Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2026 Apr 7;16:16541. doi: 10.1038/s41598-026-46905-z

Effects of aminoglycosides on macrophage viability and antimicrobial function under high-glucose exposure

Piyarat Srinontong 1,2, Worapol Aengwanich 1,3, Montira Yossapol 1,2, Kampeebhorn Boonloh 4, Zhiliang Wu 5, Jaroon Wandee 1,2,
PMCID: PMC13216629  PMID: 41946866

Abstract

High-glucose exposure is associated with impaired innate immune function and increased susceptibility to infection; however, its influence on antibiotic–macrophage interactions remains incompletely understood. This study investigated the context-dependent effects of the aminoglycosides streptomycin and kanamycin on murine RAW 264.7 macrophages under low-glucose (5.5 mM) and high-glucose (25 mM) exposure conditions, used to simulate normoglycemic and hyperglycemic environments. Macrophage viability, phagocytic activity, intracellular bacterial killing, and expression of pro-inflammatory mediators were evaluated following exposure to Escherichia coli ATCC 25922. High-glucose conditions significantly reduced macrophage phagocytosis and intracellular bacterial killing and increased the expression of IL-1β, IL-6, TNF-α, and iNOS. Neither streptomycin nor kanamycin restored phagocytic activity or altered inflammatory gene expression under either glucose condition. In contrast, both aminoglycosides significantly enhanced intracellular bacterial killing under high-glucose exposure, despite persistent impairment of phagocytosis. Cytotoxicity assessments presented concentration-dependent effects of both antibiotics, with macrophage viability preserved at concentrations corresponding to 1× and 2× minimum inhibitory concentration under both glucose conditions. Together, these results indicate that high-glucose exposure is associated with impaired macrophage antimicrobial activity, while aminoglycosides preserve the ability to enhance intracellular bacterial killing under high-glucose exposure without implying direct immunomodulatory effect. This observation underscores the influence of high-glucose environments on antibiotic–host cell interactions.

Keywords: Streptomycin, Kanamycin, Macrophage, High-glucose exposure, Diabetes

Subject terms: Diseases, Immunology, Microbiology

Introduction

Diabetes mellitus, a metabolic disorder driven by chronic hyperglycemia, remains a major global metabolic disorder affecting humans and animals. The International Diabetes Federation (2025) estimates 589 million people (20–79 years) were diabetic in 2024, rising to 853 million by 20501. In veterinary contexts, the condition is most frequently diagnosed in cats and dogs, with hospital prevalence rates of 0.39% and 0.26–1.33%, respectively2,3. Chronic hyperglycemia underlies many diabetes-related complications, significantly increasing morbidity and mortality4,5. Particularly concerning are infectious complications, as diabetic individuals have nearly twice the infection-related death risk as non-diabetics6. This vulnerability is largely due to hyperglycemia-induced impairments in immune system function7.

Immune dysfunction caused by hyperglycemia is a major contributor to the heightened risk of bacterial infections8,9. Macrophages, key phagocytic cells of the immune system, act as frontline defenders in inflammation and can differentiate into pro-inflammatory (M1) or anti-inflammatory (M2) states in response to environmental cues. M1 macrophages enhance antimicrobial defense by phagocytosing pathogens and secreting pro-inflammatory factors including TNF-α, IFN-γ, iNOS, IL-6, and IL-1, while M2 macrophages promote resolution and tissue repair via TGF-β, IL-4, and IL-1010. Under prolonged high-glucose exposure, macrophage function is impaired, with diminished phagocytosis1113 and reduced bactericidal capacity12,13. Additionally, high-glucose environments often lead to increased production of pro-inflammatory mediators, including NO, TNF-α, IL-6, and IL-111,12,14,15. These dysfunctions contribute to infection-related complications in diabetes, suggesting macrophage modulation as a promising therapeutic approach.

Aminoglycosides are well-established antibiotics known for their rapid, potent bactericidal effects. Agents such as streptomycin and kanamycin exhibit strong activity against diverse gram-negative bacteria, including Escherichia coli, Pseudomonas, Klebsiella, and Proteus species, and selected gram-positive organisms like Staphylococcus aureus16,17. Aminoglycosides also are employed in tuberculosis treatment against Mycobacterium tuberculosis or Mycobacterium bovis, pathogens capable of persisting within host macrophages of both human and animal hosts18,19. These pathogens are often implicated in infections among diabetic humans8,20 and animals21, where hyperglycemia-induced immune dysfunction heightens infection susceptibility7,9.

Antibiotics are known not only for their bactericidal properties but also for modulating immune responses, particularly macrophage function22. This underscores their potential to enhance phagocyte-mediated defense. Although aminoglycosides are key agents in treating bacterial infections in both diabetic and non-diabetic populations16,17,23, their immunomodulatory roles are not fully defined. A previous study reported that streptomycin and neomycin did not significantly alter phagocytic activity in phagocytes24, and gentamicin has no observable effect on THP-1 monocytes phagocytosing heat-killed E. coli25. Liposomal delivery of streptomycin has been shown to enhance macrophage bactericidal activity26, whereas kanamycin and tobramycin showed no effect on Salmonella enterica killing within macrophages27. Their influence on cytokine expression was modest; streptomycin elevated NOS activity in a dose- and time-dependent manner in vestibular epithelium28, while kanamycin induced TNF-α, IFN-α/β, and IL-10 in human leukocytes29. Despite these findings, no study has thoroughly investigated how aminoglycosides affect macrophage immune functions under high-glucose exposure mimicking the hyperglycemic environment of diabetes.

This study aimed to evaluate the effects of aminoglycosides on macrophage cytotoxicity, phagocytic capacity, intracellular bactericidal activity, and pro-inflammatory mediator expression under glucose levels representative of normoglycemic and simulated hyperglycemic states. To model these environments in vitro, a high-glucose exposure system was employed by culturing macrophages in media containing 25 mM glucose. Two aminoglycosides with distinct toxicity profiles, streptomycin and kanamycin, were employed as representative drugs. Kanamycin is primarily associated with cochlear and renal toxicity, whereas streptomycin exhibits greater vestibular toxicity and comparatively lower nephrotoxicity than other aminoglycosides30,31. Both antibiotics remain key agents for treating severe Gram-negative, multidrug-resistant bacterial infections and tuberculosis in diabetic and non-diabetic patients32,33. The findings provide valuable insight into the context-dependent actions of aminoglycosides within low- and high-glucose environments in both humans and animals.

Results

Antibacterial activity and cytotoxic effect of aminoglycosides on RAW 264.7 macrophage cells

The antibacterial potency of STR and KAN against Escherichia coli ATCC 25922 was determined using minimum inhibitory concentration (MIC) assays. Both antibiotics presented the same inhibitory capacity, each exhibiting a minimum inhibitory concentration of 8 μg/mL. These concentrations were subsequently used in cytotoxicity assessments of RAW 264.7 macrophages at 1×, 2×, 4×, and 8× MIC under low-glucose (5.5 mM) and high-glucose (25 mM) exposure environments.

In the cytotoxicity assay, no interaction among glucose exposure levels, aminoglycosides, and drug concentration was detected for RAW 264.7 viability (p > 0.05). Only drug concentration showed a significant main effect (p < 0.05); glucose exposure levels and antibiotic type did not (p > 0.05). Both STR (Fig. 1A) and KAN (Fig. 1B) exhibited dose-dependent cytotoxicity in low- and high-glucose exposure conditions. Under low glucose, cell viability remained above 98% at 1 × and 2 × MIC with no differences from controls (p > 0.05). STR showed 103.25 ± 0.78% and 98.44 ± 2.98%, while KAN showed 101.51 ± 0.63% and 100.46 ± 0.39% at these doses. Higher concentrations (4 × and 8 × MIC) significantly reduced viability (p < 0.05), with STR decreasing to 89.31% ± 0.75 and 61.21% ± 1.93, and KAN to 88.14% ± 1.62 and 58.96% ± 2.30. A similar pattern occurred in high glucose: STR reduced viability to 87.89% ± 0.76 and 59.62% ± 1.66, and KAN to 89.42% ± 1.70 and 56.09% ± 2.08 at 4 × and 8 × MIC (p < 0.05). At 1 × and 2 × MIC, neither antibiotic showed significant cytotoxicity relative to high-glucose exposure controls (p > 0.05). STR-treated cells showed 104.34% ± 1.32 and 101.67% ± 3.27 viability, while KAN-treated cells showed 101.33% ± 2.95 and 97.63% ± 2.69. No significant differences in cytotoxicity were detected between glucose exposure levels across all concentrations (p > 0.05).

Fig. 1.

Fig. 1

The effect of aminoglycosides on RAW 264.7 macrophage viability under low and high glucose exposure conditions. Cytotoxicity of (A) streptomycin and (B) kanamycin was evaluated using the MTT assay after 24 h of exposure to 0–8 × MIC concentrations. Macrophages were cultured under low (Low-glu) or high (High-glu) glucose exposures. Cell viability was expressed as mean ± SEM from three independent biological replicates (n = 3 per group). *p < 0.05 vs. the corresponding control group (CT) within the same glucose condition; #p < 0.05 vs. the corresponding 4 × MIC group within the same glucose condition. P-values for glucose exposure levels × aminoglycosides × drug concentration = 0.603, glucose exposure levels × aminoglycosides = 0.807, glucose exposure levels × drug concentration = 0.590, aminoglycosides × drug concentration = 0.542, glucose exposure levels = 0.885, drug concentration < 0.001, aminoglycosides = 0.250.

Effect of aminoglycosides on phagocytic activity of macrophages under low- and high-glucose exposure conditions

The effect of aminoglycosides on macrophage phagocytic activity was evaluated by quantifying the number of intracellular Escherichia coli recovered from macrophages and expressed as colony-forming units (CFU/mL). No interaction effect between glucose exposure levels and aminoglycoside treatment was observed (p > 0.05), and aminoglycosides alone did not significantly influence phagocytic activity (p > 0.05). In contrast, a significant main effect of glucose exposure levels was detected (p < 0.05). Under low-glucose exposure conditions, macrophages exhibited high phagocytic activity, with bacterial counts of 29,066.67 ± 1974.28 CFU/mL in the low-glucose control group (CT–Low glucose). Treatment with STR (STR–Low glucose) and KAN (KAN–Low glucose) resulted in comparable bacterial uptake, with values of 32,700.00 ± 9340.41 and 30,000.00 ± 4041.45 CFU/mL, respectively, showing no significant differences compared to the CT–Low glucose group (p > 0.05). Meanwhile, under high-glucose exposure conditions, macrophage phagocytic activity was markedly reduced. The high-glucose control group (CT–High glucose) exhibited a significantly lower bacterial count (9,000.00 ± 577.35 CFU/mL) compared to CT–Low glucose group (p < 0.05). Similarly, STR–High glucose and KAN–High glucose groups showed reduced phagocytic activity, with values of 12,433.33 ± 2280.59 and 18,166.67 ± 1416.96 CFU/mL, respectively. However, no significant differences were observed among treatment groups under high-glucose exposure conditions (p > 0.05). Comparative analysis between glucose conditions demonstrated that phagocytic activity was significantly decreased under high-glucose exposure across all treatments. Particularly, STR–High glucose and KAN–High glucose groups showed significantly lower bacterial uptake compared to their corresponding low-glucose exposure groups (p < 0.05) (Fig. 2).

Fig. 2.

Fig. 2

The effect of aminoglycosides on phagocytic activity of macrophages under low and high glucose conditions. Macrophages were incubated for 24 h under low (Low-glu) or high (High-glu) glucose exposure conditions, with or without STR or KAN. Escherichia coli ATCC 25922 was then added and incubated for 60 min. Intracellular bacteria were collected, plated on Mueller–Hinton agar, and counted as CFU/mL. Results are shown as mean ± SEM from three independent biological replicates (n = 3 per group). *p < 0.05 between glucose conditions within the same treatment. P-values for glucose exposure levels × aminoglycosides = 0.562, glucose exposure levels = 0.001, aminoglycosides = 0.516.

Effect of aminoglycosides on bactericidal activity of macrophages under low- and high-glucose exposure conditions

Bactericidal capacity was assessed by measuring macrophage ability to eliminate intracellular Escherichia coli, represented as the percentage reduction in viable bacteria. There was a significant interaction effect of glucose exposure levels and aminoglycosides, and main effects of glucose exposure levels and aminoglycosides were observed on macrophage bactericidal activity (p < 0.05). The bactericidal activity in the CT, STR, and KAN groups was significantly lowered under high-glucose exposure conditions compared with their corresponding low-glucose treatments (p < 0.05). Under low-glucose exposure conditions, macrophages presented strong and comparable bactericidal activity across treatments (p > 0.05). The bacterial killing was 88.47% ± 0.52 in the CT–Low glucose group, 91.44% ± 1.89 with STR, and 89.44% ± 2.48 with KAN. In contrast, under high-glucose exposure conditions, the CT–High glucose group exhibited markedly reduced bactericidal activity, achieving only 40.56% ± 4.68 killing. Treatment with STR and KAN significantly increased bacterial clearance, increasing killing to 63.52% ± 4.23 and 66.31% ± 6.67, respectively (p < 0.05 vs. CT–High glucose group). No significant difference was observed between STR and KAN treatments under high-glucose exposure conditions (p > 0.05) (Fig. 3).

Fig. 3.

Fig. 3

The bactericidal capacity of macrophages treated with aminoglycosides under low and high glucose conditions. RAW 264.7 macrophages were exposed for 24 h to low (Low-glu) or high (High-glu) glucose exposure levels with or without STR or KAN. Following treatment, Escherichia coli ATCC 25922 was introduced, and intracellular bacterial counts (CFU/mL) were determined on Mueller–Hinton agar at 60 min and 24 h (A). The bactericidal rate was calculated as the percentage reduction in viable bacteria between these time points (B). Data are presented as mean ± SEM from three independent biological replicates (n = 3 per group). *p < 0.05 between glucose conditions within the same treatment. #p < 0.05 vs. the corresponding control group (CT) within the same glucose condition. P-values for glucose exposure levels × aminoglycosides = 0.020, glucose exposure levels < 0.001, aminoglycosides = 0.008.

Effect of aminoglycosides on mRNA expression of pro-inflammatory cytokines under low- and high-glucose exposure conditions

RT-PCR analysis was used to determine the effect of glucose exposure levels and aminoglycosides on pro-inflammatory mediator productions. There was no significant interaction effect of glucose exposure levels x aminoglycosides observed on IL-1β, IL-6, iNOS, and TNF-α mRNA expression in macrophages (p > 0.05). A significant main effect of glucose exposure levels was observed (p < 0.05); however, aminoglycosides showed no significant effect on the mRNA expressions (p > 0.05). Under low-glucose conditions, treatment with STR or KAN did not significantly alter the expression of pro-inflammatory mediators, with mRNA levels remaining comparable to those of the CT–Low glucose group (p > 0.05). In contrast, high-glucose exposure markedly increased the expression of IL-1β, IL-6, iNOS, and TNF-α, as evidenced by significantly elevated levels in the CT–High glucose group compared to the CT–Low glucose group (p < 0.05). Notably, although infection under high-glucose exposure conditions significantly upregulated all four pro-inflammatory markers, the addition of STR or KAN did not result in further significant changes in mRNA expression compared with the untreated high-glucose group (p > 0.05). Furthermore, both antibiotics exhibited significantly higher expression levels of IL-1β, IL-6, iNOS, and TNF-α under high-glucose exposure conditions compared with their respective low-glucose counterparts (p < 0.05) (Fig. 4). These findings indicate that hyperglycemic conditions play a dominant role in modulating macrophage inflammatory responses, while aminoglycosides at the tested concentrations neither enhance nor suppress the infection-induced pro-inflammatory gene expression under high-glucose exposure conditions.

Fig. 4.

Fig. 4

The effect of streptomycin and kanamycin on pro-inflammatory mediator gene expression in macrophages under different glucose exposure conditions. RAW 264.7 macrophages were treated for 24 h under low (Low-glu) or high (High-glu) glucose exposures with or without aminoglycosides. The relative expression of (A) IL-1β, (B) IL-6, (C) TNF-α, and (D) iNOS mRNA was analyzed by real-time RT-PCR and normalized to GAPDH. Data are shown as mean ± SEM from three independent biological replicates (n = 3 per group). *p < 0.05 between glucose conditions within the same treatment. P-values for IL-1β; glucose exposure levels × aminoglycosides = 0.496, glucose exposure levels < 0.001, aminoglycosides = 0.623. P-values for IL-6; glucose exposure levels × aminoglycosides = 0.161, glucose exposure levels  < 0.001, aminoglycosides = 0.712. P-values for TNF-α; glucose exposure levels × aminoglycosides = 0.638, glucose exposure levels < 0.001, aminoglycosides = 0.356. P-values for iNOS; glucose exposure levels × aminoglycosides = 0.196, glucose exposure levels < 0.001, aminoglycosides = 0.646.

Discussion

The present study investigated the context-dependent effects of the aminoglycosides, streptomycin and kanamycin, on murine RAW 264.7 macrophages under low-glucose and high-glucose exposure conditions used to simulate normoglycemic and hyperglycemic environments. Hyperglycemia is known to impair innate immune function, particularly macrophage antimicrobial activity, and the present findings align with this concept1113. High-glucose exposure resulted in significant reductions in macrophage phagocytosis and intracellular bacterial killing, indicating that high-glucose exposure significantly impairs macrophage defense functions.

Despite the pronounced impairment of phagocytosis under high-glucose exposure, neither streptomycin nor kanamycin improved macrophage engulfment capacity, suggesting that aminoglycosides do not directly influence receptor-mediated pathogen recognition or uptake processes11,13,25. The present findings aligned with previous reports indicating that the aminoglycosides, including streptomycin, gentamicin, and neomycin, did not affect the phagocytic activity of neutrophils or monocytes22,24,25. In contrast, both antibiotics enhanced intracellular bacterial killing under high-glucose exposure, despite unchanged phagocytosis and inflammatory gene expression. This dissociation indicates that the observed improvement in bactericidal activity may occur at a post-phagocytic stage, independent of increased pathogen uptake or transcriptional regulation of inflammatory responses.

The observed glucose-dependent enhancement of intracellular killing suggests a potential shift in the interactions between aminoglycosides, host cells, and intracellular bacteria within a metabolically active environment. It has been hypothesized that elevated glucose availability could influence bacterial metabolic activity, potentially leading to changes in proton motive force–dependent uptake of aminoglycosides or altered susceptibility to antibiotic-mediated killing3436. While the present study did not directly measure intracellular antibiotic accumulation, bacterial metabolic activity, proton motive force, reactive oxygen species, or mitochondrial responses, these results are consistent with the possibility that antibiotic efficacy within host cells is sensitive to the surrounding metabolic context37. Further mechanistic studies are required to confirm whether these specific pathways drive the enhanced clearance observed under hyperglycemic conditions.

Both streptomycin and kanamycin exhibited expected in vitro activity against E. coli ATCC 25922, with MIC values confirming susceptibility according to Clinical and Laboratory Standards Institute criteria38,39. High-glucose exposure alone did not affect macrophage viability, consistent with previous reports demonstrating that hyperglycemic conditions are not inherently cytotoxic to macrophages or other mammalian cell types40,41. However, both aminoglycosides induced concentration-dependent cytotoxicity, with viability preserved at 1× and 2× MIC but reduced at higher concentrations. Similar effects have been reported in various mammalian cell types, including fibroblast, epithelial, hepatic, and renal cells36,42,43. Although the underlying cellular pathways were not investigated in this study, aminoglycoside-induced cytotoxicity has been associated with mitochondrial dysfunction and oxidative stress, which may contribute to cellular injury at elevated concentrations44,45. These findings highlight the importance of antibiotic concentration when evaluating host cell responses, particularly under conditions of metabolic stress such as hyperglycemia.

High-glucose exposure was also associated with increased expression of pro-inflammatory mediators, including IL-1β, IL-6, TNF-α, and iNOS, consistent with a pro-inflammatory macrophage phenotype reported in previous studies11,12,14,15. The present findings further clarify that the enhanced intracellular bacterial clearance observed with STR and KAN treatment occurs without a concomitant increase in pro-inflammatory gene expression. While high-glucose environments inherently prime macrophages toward a pro-inflammatory phenotype, the aminoglycosides themselves did not modulate the expression of IL-1β, IL-6, TNF-α, and iNOS. These findings suggest that the observed improvement in bactericidal activity is driven by direct intracellular antibiotic effects, potentially augmented by bacterial metabolic activity, rather than secondary modulation of host transcriptional responses.

A One Health framework highlights the broader relevance of these findings to both human and animal health. Macrophage-mediated innate immune responses are highly conserved across mammalian species, and hyperglycemia-associated immune dysfunction has been documented in humans as well as in companion animals such as dogs and cats7,1113,4648. However, it is important to acknowledge that this study utilized the RAW 264.7 murine macrophage cell line. While RAW 264.7 cells are a well-established and widely used model for studying innate immune responses and metabolic stress due to their high reproducibility15,49,50, immortalized cell lines may not fully replicate the physiological responses of primary macrophages or human immune cells. Differences in signaling pathways and metabolic plasticity between immortalized cell lines and primary cells could influence the translatability of these findings. Therefore, while these results provide a significant foundation for understanding antibiotic–host cell interactions under hyperglycemic conditions, future studies involving primary macrophages (such as BMDMs) or in vivo diabetic animal models are warranted to further validate these observations in a more complex clinical context.

Several limitations should be acknowledged. This study focused on in vitro functional outcomes and did not assess intracellular antibiotic accumulation, bacterial metabolic activity, reactive oxygen species production, or mitochondrial function. Notably, the current model represents a "high-glucose exposure" condition rather than a complete in vitro model of diabetes. A key limitation is the absence of an osmotic control (e.g., mannitol), which makes it difficult to definitively distinguish the direct metabolic effects of glucose from potential osmotic contributions. While these factors limit a complete mechanistic interpretation and extrapolation to in vivo systems, they do not detract from the reproducibility of the observed functional effects. Future studies incorporating osmotic controls, additional bacterial species, in vivo models, and mechanistic analyses will help further clarify these interactions.

In conclusion, the present study suggests that high-glucose exposure impairs macrophage phagocytic and bactericidal functions while preserving a glucose-dependent enhancement of intracellular bacterial killing by aminoglycosides. These findings provide functional evidence that antibiotic–host cell interactions are influenced by metabolic exposure, contributing to a clear understanding of how metabolic stress shapes innate immune responses without implying direct immunomodulatory effect.

Methods

Macrophage cell culture

RAW 264.7 murine macrophages (ATCC, Manassas, VA, USA) were thawed from frozen stocks and verified by morphology and growth. Cells were maintained in DMEM (Gibco, USA) containing 1 g/L glucose, 10% fetal calf serum, and 10 mM HEPES buffer (pH 7.35; AppliChem, Germany) without antibiotics. Cultures were incubated at 5% CO2, 37 °C for seven days. To simulate normoglycemic and hyperglycemic environments, cells were subsequently assigned to either low-glucose (1 g/L; 5.5 mM) or high-glucose (4.5 g/L; 25 mM) exposure levels in DMEM for another seven days before experiments.

Determination of Minimum Inhibitory Concentration (MIC)

Escherichia coli ATCC 25922, supplied by the Department of Medical Sciences, Ministry of Public Health, Thailand. Streptomycin (STR) and kanamycin (KAN) were obtained from Sigma-Aldrich, Singapore. MIC values were determined using the broth microdilution method according to CLSI guidelines38. Serial two-fold dilutions (0.25–128 μg/mL) of each antibiotic were prepared in Mueller-Hinton II Broth (Becton Dickinson, Sparks, MD, USA). Aliquots of 200 μL were dispensed into 96-well plates and inoculated with 10 μL of Escherichia coli ATCC 25922 (1 × 107 CFU/mL). Plates were incubated at 35 °C for 16–20 h, and the MIC was defined as the lowest concentration without visible bacterial growth.

MTT Cytotoxicity Assay

The cytotoxic effects of aminoglycosides were examined using the MTT assay as previously described41. Macrophages were seeded at 1 × 104 cells/well in 96-well plates under low- and high-glucose exposure and cultured overnight. After removing the medium, fresh DMEM containing STR or KAN (1×–8× MIC) was added. Following treatment, cells were incubated with 12 mM MTT reagent (Sigma, St. Louis, MO, USA) at 37 °C for 3 h. DMSO dissolved the formazan crystals, and absorbance was read at 570 nm.

Phagocytosis and Bactericidal Activity Assay

Macrophage phagocytic and bactericidal functions were assessed using methods described previously41. RAW 264.7 cells (1 × 106 cells/well) were cultured in six-well plates, incubated overnight, and treated for 24 h with control (CT-Low, CT-High), STR (2 × MIC), or KAN (2 × MIC) under respective glucose exposure levels. Cells were trypsinized, reseeded in 24-well plates (2 × 105 cells/well), and infected with E. coli ATCC 25922 (multiplicity of infection (MOI) 1:20; 4 × 106 CFU/mL) for 60 min or 24 h. The sample was subjected to five wash cycles using PBS (pH 7.4) to clear extracellular bacteria, with the fifth wash showing no remaining bacterial count. Macrophages were then lysed with 0.1% Triton X-100, and lysate dilutions were plated on Mueller Hinton agar. CFU were counted after incubating at 37 °C for 20 h. Phagocytic and bactericidal activities were calculated as reported by previous study51. The phagocytic activity was expressed as the total number of viable bacteria ingested by macrophages after 60 min of incubation, quantified as colony-forming units per milliliter (CFU/mL). Meanwhile, the bactericidal activity was determined according to the following formula:

graphic file with name d33e870.gif

Quantitative RT-PCR (qRT-PCR) analysis

Quantitative RT-PCR was employed to assess IL-1β, IL-6, iNOS, and TNF-α gene expression, following previously described methods41. The qPCR primers used in this study were synthesized based on previously validated sequences41,5254. The primer specificity was confirmed by melting curve analysis. The primer sequences were mouse IL-1β (sense: GACGGACCCCAAAAGATGAAG, anti-sense: CTCCACAGCCACAATGAGTGA), mouse IL-6 (sense: TCCATCCAGTTGCCTTCTTG, anti-sense: CATTTCCACGATTTCCCAGAG), mouse TNF-α (sense: TTGAGTGCCAATTCGATGATG, anti-sense: GAGGGCTTGTTGAGATGATGC), mouse iNOS (sense: TTTGTGCGAAGTGTCAGTGG, anti-sense: CCCTTTGTGCTGGGAGTCA), and GAPDH (sense: GGCATTGTGGAAGGGCTCAT, anti-sense: GACACATTGGGGGTAGGAACAC). RAW 264.7 macrophages (1 × 106 cells/well) were treated for 24 h under low or high glucose with either control, STR (2 × MIC), or KAN (2 × MIC). Total RNA was isolated using the Nucleospin RNA Kit (Macherey–Nagel, Germany) and converted to cDNA with the ReverTra Ace qPCR RT Kit (TOYOBO, Japan). qPCR was conducted using Maxima SYBR Green Master Mix (Thermo, USA) on a QuantStudio™3 PCR system (Applied Biosystems). GAPDH was used for normalization, and relative expression was determined using the 2−ΔΔCt method. The primer specificity was confirmed by melting curve analysis.

Statistical analysis

All data were analyzed by Two-way ANOVA (glucose exposure levels × aminoglycosides) followed by Tukey’s test, except the cytotoxicity assay, which used Three-way ANOVA (glucose levels × aminoglycosides × drug concentration). Significance was defined as p < 0.05. Values represented mean ± SEM from triplicate experiments.

Acknowledgements

The authors acknowledge Professor Motoyuki Sumida (Division of Research Facilitation and Dissemination, Mahasarakham University) for language editing support.

Author contributions

Conceptualization, J.W.; methodology, J.W., P.S. and Z.W.; software, J.W..; validation, J.W. and P.S; formal analysis, J.W., P.S. and W.A.; investigation, J.W., P.S., M.Y. and K.B.; resources, M.Y., P.S., W.A., K.B., Z.W. and J.W.; data curation, J.W.; writing original draft preparation, J.W.; writing review and editing, J.W., P.S., M.Y., W.A., Z.W. and K.B.; visualization, J.W..; supervision, J.W.; project administration, J.W.; funding acquisition, J.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research project was financially supported by Mahasarakham University.

Data availability

All data generated or analyzed during this study are included in this published article.

Declarations

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.International Diabetes Federation. in IDF Diabetes Atlas 11th Edition 2025 (eds D. J. Magliano et al.) 40–71 (International Diabetes Federation, 2025).
  • 2.Denyer, A. L. et al. Epidemiology and clinical management of 1072 dogs with Diabetes Mellitus in a UK diabetes register. Companion Anim. Health Genet.12, 7. 10.1186/s40575-025-00146-x (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Waite, O. et al. Frequency, risk factors, and mortality for Diabetes Mellitus in 1 225 130 cats under primary veterinary care in the United Kingdom in 2019. J. Vet. Intern. Med.39, e70161. 10.1111/jvim.70161 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Antar, S. A. et al. Diabetes Mellitus: Classification, mediators, and complications; a gate to identify potential targets for the development of new effective treatments. Biomed. Pharmacother.168, 115734. 10.1016/j.biopha.2023.115734 (2023). [DOI] [PubMed] [Google Scholar]
  • 5.Reynolds, L., Luo, Z. & Singh, K. Diabetic complications and prospective immunotherapy. Front. Immunol.14, 1219598. 10.3389/fimmu.2023.1219598 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Shah, B. R. & Hux, J. E. Quantifying the risk of infectious diseases for people with diabetes. Diabetes Care26, 510–513. 10.2337/diacare.26.2.510 (2003). [DOI] [PubMed] [Google Scholar]
  • 7.Frydrych, L. M., Fattahi, F., He, K., Ward, P. A. & Delano, M. J. Diabetes and sepsis: Risk, recurrence, and ruination. Front. Endocrinol. (Lausanne)8, 271. 10.3389/fendo.2017.00271 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chávez-Reyes, J. et al. Susceptibility for some infectious diseases in patients with diabetes: The key role of glycemia. Front. Public Health9, 559595. 10.3389/fpubh.2021.559595 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Holt, R. I. G., Cockram, C. S., Ma, R. C. W. & Luk, A. O. Y. Diabetes and infection: Review of the epidemiology, mechanisms and principles of treatment. Diabetologia67, 1168–1180. 10.1007/s00125-024-06102-x (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Xia, T. et al. Advances in the study of macrophage polarization in inflammatory immune skin diseases. J. Inflamm.20, 33. 10.1186/s12950-023-00360-z (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Morey, M., O’Gaora, P. & Pandit, A. Hyperglycemia acts in synergy with hypoxia to maintain the pro-inflammatory phenotype of macrophages. PLoS ONE14, e0220577. 10.1371/journal.pone.0220577 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Pavlou, S., Lindsay, J., Ingram, R., Xu, H. & Chen, M. Sustained high glucose exposure sensitizes macrophage responses to cytokine stimuli but reduces their phagocytic activity. BMC Microbiol.19, 24. 10.1186/s12865-018-0261-0 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Restrepo, B. I., Twahirwa, M., Rahbar, M. H. & Schlesinger, L. S. Phagocytosis via complement or Fc-gamma receptors is compromised in monocytes from type 2 diabetes patients with chronic hyperglycemia. PLoS ONE9, e92977. 10.1371/journal.pone.0092977 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Pan, Y. et al. Inhibition of high glucose-induced inflammatory response and macrophage infiltration by a novel curcumin derivative prevents renal injury in diabetic rats. Br. J. Pharmacol.166, 1169–1182. 10.1111/j.1476-5381.2012.01854.x (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Suzuki, T., Yamashita, S., Hattori, K., Matsuda, N. & Hattori, Y. Impact of a long-term high-glucose environment on pro-inflammatory responses in macrophages stimulated with lipopolysaccharide. Naunyn-Schmiedeberg’s Arch. Pharmacol.394, 2129–2139. 10.1007/s00210-021-02137-8 (2021). [DOI] [PubMed] [Google Scholar]
  • 16.Krause, K. M., Serio, A. W., Kane, T. R. & Connolly, L. E. Aminoglycosides: An overview. Cold Spring Harb. Perspect. Med.6, a027029. 10.1101/cshperspect.a027029 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Moore, H., Yeoh, D., Hughes, C., Raby, E. & Sandaradura, I. Aminoglycosides: An update on indications, dosing and monitoring. Aust. Prescr.48, 133–138. 10.18773/austprescr.2025.038 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Cegielski, J. P. et al. Aminoglycosides and Capreomycin in the treatment of multidrug-resistant tuberculosis: Individual patient data meta-analysis of 12 030 patients from 25 countries, 2009-2016. Clin. Infect. Dis.73, e3929–e3936. 10.1093/cid/ciaa621 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chuenngam, T. & Chermprapai, S. First case report of successful treatment of Mycobacterium abscessus infection in a cat in Thailand. Animals15, 925. 10.3390/ani15070925 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bibi, S. et al. The dual burden of tuberculosis and diabetes mellitus: An epidemiological correlation. Clin. Exp. Med.25, 308. 10.1007/s10238-025-01797-7 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Nelson, V., Downey, A., Summers, S. & Shropshire, S. Prevalence of signs of lower urinary tract disease and positive urine culture in dogs with diabetes mellitus: A retrospective study. J. Endocrinol.37, 550–555. 10.1111/jvim.16634 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Labro, M. T. Interference of antibacterial agents with phagocyte functions: Immunomodulation or “immuno-fairy tales”?. Clin. Microbiol. Rev.13, 615–650. 10.1128/cmr.13.4.615 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Sannathimmappa, M. B. et al. Diabetic foot infections: Profile and antibiotic susceptibility patterns of bacterial isolates in a tertiary care hospital of Oman. J. Educ. Health Promot.10, 254. 10.4103/jehp.jehp_1552_20 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Paape, M. J., Miller, R. H. & Ziv, G. Pharmacologic enhancement or suppression of phagocytosis by bovine neutrophils. Am. J. Vet. Res.52, 363–366 (1991). [PubMed] [Google Scholar]
  • 25.Bode, C. et al. Antibiotics regulate the immune response in both presence and absence of lipopolysaccharide through modulation of Toll-like receptors, cytokine production and phagocytosis in vitro. Int. Immunopharmacol.18, 27–34. 10.1016/j.intimp.2013.10.025 (2014). [DOI] [PubMed] [Google Scholar]
  • 26.Majumdar, S. et al. Efficacies of liposome-encapsulated streptomycin and ciprofloxacin against Mycobacterium avium-M. intracellulare complex infections in human peripheral blood monocyte/macrophages. Antimicrob. Agents Chemother.36, 2808–2815. 10.1128/aac.36.12.2808 (1992). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Menashe, O., Kaganskaya, E., Baasov, T. & Yaron, S. Aminoglycosides affect intracellular Salmonella enterica serovars typhimurium and virchow. Antimicrob. Agents Chemother.52, 920–926. 10.1128/aac.00382-07 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Nakagawa, T., Yamane, H., Takayama, M., Sunami, K. & Nakai, Y. Involvement of nitric oxide in aminoglycoside vestibulotoxicity in guinea pigs. Neurosci. Lett.267, 57–60. 10.1016/s0304-3940(99)00317-1 (1999). [DOI] [PubMed] [Google Scholar]
  • 29.Szczepanik, W., Czarny, A., Zaczyńska, E. & Jeżowska-Bojczuk, M. Preferences of kanamycin A towards copper(II). Effect of the resulting complexes on immunological mediators production by human leukocytes. J. Inorg. Biochem.98, 245–253. 10.1016/j.jinorgbio.2003.10.013 (2004). [DOI] [PubMed] [Google Scholar]
  • 30.Campbell, R. E., Chen, C. H. & Edelstein, C. L. Overview of antibiotic-induced nephrotoxicity. Kidney. Int. Rep.8, 2211–2225. 10.1016/j.ekir.2023.08.031 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rivetti, S. et al. Aminoglycosides-related ototoxicity: Mechanisms, risk factors, and prevention in pediatric patients. Pharmaceuticals16, 1353. 10.3390/ph16101353 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Guo, Y., Yang, J., Wang, H., Sha, W. & Yu, F. Key resistance-associated mutations in multidrug-resistant tuberculosis: A genomic study from Shanghai, China, with a focus on aminoglycosides. BMC Microbiol.25, 702. 10.1186/s12866-025-04446-x (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhao, T. et al. Bibliometric analysis of global research on the clinical applications of aminoglycoside antibiotics: Improving efficacy and decreasing risk. Front. Microbiol.16, 1532231. 10.3389/fmicb.2025.1532231 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tang, X.-k et al. Glucose-potentiated Amikacin killing of Cefoperazone/Sulbactam resistant Pseudomonas aeruginosa. Front. Microbiol.10.3389/fmicb.2021.800442 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Peng, B. et al. Exogenous alanine and/or glucose plus kanamycin kills antibiotic-resistant bacteria. Cell Metab.21, 249–262. 10.1016/j.cmet.2015.01.008 (2015). [DOI] [PubMed] [Google Scholar]
  • 36.Rosenberg, C. R., Fang, X. & Allison, K. R. Potentiating aminoglycoside antibiotics to reduce their toxic side effects. PLoS ONE15, e0237948. 10.1371/journal.pone.0237948 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hyatt, B. L., Rodrigo, M. K. D. & Barnett, T. C. Impact of host and bacterial metabolism on antibiotic susceptibility. Biochemistry64, 4555–4564. 10.1021/acs.biochem.5c00436 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.CLSI. in Performance Standards for Antimicrobial Susceptibility Testing CLSI supplement M100 (eds James S Lewis II et al.) 58–72 (Clinical and Laboratory Standards Institute, 2023).
  • 39.Wu, S., Chouliara, E., Jensen, L. B. & Dalsgaard, A. Evaluation of Petrifilm Select E. coli Count Plate medium to discriminate antimicrobial resistant Escherichia coli. Acta Vet. Scand.50, 38. 10.1186/1751-0147-50-38 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Alharthi, N. S. Prophylactic impacts of Lotusine against hyperglycaemia-induced oxidative stress in hepatic cells isolated from diabetic rats via Irs-1/Pi3 K/Akt pathway. Pak. Vet. J.45, 124–137. 10.29261/pakvetj/2025.123 (2025). [Google Scholar]
  • 41.Yossapol, M. et al. Exploring the therapeutic potential of antibiotics in hyperglycemia-induced macrophage dysfunctions. Antibiotics14, 198. 10.3390/antibiotics14020198 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Chernikov, V. G. et al. Comparison of cytotoxicity of aminoglycoside antibiotics using a panel cellular biotest system. Bull. Exp. Biol. Med.135, 103–105. 10.1023/A:1023474719042 (2003). [DOI] [PubMed] [Google Scholar]
  • 43.Kovacik, A. et al. Cytotoxic effect of aminoglycoside antibiotics on the mammalian cell lines. J. Environ. Sci. Health A. Tox. Hazard. Subst. Environ. Eng.56, 1–8. 10.1080/10934529.2020.1830653 (2020). [DOI] [PubMed] [Google Scholar]
  • 44.Foster, J. & Tekin, M. Aminoglycoside induced ototoxicity associated with mitochondrial DNA mutations. Egypt. J. Med. Hum. Genet.17, 287–293. 10.1016/j.ejmhg.2016.06.001 (2016). [Google Scholar]
  • 45.Kalghatgi, S. et al. Bactericidal antibiotics induce mitochondrial dysfunction and oxidative damage in mammalian cells. Sci. Transl. Med.5, 192ra185. 10.1126/scitranslmed.3006055 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Vaitaitis, G. et al. Canine diabetes mellitus demonstrates multiple markers of chronic inflammation including Th40 cell increases and elevated systemic-immune inflammation index, consistent with autoimmune dysregulation. Front. Immunol.10.3389/fimmu.2023.1319947 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Jaffey, J. A. et al. Ex vivo immune function and modulatory effects of calcitriol in dogs with naturally occurring diabetes mellitus. Vet. Sci.11, 193. 10.3390/vetsci11050193 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Webb, C. B. & Falkowski, L. Oxidative stress and innate immunity in feline patients with diabetes mellitus: The role of nutrition. J. Feline Med. Surg.11, 271–276. 10.1016/j.jfms.2008.07.004 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Tang, J. et al. Disruption of glucose homeostasis by bacterial infection orchestrates host innate immunity through NAD+/NADH balance. Cell Rep.10.1016/j.celrep.2024.114648 (2024). [DOI] [PubMed] [Google Scholar]
  • 50.Coufalova, M. et al. Antibacterial activity of the novel peptide Pac-525 with the RGD motif against intracellular Escherichia coli. Sci. Rep.15, 19995. 10.1038/s41598-025-04901-9 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Kaneko, M., Emoto, Y. & Emoto, M. A simple, reproducible, inexpensive, yet old-fashioned method for determining phagocytic and bactericidal activities of macrophages. Yonsei Med. J.57, 283–290. 10.3349/ymj.2016.57.2.283 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Srinontong, P. et al. Morus alba L. leaf extract exerts anti-inflammatory effect on Paraquat-exposed macrophages. Trends Sci.20, 6206. 10.48048/tis.2023.6206 (2022). [Google Scholar]
  • 53.Srinontong, P., Wandee, J. & Aengwanich, W. Paraquat modulates immunological function in bone marrow-derived macrophages. Acta Vet. Hung.70, 64–72. 10.1556/004.2022.00003 (2022). [DOI] [PubMed] [Google Scholar]
  • 54.Wu, Z., Nagano, I., Asano, K. & Takahashi, Y. Infection of non-encapsulated species of Trichinella ameliorates experimental autoimmune encephalomyelitis involving suppression of Th17 and Th1 response. Parasitol. Res.107, 1173–1188. 10.1007/s00436-010-1985-9 (2010). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in this published article.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES