Successful establishment of chicken primordial germ cell (PGC) lines from the endangered Slovakian indigenous chicken breed: the Oravka

Abstract

PGCs offer a viable means for cryobanking both female and male avian genetic material. These early-migrating cells ultimately give rise to eggs and sperm cells, making them valuable for long-term conservation of poultry genetic resources. In this study, PGCs from the endangered Oravka chicken, a local breed native to Slovakia, were isolated, propagated in vitro, characterized, and cryopreserved. A total of 18 stable PGC lines were successfully established, comprising 12 female and 6 male lines. Characterization using immunohistochemistry, gene expression analysis, karyotyping, cell proliferation assays, TEM, and in vivo migration assays confirmed the identity and developmental competency of the in vitro cultured PGCs. A total of 108 cryopreserved samples were deposited into the gene bank. This study reports the first successful derivation, in vitro culture and cryobanking of stable PGC lines from the Oravka breed, providing a foundational resource for the conservation and future restoration of this distinctive local genetic lineage.

Introduction

The Oravka chicken is a dual-purpose breed native to the Slovakia. It was originally developed to withstand the harsh climatic conditions of Northern Slovakia (Hanusova et al., 2017a). This native breed has been classified as endangered; thus, several research programs have been initiated to preserve its genetic material. These initiatives include the cryopreservation of sperm cells (Svoradová et al., 2018), blastodermal cells (Svoradová et al., 2016), gonadal PGCs (Svoradová et al., 2019) and mesenchymal stem cells (Svoradová et al., 2023). Ex situ conservation such as these are generally regarded as more advantageous than in situ conservation, as they entail lower maintenance costs and mitigate the risks of genetic loss resulting from disease outbreaks, natural disasters, inbreeding, and genetic drift (Chrenek et al., 2017; FAO, 2012). There is still limited data on establishment, expansion and cryotolerance of blood-derived PGCs from endangered Central European breeds such as the Oravka, especially under feeder-free conditions.

There are well established examples of cryobank initiatives worldwide which store PGCs among other sources (e.g. the Roslin Institute in the UK (NARF), the German Gene Bank for Farm Animals (FLI), the French Avian National Cryobank, the NARO Research Center of Genetic Resources in Japan, the Seoul National University (SNU) in South Korea, the Kasetsart University in Thailand, or the United States Department of Agriculture (USDA) - National Animal Germplasm Program (NAGP)). The gene bank of National Centre for Biodiversity and Gene Conservation in Hungary started building a PGC-based sample collection in 2015 and has PGCs from all 7 Hungarian indigenous chicken breeds and from the Hungarian goose nowadays. The Oravka project is a first step towards preserving breeds of our broader region and thus help the international efforts aiming to safeguard chicken genetic diversity.

In avian species, such as chickens, the use of primordial germ cells (PGCs) represents the most effective approach for preserving both male and female genetic material (Chaipipat et al., 2023; Glover and McGrew, 2012; Kong et al., 2018; Nakamura, 2016; Nandi et al., 2016; Nayga et al., 2025; Tajima et al., 1998; Zaib et al., 2023). These cells are the precursors of gametes and can be isolated from the dorsal aorta of early-stage embryos at approximately Hamburger–Hamilton (HH) (Hamburger and Hamilton, 1992) stages 13–17 or around 2.5-day old embryos. PGCs may also be isolated from the gonads of developing chicken embryos at HH 27-28 or around embryonic days 5 to 6 (E5–E6) (Liu et al., 2025). These cells have been demonstrated to survive and proliferate stably in culture systems, including both feeder-layer (Kong et al., 2018; Li et al., 2019; Szczerba et al., 2020) and feeder-free media (Lázár et al., 2021; Whyte et al., 2015).

Cryopreservation of chicken PGCs has been reported globally (Chaipipat et al., 2021; Ecker et al., 2023; Ibrahim et al., 2024; Nandi et al., 2016) as an effective strategy for conserving the genetic resources of various chicken breeds (Doddamani et al., 2025; Lázár et al., 2021; Liu et al., 2025; Nakamura, 2016). However, similar techniques are not yet feasible for many other avian species except goose (Chen et al., 2019; Doddamani et al., 2025) due to the lack of an established culture medium that supports stable PGC proliferation (Nayga et al., 2025; Santiago-Moreno and Blesbois, 2022). Cryopreservation typically involves the use of cryoprotective media containing dimethyl sulfoxide (DMSO) and other serum components (Nandi et al., 2016). Another promising approach for preserving chicken PGCs is vitrification, which has been successfully applied by Tonus and colleagues (Tonus et al., 2017).

The cryopreservation of PGCs from the Oravka breed provides a viable means of preserving its genetic material, which may subsequently be employed in repopulation programs. Given that the Oravka chicken is recognized as an endangered breed, the preservation of its genetic resources is imperative; thus, this study was undertaken.

In this study, we aimed to establish blood-derived PGC cultures from the Oravka chicken under feeder-free conditions, assess their proliferation and marker expression, and then cryopreserve them in our gene bank as a genetic resource for future repopulation efforts (Fig. 1).

Fig. 1.

General outline of the study. (A) Oravka eggs were incubated for 2.5 days, then blood was collected from embryos individually. The samples were put into a feeder-free medium to establish primordial germ cell (PGC) lines. (B) The stable PGC lines underwent sex determination, immunohistochemistry, proliferation assay, chromosome analysis, gene expression measurement and TEM in order to validate their quality. (C) The characterized PGC lines were frozen and placed into cryobank of our institute. (D) To prove the functionality of the established and frozen PGCs, donor cells were labelled and injected into recipient embryos. On day-6, recipient embryos were dissected and their gonads were screened for the donor PGCs.

Materials and methods

Ethics statement

Permission to undertake experimental animal research was granted by the Pest County Government Office’s Directorate of Food Chain Safety, Hungary under the permit numbers PE/EA/2485-6/2016 and PE/EA/00741-7/2022. All experimental methods described herein were approved by the Institutional Ethics Review Board of the Institute for Farm Animal Gene Conservation (No. 7/2011), in accordance with relevant guidelines and regulations.

Maintenance of experimental stocks

The Oravka fertile eggs which were used in our experiment came from the rearing of the National Agricultural and Food Centre, Research Institute for Animal Production Nitra, Slovakia. The Oravka chicken were kept in barns with large outdoor areas in the institute. The stocking density 2 birds/m2, outside 2 birds/m2. The breeding ratio was maintained at 10 hens per cockerel. There are nest boxes (4 hens/nest) for the collection of eggs. Breeding flocks are fed with a commercially available complete feed mixture with addition of limestone grit. The eggs are collected twice a day, and then stored at 14°C for no more than 10 days.

Isolation and in vitro culture of Oravka PGCs

A total of 90 Oravka chicken eggs were placed in an incubator (MIDI F500S hatchery machine (PL Machine Ltd., Tárnok, Hungary)) with a temperature condition at 37.8°C and 60 % relative humidity. The eggs were turned 45° automatically to both directions (one 90° movement takes 2 hours). The eggs were removed from the incubator after 2.5- day of incubation, and were sanitized by wiping a tissue paper with 70 % ethanol. The eggs were gently cracked open and the embryos including the other egg components were placed in a sterile Petri dish. Most embryos around this timepoint are at Hamilton-Hamburger HH 13-17 stage (Hamburger and Hamilton, 1992), where the dorsal aorta, pumping heart, and peripheral vessels are clearly visible under the stereomicroscope (Zeiss Stemi 305, 0.8-4x, Carl Zeiss AG, Oberkochen, Germany). With a sterile glass microcapillary (Marienfeld No. 2930208, 100mmx1mm, Paul Marienfeld GmbH & Co. KG, Lauda-Königshofen, Germany; tip diameter after pulling and breaking: 30 µm) and a mouth-controlled pipette, 1-3 µl of blood from the dorsal aorta were collected under the stereomicroscope. The collected blood samples were then transferred to a 48-well plate (Thermo Fisher No. 152640, Eugene, United States) containing 300 µl of chicken PGC medium which was identical to the FAcs medium described by McGrew and colleagues (Whyte et al., 2015). Key components of the FAcs medium are FGF, Insulin, and Activin A with the addition of 0.2 % chicken serum. The cultures were kept in a Sanyo MCO-19AIC (UV) CO₂ Incubator (Sanyo, 10040162, Osaka, Japan) in 38°C temperature with 5 % CO₂ concentration. Medium change was done every two days by removing 30 % of the medium gently, without disturbing the PGCs sitting at the bottom of the well, and then refill with 30 % of fresh PGC medium.

Freezing and thawing of Oravka PGCs

For freezing, the cells were collected by gentle pipetting from the well, and then transferred to a 1.5 mL tube (Greiner No. 616201, Kremsmünster, Austria) for centrifugation at 270 x g for 4 min. The medium for freezing was added in two steps, first, the pellet was re-suspended in DMEM (Thermo Fisher No. 21068-028, Eugene, United States) diluted with sterile water (in 2:1 ratio) and with 0.4 % Sodium Pyruvate (Thermo Fisher, No. 11360-039, Eugene, United States) added. Then the cell suspension was transferred to the labelled cryovials and the second part of the freezing medium was added drop by drop (this helps PGCs adapt to changing conditions and avoid the osmotic shock otherwise might be caused by DMSO). Components of the second half of the medium: DMEM (Thermo Fisher, No. 21068-028, Eugene, United States) diluted with sterile water (in 2:1 ratio), 8 % DMSO (Sigma-Aldrich, No.276855, Darmstadt, Germany, final concentration in the cryotube: 4 %), 10 % chicken serum (Sigma-Aldrich, No. C5405, Darmstadt, Germany, final concentration in the cryotube: 5 %), and 150 µM CaCl₂ (Sigma-Aldrich, No. C4901, Darmstadt, Germany, final concentration in the cryotube: 75 µM CaCl₂). The cryovials were then frozen at −80°C and kept there overnight. The following day the cryovials were transferred to liquid nitrogen (−196°C) for long term storage (Lázár et al., 2021; Taylor et al., 2017).

For thawing, the cryovials were placed into a 37°C water bath with gentle agitation. Once completely thawed, the cells were transferred to a 15 mL centrifuge tube (Greiner No. 188261, Kremsmünster, Austria), where 2 mL of chicken PGC culture medium was already added to dilute the DMSO-containing freezing medium. The sample was then centrifuged at 270 x g for 4 min (Jouan GR412, Saint-Herblain, France), and the supernatant was removed. The cell pellet was resuspended in fresh PGC culture medium and plated in a 48-well culture plate (Thermo Fisher No. 152640, Eugene, United States).

Characterization of PGC lines

DNA isolation and sex determination

Tissue samples were collected from both the donor and recipient embryos. Tissue samples were digested in 100 µl lysis buffer and Proteinase K mix (0.1 M Tris (pH 8.5), 5 mM EDTA, 0.2 M NaCl, and 0.2 % SDS with 10 mg/ml Proteinase K at 55°C for 3 h), then subjected to DNA isolation through phenol-chloroform protocol (Sambrook and Russell, 2006). DNA concentration was measured (Nanodrop One Spectrophotometer (Thermo Fisher, Eugene, United States)) in duplicates. The extracted DNA was diluted to 25 ng/µl concentration, then 25 ng of DNA was used per PCR reaction. The sex of the embryos was determined using the CHD1 primer set as described previously by Lee et al. (Lee et al., 2010). The PCR reaction (13 µl / tube): 6.75 µl MyTaq Ready Mix (Bioline, Cat. No. BIO-25045, London, United Kingdom), 0.5 µl forward primer (CHD1: 5′-TATCGTCAGTTTCCTTTTCAGGT-3′), 0.5 µl reverse primer (CHD1: 5′-CCTTTTATTGAT CCATCAAGCCT-3′), 4.25 µl nuclease-free water, 1 µl DNA (25 ng / µl). The PCR program used the following steps: 95°C 60 s, (95°C 15 s, 48°C 30 s, 72°C 10 s) x28, 72°C 5 min., and 4°C forever. The PCR products were loaded onto a 1 % agarose gel (1 g agarose in 100 ml 1xTAE with 0.5 μg/ml EtBr) and run at 120 V for 30 min. The bands were then visualized and photographed under UV illumination (VWR ECN 730-1488 Transilluminator, Leuven, Belgium) was used with a Canon EOS 2000D with EFS 18-55 (Canon, Tokyo, Japan).

Immunohistochemistry

Immunostaining was performed according to the protocol previously described (Ecker et al., 2024; Lázár et al., 2021). Prior to staining, fixation was prepared by dropping 10 µl of PGC suspension (collected fresh from the culture plate) to the slide, then the drop was dried out on a 38°C heated surface. Then 20 µl of 4 % paraformaldehyde (PFA) was added for 10 min at room temperature for fixation. Following, the slides were washed three times with 0.01 % BSA-PBS, each wash lasting 5 min at room temperature. Next, 50 µL of blocking solution (PBS with 0.1 % BSA, 0.1 % Triton™ X-100 (Merck Millipore No. 1.08603, Darmstadt, Germany), and 2.5 % donkey serum) was added to each slide and incubated for 45 min at room temperature. Subsequently, 30 µL of primary antibody solution (diluted in 0.1 % BSA-PBS) was applied to each sample and incubated overnight at 4°C. In this case, the primary antibodies were anti-DAZL (1:100, Abcam No. ab34139, Cambridge, United Kingdom) and anti-P63 (1:100, MyBioSource No. MBS821026, San Diego, United States). Following the overnight incubation, the samples were washed three times with 50 µL drops of 0.01 % BSA-PBS for 5 min each at room temperature. The cells were then incubated with 30 µL of Alexa Flour™ 555 Donkey Anti-Rabbit IgG secondary antibody (1:400, No. A-31572, Thermo Fisher, Eugene, United States) for 60 min at 37°C in a dark, humid chamber. After incubation, the samples were washed with 50 µL of 0.01 % BSA-PBS in the dark at room temperature for 5 min. Next, the cells were stained with 30 µL of TO-PRO™−3 iodide (1:500, No. T3605, Thermo Fisher, Eugene, United States) nuclear stain and incubated in the dark at room temperature for 15 min. This was followed by three additional washing steps with 30 µL of 0.01 % BSA-PBS in the dark, each for 5 min at room temperature. After the final wash, 10 µL of mounting medium (ProLong Diamond Antifade Mountant with DAPI (No. P36962, Thermo Fisher, Eugene, United States)) was added to each sample, and a coverslip was placed on top. The prepared slides were then examined using a confocal microscope (Leica TCS SP8, HC PL APO CS2 63x/1.40 OIL objective, OPSL 552 nm and Diode 638 nm lasers, 565–620 nm and 650–700 nm detection windows, LAS X 3.5.5.19976 software, Leica Microsystems, Wetzlar, Germany).

In this experiment, four selected proliferating chicken PGC lines (two male (Lines #60; #43) and two females (Lines #7; #37)) were used. Cell suspensions were collected from the wells and after centrifugation, the resulting cell pellets were washed in D-PBS once.

Cell counting and proliferation assay

Cell viability and cell counting of the PGCs were performed before freezing using the Arthur Novel Fluorescence Cell Counter (NanoEnTek, Pleasanton, USA). Propidium Iodide was used as a viability dye, the threshold for the red channel was set to 350 RFU for the measurements. Each side of the specialized Arthur slide allows a maximum of 25 µL of cell suspension to be measured. For each cell line, two measurements were taken, and the average was calculated.

A cell proliferation assay was performed using the ImageXpress Pico Automated Cell Imaging System over a period of 72 h, with three parallels for every cell line. Measurements were taken in every 6 h, resulting 12 timepoints altogether. For the DT calculation, timepoints #0 and #12 were used. DT was calculated for every well, then DT values were averaged. Initial cell number was between 100 and 200 cells / well. They were loaded into a 96-well cell culture plate (Greiner, No. 655180, Kremsmünster, Austria) with 100 µl medium. The machine has an environmental control cassette, therefore temperature and CO₂ were controlled (38°C, 5 % CO₂), but medium was not changed during the measurement. Based on the proliferation measurements doubling time (DT) values were calculated for all the PGC lines. DT was calculated as follows: DT = (T × (ln2)) / (ln (Ne / Nb)) where T = time in any units; Ne = cell number at the end; and Nb = cell number at the beginning.

Chromosome analysis

Metaphase chromosomes were generated using the conventional ethanol–acetic acid fixation method combined with air-drying, following the procedure of Alfi and colleagues (Alfi et al., 1973). The four selected PGC lines (Lines #7, #60, #43, and #37) had been maintained in continuous culture for 93 days prior to analysis. Actively proliferating PGC cultures were incubated in a CO₂ incubator at 37.8°C and 60 % relative humidity (MCO-19AIC (UV); SANYO Electric Co. Ltd., Osaka, Japan). To enrich for metaphase-arrested cells, 40 µL of KaryoMAX® Colcemide solution (No. 15212-012, Thermo Fisher Scientific, Eugene, United States), was added to the cultures, resulting in a final concentration of 0.079 µg/mL. After a 2-hour incubation, the culture medium containing PGCs was collected from the cell culture plate (No. 142485, Thermo Fisher, Eugene, United States) and transferred into 15 mL centrifuge tubes. The cell suspension was centrifuged at 300 × g for 7 min at room temperature (RT). The supernatant was carefully removed using a pipette, and the cell pellet was gently resuspended in 4 mL of ice-cold 0.56 % KCL for hypotonic treatment, followed by incubation for 20 min at room temperature. Cells were then fixed using 4 mL of ethanol/acetic acid fixative (3:1, v/v). After a 20-minute fixation period, the cell suspension was centrifuged at 300 × g for 7 min (Heraeus Megafuge 8R; Thermo Fisher, Eugene, United States), and the supernatant was removed. This fixation step was repeated two additional times. The entire fixation procedure required approximately 85 min. The final cell suspension was dropped onto humid microscope slides, air-dried, and stained with freshly prepared 5 % KaryoMAX® Giemsa stain improved R66 solution (No. 10092-013, Thermo Fisher; Grand Island, NY, USA) in phosphate buffer (pH 7.0) for 7–8 min. Five slides were prepared per cell line, and at least 30 metaphase spreads per line were analysed. Only well-spread metaphases with clear background and without overlapping chromosomes were selected for evaluation.

RNA isolation, cDNA synthesis, and gene expression measurement (qPCR)

Cells were collected from four (Lines #7; #60; #43; #37) selected proliferating cell cultures (two male and two female cell lines) for RNA isolation (10 wells of a 24-well cell culture plate). After centrifugation (270 x g for 4 min (Jouan GR412, Saint-Herblain, France)) the pellets were washed with 500 µL of DPBS (Gibco, No. 14190144, Thermo Fisher; Grand Island, USA), then the supernatant was removed, and 100 µL of Lysis buffer (RNAquariousTM-Micro Total RNA Isolation Kit, Thermo Fisher; Waltham, USA) was added to each tube. The tubes were stored at −80°C before RNA isolation.

RNA isolation was done with the RNAquariousTM-Micro Total RNA Isolation Kit (Thermo Fischer Scientific, Waltham, USA) according to the manufacturer’s instructions. RNA concentration was then measured and RNA samples were stored at −80°C for further analysis.

Prior to cDNA synthesis, the concentration of the isolated RNA of each sample was then diluted to 25 ng/µL. cDNA synthesis was done with the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher, Waltham, USA) according to the manufacturer’s instructions. The PCR conditions were as follow: 10 min preheating at 25°C, 120 min incubation at 37°C, and a 5 min heat treatment at 85°C. qPCR reactions were prepared with the Power SYBRGreen PCR Master Mix (Thermo Fisher, Foster City, USA). The set of primers used in this experiment were DDX4 (CVH), POU5F3 (OCT4), and DAZL. GAPDH was used as a housekeeping reference gene (Table 1.)

Table 1.

Set of primers used in the gene expression analysis.

Gene Symbol	Gene Full Name (organism)	NCBI Number		Primers	Product Length (bp)
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase (Gallus gallus)	NM_204305.1	FW RV	GACGTGCAGCAGGAACACTA CTTGGACTTTGCCAGAGAGG	112
POU5F3	POU domain class 5 transcription factor 3 (Pou5f3) (Gallus gallus)	NM_001110178.1	FW RV	GAGGCAGAGAACACGGACAA TTCCCTTCACGTTGGTCTCG	109
DDX4	DEAD-box helicase 4 (DDX4)(Gallus gallus)	NM_204708.1	FW RV	GAACCTACCATCCACCAGCA ATGCTACCGAAGTTGCCACA	113
DAZL	Deleted in Azoospermia Like	NM_204218.1	FW RV	TTGTCTTGAAGGCCTCGTTT ATCCTTGGCAGGTTGTTGAC	863

Transmission electron microscope (TEM)

To analyse the ultrastructure of cultured PGCs by TEM, cell samples from two male (Lines #60; #43) and two female (Lines #7; #37) proliferating lines were prepared as described in the study of Duranova and colleagues (Duranova et al., 2022). Briefly, cell pellets were firstly fixed in Karnovsky fixative and subsequently washed in sodium cacodylate buffer. Then, samples were embedded into agar, postfixed again 1 % OsO4 in sodium cacodylate buffer and dehydrated in acetone. At last, samples were embedded into Poly/Bed resin and cut to ultra-thin sections (70 nm) and collected on nickel grids. TEM analysis was performed using JEOL JEM-2100 transmission electron microscope (JEOL, Tokyo, Japan) operating at 200 kV.

PGC in vivo migration assay

For the migration assay frozen-thawed cells were used. One male and one female cell line (Lines #7; #60) were selected to evaluate the migration and colonization capabilities of the cultured and cryopreserved cells. The cell lines were stained with PKH26 (PKH26 Red Fluorescent Cell Linker Kit, St. Louis, USA) fluorescent dye according to the manufacturer’s protocol before being injected into 2.5-day-old chicken embryos (Kong et al., 2018; Lázár et al., 2021). The two cell lines were injected separately.

The eggs of the recipient embryos were incubated under the same conditions as the Oravka eggs. The eggs were sanitized with 70 % ethanol before creating a window (approximately 1 to 2 cm) in the eggshell using sterilized forceps.

A sterilized glass microcapillary paired with a mouth pipette was used for the injection (characteristics of the capillary are the same as used for blood isolation). Approximately 2–3 µL of stained PGCs were injected into the heart of each recipient embryo. The cell suspensions contained an average of approximately 8,500 PGCs per µL for the female and male cell lines. After injection, the windows were sealed with two layers of sterilized parafilm and a lighter. The injected eggs were marked and returned to the incubator to continue embryonic development.

After a further 4 days of incubation, the injected eggs were opened, and the mesonephros along with the gonads were dissected under a stereomicroscope. The tissues were fixed in 4 % PFA. Following fixation, the isolated kidney-gonadal complexes were transferred to 1X PBS for rehydration and photo documentation using a LEICA fluorescence stereomicroscope (Leica M205 FA, Leica Microsystems, Wetzlar, Germany). The presence of the marked PGCs was scored qualitatively, thus categorized as ‘colonized’ and ‘not-colonized’ gonads.

Results

Isolation of PGCs and establishment of stable in vitro cultures

From the 90 Oravka eggs used for blood collection, there were 64 embryos adequate for blood isolation (11 eggs were infertile, 10 embryos were too young for isolation, and 5 embryos died early). This results an 87.8 % fertility rate, which is typical for the Oravka flock used in this study. From those blood samples, 18 stable cell cultures were established successfully with healthy, round, actively proliferating cells (Fig. 2). This indicates that the derivation rate from the Oravka breed is 28 %. The derivation rate was calculated as follows: no. of established PGC lines / no. of blood samples collected. Among these cell lines, 12 were female and 6 were male, as shown in Table 2, Table 3. For each cell line, six parallel cryotubes were frozen and then stored in the gene bank at −196°C. The number of cryopreserved PGCs per cryotube depends on the proliferation rate of each cell line, since we wanted to store all valuable cells, equalization of cell number between cell lines before freezing was not performed.

Fig. 2.

Typical morphology of in vitro cultured Oravka PGC lines #7 (female) and #60 (male). Scale bar: 100 μm.

Table 2.

Summary table of PGC isolation, derivation rate and frozen samples in the gene bank.

Breed	No. of isolations	No. of cell cultures	No. of male cell lines (%)	No. of female cell lines (%)	Derivation rate	No. of cryotubes in genebank
Oravka	64	18	6 (33,3)	12 (72,2)	28,1 %	108

Table 3.

Details of established Oravka PGC cultures.

ID	Viability (%)	No. of PGCs/cryotube	Gender
#12	87,23	315000	M
#62	95,88	336250	F
#7	93,41	2292500	F
#43	91,06	328750	M
#37	95,69	4287500	F
#60	82,63	1016250	M
#3	97,33	275500	F
#39	97,45	3537500	F
#14	93,27	950000	F
#38	70,66	62500	F
#13	85,29	522500	M
#53	85,49	616250	F
#15	89,03	358750	M
#51	85,34	157625	F
#19	95,66	1192500	F
#50	70,00	58625	F
#10	86,86	218500	M
#61	76,87	175250	F

Characterization of Oravka PGC lines in vitro

Validation of PGCs was done through immunohistochemistry, gene expression analysis, karyotyping, cell proliferation assays, TEM, and in vivo migration assay.

Immunostaining was carried out using two female and two male cell lines (Lines #7; #60; #43; #37). Each tested cell line exhibited germ cell–specific DAZL staining and P63 staining, the latter being associated with certain stem or progenitor cell populations, and it was shown to stain embryonic germ cells (Lin et al., 2021; Molnár et al., 2019). The germ cell–specific DAZL was stained red, P63 was also stained red, and TO-PRO-3, used as a nuclear stain, was stained blue. Fig. 3 shows representative images of lines #7 and #60.

Fig. 3.

Germ cell specific immunohistochemistry of Oravka PGC lines #7 and #60. Merged images of DAZL (red) or p63 (red) and nuclear staining (NS, blue, TO-PRO-3®). n = 4 (2 male, 2 female). This figure shows representative images of two lines. Scale bar: 20 μm.

Four (4) PGC lines were selected for gene expression analysis, comprising two females and two males (Lines #7; #60; #43; #37). All selected PGC lines showed expression of the germ cell–specific markers DDX4 and DAZL, furthermore the pluripotency-associated POU5F3 (Fig. 4).

Fig. 4.

Germ cell and stem cell-specific marker expression of PGC lines from the Oravka breed. Expression levels of DDX4, POU5F3 and DAZL genes compared to the GAPDH housekeeping gene. n = 4 (2 male, 2 female), this figure shows all tested lines.

The doubling time was analyzed using the ImageXpress Pico Automated Cell Imaging System. All 18 PGC cultures were analysed. The minimum DT was 15.94, the maximum DT was 30.69 while the mean DT value is 22.86 ± 4.5 SD. Significant difference was not found between female (23.31 ± 4.74 SD) and male (21.94 ± 4.23 SD) PGC lines (Student’s t-test, p = 0.545). Fig. 5. presents the doubling time data for the 18 Oravka PGC lines established.

Fig. 5.

Proliferation measurement assay for the established Oravka PGC lines. (A) Doubling time (DT) was calculated for all female and male lines. The minimum DT was 15.94, the maximum DT was 30.69 while the mean DT value is 22.86 ± 4.5 SD. (B) Significant difference was not found between female (23.31 ± 4.74 SD) and male (21.94 ± 4.23 SD) PGC lines (Student’s t-test, p = 0.545).

Chromosome analysis of selected Oravka PGC lines

All four selected Oravka PGC lines (#7; #60; #43; #37) exhibited normal chromosomal constitutions with no detectable abnormalities. As expected, male PGC lines showed two Z chromosomes (ZZ), and female PGC lines showed only one Z chromosome and one W chromosome (ZW), as seen in Fig. 6. In domestic chickens, the karyotype comprises, in addition to the sex chromosome pair, eight pairs of macro-autosomes, all of which showed a normal morphology in the examined lines. Beyond these, the genome contains 38 or more microchromosomes (Shibusawa et al., 2004); however, standard karyotype analyses are typically limited to macrochromosomes.

Fig. 6.

Chromosome analysis. The analysis from the four selected Oravka PGC lines (#60; #43; #7; #37) showed no chromosomal abnormalities and no degradation of the sexual chromosomes due to the long-term culture in the cell lines. Black arrows indicate sex chromosomes. Scale bar: 10 μm.

Based on these observations, the 93-day long-term in vitro maintenance of the four analysed PGC lines did not result in detectable chromosomal abnormalities.

Transmission electron microscope (TEM) analysis

The ultrastructure of proliferating PGCs was observed under transmission electron microscope. The cultured PGCs exhibited relatively large and round nucleus located in the centre of cell with high nucleocytoplasmic ratio and clearly visible nucleolonema responsible for ribosome production. The large number of ribosomes are scattered throughout the cytoplasm together with abundant mitochondria and typical yolk granules, as seen in Fig. 7.

Fig. 7.

Transmission electron microscope analysis. (A) Illustrative electron micrograph of two entire chicken PGCs derived from male Line #60. (B) Closer detail on the organelles in chicken PGC. Cultured chicken PGCs exhibit large round-shaped nucleus (N) surrounded by nuclear envelope (Ne) with marked nucleolus (Nc). The cytoplasm of cells contains numerous mitochondria (M) of round or elliptical shape with clearly visible cristae as well as typical yolk granules (YG) and ribosome scattered throughout the whole cytoplasm.

Migration assay as validation of Oravka PGC lines in vivo

The cultured PGCs were stained with PKH26 and injected into recipient embryos to evaluate and validate their cellular function and migratory activity toward the gonads of the recipient embryos. Embryos from the Hungarian Partridge-colour chicken breed were used as recipients. A total of 30 eggs were incubated for the injection experiment from which 14 embryos were injected with Oravka PGCs. The remaining eggs were either infertile or contained very early-stage embryos. Of the 14 injected, 9 embryos survived until day-6.5 when gonads were dissected (64,3 % survival rate for the injection procedure). All alive recipient embryos were positive for the donor PGCs resulting in a 100 % success rate for colonization (Table 4). From the 9 successful injections, both the female and the male Oravka PGC line colonized the gonads of the recipient embryos. All 9 recipient embryos exhibited strong red fluorescence from the PKH26 staining (Fig. 8). Among the 9 surviving recipient embryos, 7 were female and 2 were male. The male PGC line was successfully introduced into 3 female and 1 male recipient embryos. On the other hand, the female PGC line was successfully introduced into 4 female and 1 male recipient embryos. We acknowledge that the sample size for this assay was rather small, however it was a proof-of-concept experiment and was not meant as a comparative result.

Table 4.

Results from the gonad colonization assay.

Breed	No. of injections	No. of live embryos (%)	No. of colonizations	No. of colonizations with ♀ PGCs	No. of colonizations with ♂ PGCs	Colonization rate (%)
Oravka	14	9 (64.3)	9	5	4	100.0

Fig. 8.

In vivo migration assay. Fluorescently labelled (red, Sigma PKH26) PGCs were injected into the heart of 2.5-day-old recipient embryos. Embryonic gonads were screened at embryonic day-6.5 for the presence of injected cells. Representative integration of the male #60 and female #7 PGC lines are shown (Scale bar: 1 mm).

Discussion

Preserving the genetic material of the Oravka chicken breed is of great importance, as this breed is recognized as endangered and is native to Slovakia (Hanusova et al., 2017b). PGCs isolated from the dorsal aorta of 2.5-day-old embryos were utilized for cell culture establishment, as circulating PGCs are found in the early embryonic circulatory system during their migration to the genital ridges (Chen et al., 2025; Morimoto and Saito, 2025).

Chicken PGCs represent the most suitable genetic material for cryoconservation because both the male and the female genetic information can be stored (Benesova and Trefil, 2016; Sun et al., 2022), unlike with sperm, which preserves only the male (ZZ) chromosome set. In this study, the establishment of stable Oravka PGC lines was successfully achieved resulting a total of 18 PGC lines, comprising both males and females.

The number of PGCs in each cell line varied according to their proliferation rate, as some PGCs exhibited faster growth than others. Regardless of doubling time, the stored PGCs upon thawing and reculturing, proliferated efficiently in the PGC-specific culture medium therefore, if needed, millions of cells could be produced within a month with further culturing.

The derivation rate of the cryopreserved Oravka PGCs is 28.1 %, which is comparable to that of the Hungarian Partridge-coloured breed at 28.4 % (Lázár et al., 2021). However, this rate is relatively low compared with other chicken breeds, many of which exceed 50 %. For example, the Chinese chicken population shows a derivation rate of 81.6 % (Kinoshita et al., 2024). Some Chinese breeds, such as Rugao Yellow and Shouguang, exhibit derivation rates of 45 % and 39.1 %, respectively, which are also below the 50 % threshold (Liu et al., 2025). Additionally, several other Hungarian breeds demonstrate higher derivation rates ranging from 37 % to 50 %, including the Speckled Transylvanian naked neck (37.5 %), Black Transylvanian naked neck (39.7 %), White Hungarian (47.6 %), Speckled Hungarian (48.7 %), and Yellow Hungarian (50 %) (Lázár et al., 2021). In our opinion, these differences – to a great extent – can be explained by breed-specificity. Different species require significantly different media compositions (Doddamani et al., 2025; Nicholson et al., 2025), so it is possible that there are differences between breeds that could cause such variation in the rate of derivation. In addition to that, technical factors such as operator skill, quality of the medium components (even if the recipe is the same) or the stage of the embryos could potentially have an effect too, which makes an objective comparison challenging.

Characterization of the PGCs was performed using immunostaining, gene marker expression analysis via quantitative PCR (qPCR), proliferation assays, and in vivo migration assessment to the gonads of recipient embryos. Immunostaining results revealed positive fluorescence signals for the germ cell–specific markers DAZL and P63. These findings were consistent with the gene expression analysis, which confirmed that the selected PGC lines expressed the germ cell– and stem cell–specific markers DDX4, DAZL, and POU5F3. In addition to these findings, the DDX4 gene had shown higher expression levels in male PGC lines than in females. This was expected because this gene is located on the Z chromosome, which is duplicated in males (Soler et al., 2021). TEM analysis showed typical ultrastructure of chicken PGCs as demonstrated previously by Kress et al. (Kress et al., 2016) or Svoradová et al. (Svoradová et al., 2019).

All established cell lines exhibited stable proliferation (mean DT value 22.86 ± 4.5 SD). Their rate of division enabled us to produce and collect the required number of cells for characterisation and freezing within a reasonable time period. Based on our estimations, DT values below 40 hours are suitable for gene banking applications (this was not a limiting factor in this project; the longest DT was 30.69). Their DT values are comparable to those reported for Hungarian breeds, in which most cell lines exhibited shorter doubling times, while only a few showed average doubling times (Lázár et al., 2021). The difference in proliferation could be breed specific, however culture conditions can have an effect as well. Clarifying this requires further studies.

Karyotyping analysis confirmed that the cell lines exhibited normal karyotypes with no detectable abnormalities. Similarly, karyotyping of PGCs derived from long-term culture has been shown to reveal normal karyotypes (Ecker et al., 2024). Furthermore, this technique also enabled sex determination of the PGC lines, complementing the results obtained through PCR-based sex identification. As seen from Fig. 6, male PGC lines showed two Z chromosomes (ZZ) and female PGC lines showed only one Z chromosome and one W chromosome (ZW).

For the in vivo migratory assay of the cultured PGCs, PKH26-stained PGCs were injected into the dorsal aorta of host embryos. The labelled cells successfully migrated to the genital ridges and colonized the gonads, as observed under fluorescence imaging (see Fig. 8). These results indicate that the stained PGCs, originally isolated from 2.5-day-old Oravka chicken embryos and maintained in culture for several weeks, then frozen-thawed (Hu et al., 2022; Lázár et al., 2021) retained their migratory ability and capacity to integrate into the gonads of recipient embryos. This in vivo colonization assay is used to evaluate the migratory capacity of PGCs in recipient embryos and to generate chimeric offspring (Hu et al., 2022; Lázár et al., 2021; Molnár et al., 2019; Szczerba et al., 2020). The success rate of PGC integration to the gonads of the recipient embryos typically ranges from 60 % to 100 %. Reported efficiencies include Hungarian Partridge (76.2 %), Speckled Transylvanian Naked Neck (77.8 %), Yellow Hungarian (100 %), Black Transylvanian Naked Neck (100 %) breeds (Lázár et al., 2021), as well as Rugao Yellow (68.4 %) and Shouguang (72.3 %) chicken breeds (Liu et al., 2025).

A total of 108 cryopreserved samples were deposited in the gene bank. These were derived from 12 female and 6 male individual embryos. This is at the lower end of the sample size FAO recommends (FAO, 2012) for such collections, and the sex ratio is not around 50–50 %, thus we are aiming to expand sample size in future iterations of the project. In this study, we did not examine how well the genetic variability of the original flock was represented by the samples we collected. This is a limitation and should be addressed in the future. Nevertheless, the samples collected and characterized in this project provide a foundational resource for the conservation and future restoration of this unique local chicken breed.

List of abbreviations

GAPDH – Glyceraldehyde-3-Phosphate Dehydrogenase

CHD1 – Chromo-Helicase-DNA Binding Protein 1

CVH – Chicken Vasa Homolog (identical to DDX4)

DAZL – Deleted in Azoospermia-Like

DDX4 – DEAD-Box Helicase 4 (identical to CVH)

DMEM – Dulbecco’s Modified Eagle Medium

DMSO – Dimethyl Sulfoxide

DT – Doubling Time

FAO – Food and Agriculture Organization

HH – Hamburger–Hamilton Stages

PFA – Paraformaldehyde

PGCs – Primordial Germ Cells

PKH26 – Red Fluorescent Cell Linker for Cell Membrane Labeling

POU5F3 – POU domain class 5 transcription factor 3

P63 – Tumor Protein p63

TEM – Transmission Electron Microscope

TO-PRO-3 – Nuclear Stain

CRediT authorship contribution statement

Jehan Nayga: Writing – original draft, Project administration, Investigation. Bence Lázár: Writing – original draft, Visualization, Supervision, Methodology, Investigation, Conceptualization. Arnold Tóth: Investigation. Mariann Molnár: Investigation. Maria Teresa Salinas Aponte: Investigation. Jaromír Vasícek: Writing – review & editing, Visualization, Methodology, Investigation. Andrej Balázi: Writing – review & editing, Investigation. Jakub Vozaf: Writing – review & editing, Investigation. Lucia Olexiková: Investigation. Peter Chrenek: Writing – review & editing, Supervision, Resources, Funding acquisition, Conceptualization. Krisztina Liptói: Resources, Funding acquisition. Elen Gócza: Writing – review & editing, Resources. Eszter Várkonyi: Writing – original draft, Supervision, Methodology, Investigation, Conceptualization.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

The data and materials supporting this study are available from the corresponding author upon reasonable request.