements were performed using a particle size analyzer (Horiba SZ-100Z, Horiba Ltd., Japan) at the Integrated Laboratory and Research Center, Universitas Indonesia. Prior to analysis, samples were appropriately diluted in distilled water to minimize multiple scattering. Particle size and PDI were determined by dynamic light scattering (DLS), while zeta potential was measured using electrophoretic light scattering, following the manufacturer's standard operating protocols. All measurements were conducted at room temperature.

2.4. Compound characterization on MOA and NCM

2.4.1. Total flavonoids content (TFC)

The total flavonoid content (TFC) of MOA and NCM was assessed using a slightly modified version of the protocol by Sharma et al. [32]. First, the extract was mixed with 2 mL of water and 0.15 mL of sodium nitrate solution. Then, the mixture was incubated for 6 min, and 4% NaOH solution was added; the final volume was adjusted to 5 mL with methanol. The standard compound used is catechin. Finally, the absorbance was measured using a dual-beam UV-Vis spectrophotometer at 415 nm. The final result of the total flavonoid compound content was expressed as the catechin equivalent of the catechin standard curve.

2.4.2. Total phenolic content (TPC)

A slightly modified Folin-Ciocalteu test was employed to evaluate the total phenolic content (TPC) of both treatments [31]. For the standardization curve at gallic acid equivalents with concentrations of 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, and 4.0 mL, the stock solution was transferred to a 100 mL flask and mixed with water to make a solution of gallic acid and sodium carbonate. The phenolic concentration was measured at 650 nm using the reagent. In this method, gallic acid serves as a standard, and the total concentration of phenolic compounds is expressed as equivalents to gallic acid.

2.5. Cell culture

The cell lines used in this study were a normal mouse embryonic fibroblast cell line (NIH3T3) and a breast cancer cell line (MCF-7), both purchased from the ATCC (American Type Culture Collection). Both were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco Cat No. 11965118) with 10% Fetal Bovine Serum (Gibco Cat No. 15140122) and antibiotics (100 U/mL Streptomycin and 100 U/mL Penicillin, Gibco Cat No. 15140122). The cells adhered to the T-flask, and subculturing was performed once the cells reached 80% confluence to ensure optimal growth conditions.

2.6. MTT assay

This study used a dose of IC₅₀ MOLP-AgNPs (MOA) of 1500 μg/ml and also NC-Mosee (NCM) of 1650 μg/ml. The cells were treated once they reached approximately 70–80% confluence to ensure that the assays were performed during the logarithmic growth phase. The cell viability percentages in both treatments were then compared. This toxicity test used an MTT reagent (BioVision, Catalog Number 2809). The doubling-time proliferation test was also carried out using this reagent to determine cell viability at different incubation times.

2.7. RT-qPCR

Genomic proliferation measurement using the RT-qPCR method by targeting genes involved in proliferation signaling via Wnt/βcatenin/CyclinD1 and EMT/Metastasis pathway via TGFβ-Snail (target gene primers as in Table 1). Two-step RT-qPCR used the following materials: QIAzol Lysis Reagent (Qiagen-Germany, 79306), Revertra-Ace TOYOBO cDNA synthesis kit (Toyobo-Japan, FSQ-301), and Sensyfast SYBR No-Rox Kit (Meridian Bioscience-Ohio, BIO-98005).

Table 1.

List of primers used in this study.

Gene	Forward	Reverse
βactin	AGAAAATCTGGCACCACACC	CCATCTCTTGCTCGAAGTCC
Wnt	ACCACATGCAGTACATCGGAG	GAGGTGTTATCCACAGTGCTG
βcatenin	GCCGGCTATTGTAGAAGCTG	ACTAGTCGTGGAATGGCACC
Cyclin-D1	CGTGGCCTCTAAGATGAAGGA	CCTCGGGCCGGATAGAGTAG
TGFβ	AAGTGGACATCAACGGGTTC	GTCCTTGCGGAAGTCAATGT
Snail	GAAAGGCCTTCAACTGCAAA	TGACATCTGAGTGGGTCTGG

2.8. Expression of proliferation marker Ki-67

Proliferation test by measuring Ki-67 expression using immunofluorescence (IF) staining and RT-qPCR methods. IF staining using mouse monoclonal antibody Ki-67 (Santa Cruz Biotechnology-US, sc-23900), secondary mouse monoclonal antibody IgG1 Rhodamine (Santa Cruz Biotech-US, Catalog, sc-57606), and DAPI (Roche-Switzerland, No. 10236276001) and Ki-67 primers for RT-qPCR analysis as follows: forward 5′-ATAAACACCCCAACACACAA-3′ and reverse 5′-GCCACTTCTTCATTCCAGTTACA-3′.

2.9. Data analysis

Immunofluorescence staining images were processed semi-quantitatively with ImageJ software (Fiji). All data from 3 replications were written in the form of mean ± SD. Then, the data were analyzed using ANOVA, followed by Duncan's multiple range test (DMRT) at the 95% level in SPSS 29 (2022), and the results were illustrated in GraphPad Prism v5.

3. Results

3.1. Basic characterization of particle size

The particle size analysis showed that MOA nanoparticles had an average hydrodynamic diameter of 56 nm, whereas NCM exhibited a larger mean size of 106 nm (Table 2). Both formulations exhibited polydispersity indices (PDIs) greater than 0.5, indicating relatively broad size distributions [33]. Zeta potential measurements revealed negative surface charges for both MOA (−37.2 mV) and NCM (−30.9 mV), suggesting moderate colloidal stability (Table 2). All particles in the suspension of both treatments possess negative zeta potential values. As a result, the electrostatic force will increase, helping prevent nanoparticle agglomeration and preserving long-term stability [34].

Table 2.

Particle size analysis.

Product	Z-Average	PI	Zeta Potential
MOLP-AgNP (MOA)	56 ± 0.31 nm	0.816 ± 0.67	−37.2 mV ± 0.73
NC-Mosee (NCM)	106.8 ± 0.44 nm	0.617 ± 0.38	−30.9 mV ± 0.16

3.2. Compound characterization on MOA and NCM

Quantitative analysis of bioactive compounds demonstrated that MOA contained a higher total flavonoid content (61.85 mg/g) compared to NCM (39.08 mg/g). In contrast, total phenolic content was higher in NCM (57.10 mg/g) than in MOA (26.57 mg/g). These results are presented in Fig. 1.

Fig. 1.

Total flavonoid content (TFC) on the left side and phenolic compounds (TPC) on the right side of MOA and NCM.

3.3. MTT assay

Cytotoxicity evaluation using the MTT assay revealed that both MOA and NCM reduced MCF-7 cell viability at their respective IC50 concentrations (1500 μg/mL for MOA and 1650 μg/mL for NCM). At these concentrations, MOA and NCM inhibited MCF-7 cell viability by approximately 56% and 55%, respectively (Fig. 2). In NIH-3T3 cells, MOA treatment resulted in lower cell viability (approximately 70%) than NCM (approximately 81%), indicating a greater cytotoxic effect of MOA on normal fibroblasts.

Fig. 2.

Cytotoxicity test by MTT assay, left) MCF-7 cell line and right) NIH 3T3 cell line. Both used IC₅₀ doses of 1500 μg/mL for MOA and 1650 μg/mL for NCM. ∗Both were declared significant in each Treatment (MOA and NCM) VS Control (K- and K+) with one-way ANOVA test.

Morphological observation under inverted microscopy showed noticeable differences between control and treated groups. In MCF-7 cells, both MOA and NCM treatments were associated with reduced cell density and increased cell rounding compared with the negative control. In NIH-3T3 cells, MOA-treated cultures exhibited more pronounced changes in cell morphology and attachment over time than NCM-treated cells, which largely maintained a spread morphology (Fig. 3).

Fig. 3.

Inverted microscopical results of both treatments (MOA and NCM) on MCF-7 and NIH-3T3 cell lines. Yellow arrows indicate cells exhibiting morphological features consistent with reduced viability, including cell shrinkage and loss of adherence, while arrows in the negative control (K−) indicate viable and densely populated cells. Images were captured at × 200 magnification. Scale bars: 100 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

3.4. Proliferation test by MTT assay

Cell proliferation analysis demonstrated that the strongest inhibitory effect on MCF-7 cells occurred after 48 h of incubation for both treatments. At all incubation times, NIH-3T3 cells treated with MOA exhibited consistently lower viability than NCM. Doubling time analysis for both cell lines is presented in Fig. 4, Fig. 5, Fig. 6.

Fig. 4.

Cell doubling time proliferation assay using MTT assay, top) MCF-7 cell line and bottom) NIH 3T3 cell line. Some letters indicate significant differences between MOA and NCM tested based on the DMRT test (p < 0.05).

Fig. 5.

Doubling time (24, 48, and 72 h) of cell proliferation assay using MTT assay between two treatments on MCF-7 cell line. Yellow arrows indicate representative cellular features. At 24 h, cells remain relatively dense with early signs of morphological alteration. Prolonged exposure (48 and 72 h) to both treatments results in a progressive reduction in cell density, increased cell rounding, detachment, and accumulation of non-adherent cells, indicating inhibited proliferation and enhanced cell death. The effects appear more pronounced with extended incubation time, supporting the time-dependent antiproliferative activity observed in the MTT assay. Images were captured at × 200 magnification; scale bar = 50 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 6.

Representative inverted microscopy images illustrating cell proliferation at 24, 48, and 72 h following treatment with MOA and NCM in NIH-3T3 cells. Yellow arrows indicate representative cellular features, including changes in cell density, morphology, and attachment. Images were captured at × 200 magnification. Scale bar = 50 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Consistent with the proliferation assay, time-dependent changes in cell density were more pronounced in MOA-treated NIH-3T3 cells over 24–72 h than in NCM-treated cells.

3.5. RT-qPCR

RT-qPCR analysis revealed significant modulation of proliferation- and metastasis-related genes following treatment with MOA and NCM. While Cyclin D1 and Snail expression levels differed significantly between treatments, Ki-67, Wnt, and TGF-β transcript levels did not show statistically significant differences (Fig. 7, Fig. 8).

Fig. 7.

mRNA expression levels of Wnt/β-catenin and proliferation-related genes (Ki-67 and Cyclin D1) in MCF-7 cells following treatment with MOA and NCM. β-actin was used as a housekeeping gene. Different letters indicate statistically significant differences between groups based on Duncan's multiple range test (p < 0.05).

Fig. 8.

mRNA expression levels of metastasis-related genes (TGF-β and Snail) in MCF-7 cells following treatment with MOA and NCM. β-actin was used as a housekeeping gene. Different letters indicate statistically significant differences between groups based on Duncan's multiple range test (p < 0.05).

3.6. Immunofluorescence using Ki-67 proliferation marker

Immunofluorescence analysis demonstrated a visible reduction in Ki-67–positive nuclei in treated groups compared with the untreated control. Among the treatments, MOA showed a lower Ki-67 signal intensity relative to NCM (Fig. 9, Fig. 10).

Fig. 9.

Immunofluorescence staining using Ki-67 antibody was used in all treatments, especially MOA and NCM. Representative immunofluorescence images of Ki-67 expression in MCF-7 cells under control and treatment conditions (K−, K+, MOA, and NCM). Cell nuclei were counterstained with DAPI (blue), and Ki-67 was detected using a specific antibody (red). Merged images show nuclear localization of Ki-67. Yellow arrows indicate representative Ki-67–positive nuclei. Images were acquired at × 400 magnification. Scale bar = 20 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 10.

Immunofluorescence intensity values (left) and Ki-67 relative gene expression (right) for each treatment. Several letters based on Duncan's test (p < 0.05) indicate significant differences between the tested groups, except for Ki-67.

4. Discussion

Moringa oleifera has cancer-preventive properties that help stop the growth of human cancer cells [35]. This study confirms that both treatments (MOA and NCM) inhibited breast cancer cell development through Wnt, TGFβ, and Ki-67 signaling. Previous research has demonstrated that MOA can inhibit colorectal cancer cell development, especially in metastasis and proliferative signals [36]. Similarly, NCM has been shown to inhibit the expression of proliferation and metastasis genes in MCF-7 breast cancer cells [26].

AgNP-based MOAs were developed to target specific cells or tissues, potentially inhibiting the proliferation while inducing apoptotic activity of cancer cells by engaging interaction with specific mechanical pathways such as Caspase and PI3K/Akt [37,38]. Nanoparticles with their size advantage have shown promise as anticancer agents by enhancing the therapeutic effects of chemotherapeutic agents compared to traditional formulations [39,40]. In addition, MOAs have been shown to contain various flavonoids, isothiocyanate, and phenolic compounds [41]. While MOA demonstrates efficacy in inhibiting cancer cell viability through Wnt, TGFβ, and Ki-67 signaling, this study also found MOA to be more toxic than NCM, as indicated by its toxicity in NIH-3T3 cells. This implies the potential for cytotoxic effects on normal cells caused by oxidative stress from the formation of reactive oxygen species (ROS), resulting in DNA damage, impaired cell function, and leading to apoptosis [42,43]. The stronger cytotoxic response of MOA toward NIH-3T3 fibroblasts is consistent with the established reactivity of silver nanoparticles, which catalyze the formation of reactive oxygen species (ROS) and induce oxidative stress, lipid peroxidation, and mitochondrial dysfunction in non-cancerous cells. Normal fibroblasts possess lower basal antioxidant defenses than malignant cells, making them more vulnerable to ROS-driven injury [44]. This mechanistic difference explains why MOA produced a greater reduction in NIH-3T3 viability compared with NCM. By contrast, chitosan-based nanoparticles are widely recognized for their superior biocompatibility and lower propensity to generate oxidative stress [45,46]. The chitosan matrix can also modulate the release of entrapped compounds, thereby contributing to the milder toxicity profile observed in NCM. These properties align with the toxicity patterns seen in this study and highlight the importance of nanomaterial composition in determining biological safety.

To enhance efficacy, careful attention to the dose can worsen side effects, while lower concentrations can minimize the impact. Furthermore, there are concerns about the biodistribution of these particles after administration. They can accumulate in organs like the liver or spleen rather than specifically targeting tumors [47,48]. Other studies have shown that certain types of metal-based nanoparticles, including silver, can activate immune responses that can help fight infections, but also have the potential to cause inflammation that causes tissue damage if not adequately controlled [[49], [50], [51]].

While the IC₅₀ values recorded here might appear elevated relative to standard chemotherapeutics, such profiles are characteristic of nanocarriers encapsulating complex plant extracts rather than single isolated compounds [52,53]. Unlike pure metallic nanoparticles or chemically synthesized drugs, extract-loaded formulations comprise a heterogeneous mix of phytochemicals; consequently, a higher total mass is required to deliver a cytotoxic equivalent of the active moiety [54,55]. This is in line with reports on Moringa oleifera on both chitosan and silver nanoparticles in our previous study which stated that the effective inhibitory concentration often ranges from 500 to more than 3000 μg/mL; it depends on the purity of the extract and the ratio of the polymer matrix [26,36,[56], [57], [58], [59]]. Thus, the biological relevance of these concentrations should be inferred from the sustained suppression of proliferation and metastasis markers in MCF-7 cells, confirming that the entrapped bioactives remain potent despite the nanocarrier's shielding effect.

The quantitative changes in gene expression observed in this study also correspond well with the functional outcomes from the MTT and proliferation assays. The moderate suppression of Wnt and CyclinD1 transcripts aligns with the 55-56% reduction in MCF-7 viability, consistent with the central role of Wnt/β-catenin in promoting G1/S transition [60]. Even partial inhibition of this pathway slows cell-cycle entry, which aligns with the longer doubling times observed in both treatments. Likewise, the downregulation of TGFβ and Snail suggests an attenuation of EMT-associated signaling, which may contribute to reduced proliferative capacity even though migration and invasion were not directly assessed [61,62]. These points indicate that the molecular effects produced by MOA and NCM are proportional to and mechanistically consistent with the observed phenotypic responses.

However, chitosan (NCM) is derived from chitin, a natural polymer, which is biocompatible and non-toxic to human cells [27,63]. As an encapsulant, Chitosan can encapsulate various compounds from Moringa seeds, such as flavonoids and phenolics. This allows targeted drug delivery, increasing therapeutic efficacy while reducing systemic toxicity. The findings of this study demonstrate that NCM can inhibit the viability and proliferation of MCF-7 cells through Wnt, TGFβ, and Ki-67 signaling and is also non-toxic to NIH-3T3 cells. Additionally, other studies have shown that chitosan has potential antitumor properties, which can contribute to the overall efficacy of therapies that use it, such as NCM. Chitosan's cationic and anionic properties enable it to form polyelectrolytes [28,64]. Chitosan can dissolve at low pH but does not dissolve at high pH (it can form a layer that plays a role in preventing the release of encapsulated active compounds), and has the effect of increasing permeation, namely being able to open the epithelial wall, which is essential for hydrophilic compounds [65,66]. Due to its excellent properties, Chitosan has been widely explored as an anticancer and antimicrobial agent, but its insolubility in water and most organic solvents most likely limits its applications. This is due to inter- and intramolecular hydrogen bonding. It can dissolve in dilute acids, such as 1% acetic acid. Modifying its OH and NH₂ groups through chemical reactions can improve its solubility and expand its applications [67].

The potential toxicity of MOA at the human scale remains uncertain, and further in vivo studies will be required to determine its long-term safety profile, especially given the indication of greater toxicity toward normal NIH-3T3 cells in this study. Particular attention should also be paid to possible accumulation of silver (Ag) residues following repeated exposure. Although advanced morphological and crystallinity analyses (TEM/SEM and FTIR/XRD) were not performed due to limited access to instrumentation, the particle size, PDI, and zeta potential data obtained (Table 2) already provide key information regarding colloidal stability and biological suitability of the nanoformulations. These parameters are widely accepted as primary indicators of hydrodynamic behavior and surface interaction in extract-based nanoparticles, where biological performance is often driven more by size distribution and surface charge than by crystallinity [68,69]. Future work will benefit from additional morphological and structural characterization to complement these findings. Likewise, while qPCR results provide insight into transcriptional responses, mRNA abundance does not always reflect protein levels, as Ki-67 is regulated post-transcriptionally through translation efficiency and protein turnover. This explains why Ki-67 transcripts showed minimal differences, whereas immunofluorescence revealed stronger protein suppression in the MOA group. Protein-level assays such as Western blotting in future studies would therefore strengthen the mechanistic interpretation of Wnt/β-catenin and TGFβ/Smad/Snail signaling.

5. Conclusion

This study demonstrated that MOA and NCM have anti-proliferative activity on breast cancer cells. These findings also imply that MOA and NCM have potential for breast cancer therapy or treatment. It has been shown that both can suppress the expression of genes related to proliferation and metastasis via Wnt signaling. In this case, M. oleifera can be applied in vivo using Chitosan and AgNP nanoparticles to evaluate its effects further.

Contribution details

Hendra Susanto: Concepts or Ideas, Design, Literature search, Experimental studies, Data acquisition, Data analysis, Statistical analysis, Manuscript preparation and review.

Moch Sholeh: Design, Literature search, Experimental studies, Data analysis, Manuscript preparation, and editing.

Agustina Tri Endharti: Design, Definition of intellectual content, Experimental studies, Data acquisition, Data analysis, Manuscript editing.

Sa'diyatul Rizqie Amaliyah Firdaus: Experimental studies, Data analysis, Manuscript editing.

Praseetha Prabhakaran: Concepts or Ideas, Design, Definition of intellectual content, Manuscript review.

Nik Ahmad Nizam Nik Malek: Concepts or Ideas, Design, Definition of intellectual content, Manuscript review.

Adeodatus Yuda Handaya: Data acquisition, Data analysis, Manuscript review.

Ahmad Taufiq: Design, Data acquisition, Statistical analysis.

Declaration of generative AI in scientific writing

We declare that no generative AI tools were used in the writing, editing, data processing, analysis, or interpretation of this manuscript. We confirm that all sections of the work, including conception, experimental design, methods, and scientific writing, were entirely produced by us using manual processes and standard academic software. We affirm that no AI-generated text, figures, or analytical output contributed to the scientific content of this work.

Source of funding

We want to express our deepest gratitude for the funding support from the 2024 Universitas Negeri Malang grant Matching Fund Scheme, under contract number 4.4.599/UN32.14.1/LT/2024.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.