Galangin alleviates cold stress-induced splenic injury in Danzhou chickens by inhibiting NLRP3 inflammasome-mediated pyroptosis

Highlights

• •Galangin, a dietary flavonoid, mitigates cold-stress induced spleen injury in chickens.
• •It suppresses the NLRP3-mediated pyroptosis pathway in chicken spleen and macrophages.
• •Molecular docking indicates a direct binding affinity between galangin and NLRP3.
• •Galangin shows potential as a plant-derived feed additive against cold stress in poultry.

Abstract

Cold stress poses a significant challenge to the poultry industry, leading to impaired health and economic losses. However, the specific mechanisms by which cold stress induces injury in the chicken spleen, a critical immune organ, remain poorly defined. This study aimed to investigate the protective effects of the natural flavonoid galangin against cold stress-induced splenic injury and to elucidate the underlying mechanisms, with a focus on the NLRP3 inflammasome-mediated pyroptosis pathway. Using an in vivo chicken model, we demonstrated that acute cold exposure (10±1°C for 48 h) significantly induced splenic structural damage, characterized by lymphoid depletion and necrotic debris. This was accompanied by a profound disruption of redox homeostasis, marked by increased malondialdehyde (MDA) and suppressed antioxidant enzyme activities, alongside robust activation of the NLRP3/caspase-1/GSDMD pyroptosis pathway and elevated levels of inflammatory cytokines (IL-1β, IL-18). Notably, prophylactic administration of galangin (50 mg/kg) effectively mitigated all these pathological changes in vivo, restoring antioxidant capacity, reducing inflammation, and inhibiting pyroptosis. In vitro studies using chicken HD11 macrophages confirmed that galangin suppressed cold stress-induced oxidative damage, inflammation, and pyroptosis. Critically, the protective effects of galangin were reversed upon NLRP3 overexpression, confirming that galangin acts, at least in part, by directly targeting this inflammasome. Molecular docking further predicted a strong binding affinity between galangin and the NLRP3 protein. In conclusion, this study identifies NLRP3-mediated pyroptosis as a key mechanism in cold stress-induced splenic injury and demonstrates that galangin alleviates this damage by inhibiting this pathway. These findings support the potential of galangin as a natural feed additive to enhance resilience against cold stress in poultry.

Introduction

Modern intensive poultry production faces significant threats from environmental stressors, which compromise animal welfare and economic sustainability. Among these, cold stress is a major challenge, responsible for substantial global economic losses estimated in billions of dollars annually. These losses result from reduced growth rates, impaired feed efficiency, increased morbidity, and elevated mortality (Ncho et al., 2025). Physiologically, chronic or acute cold exposure causes systemic damage, including growth retardation, oxidative stress, and multi-organ injury (Li et al., 2025a). The spleen—a key peripheral immune organ central to mounting immune responses and regulating inflammation—is particularly vulnerable. However, the underlying molecular mechanisms, especially those linking cold stress to inflammatory cell death pathways like pyroptosis in splenic immune cells, remain poorly understood. Clarifying how cold stress impairs this critical immune organ is therefore of both theoretical and practical importance.

The conventional approach to mitigating cold stress relies on environmental management through improved insulation and heating. Although effective, this strategy demands considerable capital investment and ongoing energy costs, which can be prohibitive for small-to-medium-scale operations, particularly in developing regions. Consequently, cost-effective nutritional interventions have gained attention as a viable alternative. Evidence shows that specific dietary supplements can enhance systemic resilience against cold stress. For example, resveratrol supplementation alleviates cardiac injury in cold-stressed broilers by enhancing antioxidant defenses and suppressing pyroptosis (Wei et al., 2024). Similarly, sodium butyrate attenuates intestinal barrier damage and pyroptosis, partly by inhibiting the NLRP3/Caspase-1 pathway (Jiang et al., 2025), and Eucalyptus globulus essential oil improves growth performance and redox status in broilers under cold-induced ascites (Mohebodini et al., 2025). These findings support the potential of dietary bioactive compounds in protecting against cold stress-induced immunopathology.

Inflammatory activation is a central event in stress-related tissue injury. The NLRP3 inflammasome acts as a critical innate immune signaling hub that integrates various danger signals, including excess ROS generated during oxidative stress (Bai et al., 2020). Upon activation, NLRP3 recruits ASC and procaspase-1 to form a multiprotein complex, leading to caspase-1 activation. Active caspase-1 cleaves gasdermin D (GSDMD), whose N-terminal fragments form plasma membrane pores, resulting in pyroptosis—a lytic, pro-inflammatory form of cell death accompanied by the release of IL-1β and IL-18 (Swanson et al., 2019; Zhang et al., 2025). Unlike apoptosis, pyroptosis amplifies inflammatory cascades and disrupts tissue homeostasis. Oxidative stress is a well-established trigger for NLRP3 activation, and the transcription factor Nrf2 plays a key role in counteracting this process (Rojo de la Vega et al., 2018). Although the NLRP3-pyroptosis axis has been implicated in various stress-induced organ injuries (Jain et al., 2025), its role in cold stress-related splenic damage in avian species remains unclear.

Within the spleen, macrophages are key innate immune sentinel cells, crucial for initiating and regulating inflammatory responses through cytokine secretion. Under cold stress, macrophages are likely a cellular nexus where oxidative stress triggers aberrant inflammatory signaling (Chancellor-Freeland et al., 1995). The chicken macrophage cell line HD11 provides a relevant in vitro model for studying these mechanisms, as it retains core macrophage functions and has been used to investigate NLRP3 inflammasome activation in avian systems (Peng et al., 2022).

Natural phytochemicals represent a promising therapeutic avenue due to their safety and multi-target bioactivity. Galangin, a flavonoid found abundantly in Alpinia officinarum, exhibits strong anti-inflammatory and antioxidant properties. It has been shown to modulate signaling pathways such as PI3K/Akt and NF-κB (Wu et al., 2024), activate the Nrf2 pathway to inhibit ferroptosis (Li et al., 2025b), and protect against stress-related pathologies through integrated antioxidative and anti-inflammatory actions (Scarlata et al., 2025; Wang et al., 2023). However, its efficacy and mechanism in mitigating cold stress in poultry remain unexplored.

Therefore, this study aimed to establish in vivo and in vitro cold stress models using chickens and HD11 macrophages to: (1) determine whether cold stress induces splenic injury and activates the NLRP3-mediated pyroptosis pathway; (2) evaluate the preventive effects of galangin pretreatment against such damage; and (3) elucidate whether galangin exerts its preventive action by suppressing the NLRP3-pyroptosis pathway, potentially via modulation of Nrf2 signaling. The findings are expected to advance the understanding of cold stress-induced immunosuppression and offer a natural dietary strategy to enhance poultry resilience under environmental challenges.

Materials and methods

Animals and treatments

In this study, 40 healthy 45-day-old Danzhou chickens were obtained from Danzhou City Rehe Science Ecological Breeding Co., Ltd. The chickens were randomly assigned to two groups: a control group (CON) and a cold stress group (CS), each containing 20 chickens. Chickens in the CON group and the CS group were raised in temperature-controlled environments for 48 hours, with temperatures of 30±1°C for the CON group and 10±1°C for the CS group. All chicken were provided with the same diet and had ad libitum access to feed and water. The experimental procedures complied with the ARRIVE guidelines and the Animal Welfare Act of the Ministry of Science and Technology, China, and were approved by the Animal Care and Use Committee of Hainan University (Approval No. HNUAUCC-2024-00150).

Blood samples were collected via decapitation into anticoagulant tubes. After standing at room temperature for serum separation, the samples were centrifuged at 3000 rpm for 10 min at 4°C. The supernatant was aliquoted and stored at –80°C. Spleen tissues from each group were dissected, fixed in 4% paraformaldehyde for histological analysis, and snap-frozen in liquid nitrogen for subsequent molecular analyses. All tissue samples were stored at –80°C until use. For subsequent analyses, spleen tissue samples from each group were allocated as follows: samples from 3 chickens per group were used for RNA-Sequencing (transcriptomic analysis); samples from the remaining 17 chickens per group were used for histological examination (H&E staining), oxidative stress marker assays, Western blotting, qRT-PCR, immunofluorescence staining, LDH activity assays, and ELISA.

Galangin treatment in vivo

To evaluate the protective effects of galangin against cold stress-induced splenic injury, an additional 80 healthy 45-day-old Danzhou chickens were randomly assigned to four groups (n = 20 per group): a cold stress group (CS+vehicle), and three galangin treatment groups (CS + 12.5 mg/kg galangin, CS + 25 mg/kg galangin, and CS + 50 mg/kg galangin). Galangin (MCE, MW.270.24) was dissolved in physiological saline to achieve the indicated concentrations and administered via oral gavage once daily for three consecutive days. The CS+vehicle group received an equal volume of physiological saline by gavage. Following the final gavage, all chickens were subjected to cold stress at 10 ± 1°C for 48 h with ad libitum access to feed and water. After cold exposure, chickens were euthanized by cervical dislocation, and spleen tissues were collected for subsequent analyses as described above.

Hematoxylin and eosin (H&E) staining

For histopathological examination, spleen tissues from chickens were fixed in 4% paraformaldehyde, dehydrated through a graded ethanol series, cleared in xylene, and embedded in paraffin. The embedded tissues were sectioned at a thickness of 5 μm. Subsequently, the sections were deparaffinized, rehydrated, and stained with hematoxylin and eosin (H&E) according to standard protocols. Finally, the stained sections were sealed with neutral balsam.The morphological changes in the spleen tissues were observed and imaged under a light microscope.

Analysis of oxidative stress markers

The oxidative stress levels in chicken spleen tissues and HD11 cells were assessed by measuring the activity of key antioxidant enzymes and the content of oxidative products. Spleen tissues were homogenized in cold saline (0.9% NaCl), while HD11 cells were sonicated on ice. The homogenates were then centrifuged at 12,000 × g for 10 minutes at 4 °C to collect the supernatant.According to the manufacturer's instructions, the supernatants were used to determine the activity of total superoxide dismutase (T-SOD), catalase (CAT), total glutathione (T-GSH), glutathione peroxidase (GSH-Px), Glutathione Reductase (GR), total antioxidant capacity (T-AOC), and the content of malondialdehyde (MDA) and reduced glutathione (GSH) using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, China).

RNA-sequencing and bioinformatics analysis

Total RNA was extracted from spleen tissues of 3 randomly selected chickens from each group (CON and CS) using TRIzol reagent. The integrity and concentration of RNA were assessed using an Agilent 2100 Bioanalyzer. Sequencing libraries were constructed from high-quality RNA samples using the Illumina TruSeq Stranded mRNA Sample Prep Kit according to the manufacturer's instructions. The libraries were sequenced on an Illumina NovaSeq 6000 platform to generate 150 bp paired-end reads. The raw sequencing data were subjected to quality control using fastp (version 0.23.2) to remove adapters and low-quality reads, resulting in clean reads. The clean reads were then aligned to the chicken reference genome (GRCg7b) using HISAT2 (version 2.2.1). The resulting sequence alignment/map (SAM) files were converted to binary alignment/map (BAM) files and sorted using SAMtools (version 1.12). Read counts for each gene were obtained using featureCounts (version 2.0.3). Differential gene expression analysis between the CON and CS groups was performed using the DESeq2 package (version 1.34.0) in R. Genes with an absolute value of |log2(Fold Change)| > 1 and an adjusted P-value (FDR) < 0.05 were considered differentially expressed genes (DEGs). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of the DEGs were conducted using the clusterProfiler package (version 4.2.2). A protein-protein interaction (PPI) network was constructed using the STRING database and visualized with Cytoscape software (version 3.9.1). The raw sequencing data generated in this study have been deposited in the Genome Sequence Archive of the China National Center for Bioinformation under accession number CRA036864.

Immunofluorescence staining

Immunofluorescence staining was performed on paraffin-embedded sections of chicken spleen tissue. Briefly, after deparaffinization and antigen retrieval, the sections were blocked with 5% BSA for 1 hour at room temperature. Then, the sections were incubated overnight at 4 °C with specific primary antibodies NLRP3 (Servicebio, GB114320, China) and Nrf2 (Bioss, bs-1074R, Beijing, China). After washing with PBST, the sections were incubated with goat anti-rabbit IgG (Servicebio, GB21303, China) as the secondary antibody for 1 hour at room temperature in the dark. Cell nuclei were counterstained with DAPI for 5 minutes. Finally, the sections were mounted with an anti-fade mounting medium. Fluorescence images were captured using a fluorescence microscope.

Western blotting

Chicken spleen tissues were homogenized and HD11 cells were lysed in RIPA lysis buffer supplemented with protease and phosphatase inhibitors. The lysates were centrifuged at 16,000 × g for 15 min at 4 °C, and the supernatants were collected. Protein concentrations were determined using a bicinchoninic acid (BCA) assay kit according to the manufacturer’s instructions. Equal amounts of protein were separated on 8–12% SDS-PAGE gels. Electrophoresis was performed initially at 80 V for 30 min through the stacking gel, followed by 120 V for 30 min through the separating gel. The resolved proteins were then transferred to PVDF membranes at 200 mA for 60 min under refrigeration. After transfer, the membranes were blocked with 5% non-fat milk in TBST for 2 h at room temperature. Subsequently, the membranes were incubated with specific primary antibodies (diluted as indicated in Table 1) overnight at 4 °C. Following three washes with TBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Abclonal, AS038, Wuhan, China) for 1 h at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) system (Bio-Rad, Hercules, CA, USA). The band intensities were quantified using ImageJ software and the expression levels were normalized to β-actin as an internal control. All antibodies used in this study are listed in Table 1.

Table 1.

The antibodies used in the present study.

Antibody name	Dilution ratio	kDa	Resource	Article number
β-actin	1:10000	43	Abclonal Technology, China	AC026
NLRP3	1:1000	118	Wuhan Servicebio Technology, China	GB114320-50
Nrf2	1:500	68	Biosynthesis Biotechnology, China	bsm-61093R
P65	1:1000	65	Proteintech Group, USA	10745-1-AP
P-P65	1:1000	61	Biosynthesis Biotechnology, China	bs-0982R
GSDMD	1:500	53	WanLei Biotechnology, China	WL05686
Pro-caspase1(cleaved-caspase1)	1:1000	45(25)	Abclonal Technology, China	A0964
GSDMD-N	1:500	31	WanLei Biotechnology, China	WL05411
ASC	1:500	22	WanLei Biotechnology, China	WL02462
IL-18	1:500	22	WanLei Biotechnology, China	WL01127
IL-1β	1:500	17	WanLei Biotechnology, China	WL02257

Real-time quantitative PCR

Total RNA was extracted from chicken spleen tissues and HD11 cells using TRIzol reagent (ThermoFisher Scientific, MA). cDNA was synthesized from 1 μg of total RNA using a reverse transcription kit (abclonal, China). qRT-PCR was performed using SYBR Green Master Mix (abclonal, China) on a CFX Connect™ Real-Time PCR System (Bio-Rad, Hercules, CA, USA). The PCR conditions were as follows: 95°C for 30 sec, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec.The relative mRNA expression levels were calculated using the 2^(-ΔΔCt) method, with β-actin as the internal reference gene. All primer sequences are listed in Table 2.

Table 2.

The primers used in the present study.

Gene	Accession number	Forward(5′−3′)	Reverse(5′−3′)
GAPDH	NM_204305.2	AGGACCAGGTTGTCTCCTGT	CCATCAAGTCCACAACACGG
IL-1β	XM_046931582.1	CTTCATCTTCTACCGCCTGGACAG	CTGGTCGGGTTGGTTGGTGATG
IL-18	XM_015297948.4	CAAAGTGCCAGTGAACCCCAGAC	ACAGAGAGGGTCACAGCCAGTC
TNF-α	XM_040647304.2	CTGAGGCATTTGGAAGCAGC	ATGAAGGTGGTGCAGATGGG
TLR4	NM_001030693.1	AGGCACCTGAGCTTTTCCTC	TACCAACGTGAGGTTGAGCC
Nrf2	XM_046943480.1	GATAAACCTTCAGGCCGTCT	ACTGAACTGCTCCTTCGAC
COX2	NM_001167719.2	TGTCCTTTCACTGCTTTCCAT	TTCCATTGCTGTGTTTGAGGT

Lactate dehydrogenase (LDH) activity assays

The lactate dehydrogenase (LDH) activity in chicken spleen tissues and the LDH release from HD11 cells were determined using a commercial assay kit (Nanjing Jiancheng Bioengineering Institute, China), following the manufacturer's instructions. For spleen tissues, samples were homogenized in cold saline (0.9% NaCl) and centrifuged at 12,000 × g for 10 minutes at 4 °C. The resulting supernatant was collected for analysis.For HD11 cells, the culture medium was collected and centrifuged at 1000 × g for 10 minutes to remove any cellular debris.The supernatants from both sources were then incubated with the reaction mixture. The absorbance was measured at 440 nm using a microplate reader. The LDH activity was calculated based on the provided standard curve.

Enzyme-linked immunosorbent assays (ELISA)

The concentrations of the pro-inflammatory cytokines interleukin-18 (IL-18), interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) in the supernatant of HD11 cell cultures and in the homogenates of chicken spleen tissues were measured using chicken-specific commercial ELISA kits for IL-18 (YJ33340), IL-1β (YJ33339), IL-6 (YJ33335), and TNF-α (YJ33205), all from Shanghai Yuanju Biotechnology Co., Ltd. (Shanghai, China). Briefly, spleen tissues were homogenized in cold phosphate-buffered saline (PBS) and centrifuged at 12,000 × g for 10 minutes at 4 °C to collect the supernatant. The cell culture medium from HD11 cells was collected and centrifuged at 1000 × g for 10 minutes to remove cellular debris. For each target cytokine, the assay was performed independently according to the respective manufacturer’s instructions. The supernatants or standards were added to the antibody-precoated wells and incubated. After a series of washing and incubation steps with corresponding biotinylated detection antibodies and HRP-conjugated streptavidin, the reaction was developed using a tetramethylbenzidine (TMB) substrate. The reaction was terminated with the stop solution, and the absorbance was measured at 450 nm using a microplate reader. The concentration of each cytokine was calculated based on its respective standard curve.

Cell treatment and viability assays

HD11 cells were maintained in high-glucose DMEM (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (Clark, Australia) at 37 °C in a 5% CO₂ atmosphere and subcultured at 80–90% confluence. To induce cold stress, cells were treated with 50 μM galangin for 1 hour, followed by incubation at 4°C for 12 hours. The viability of HD11 cells was assessed using the Cell Counting Kit-8 (CCK-8) assay. Briefly, cells were seeded in 96-well plates at a density of 1 × 10^4 cells per well and allowed to adhere for 12 hours. Subsequently, the cells were treated with various concentrations of the test compounds for 24 hours. Following treatment, 10% CCK-8 reagent (Biosharp, China) was added to each well, and the plates were incubated at 37 °C for 1 hour. The absorbance of each well was measured at a wavelength of 450 nm using a microplate reader. Cell viability was calculated as a percentage relative to the untreated control group.

Establishment of a stable NLRP3-overexpressing HD11 cell line

To generate a stable NLRP3-overexpressing cell model, the full-length chicken NLRP3 gene was cloned into the PLO301-pLV-ZsGreen(2A)Puro-CMV lentiviral vector. HEK293T cells were then employed for lentivirus packaging; specifically, the cells were co-transfected with the constructed NLRP3 overexpression plasmid and the necessary packaging plasmids (psPAX2 and pMD2.G) using Lipo8000 transfection reagent, with all plasmid concentrations being precisely quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). The virus-containing supernatant was collected 48 and 72 hours post-transfection, pooled, and filtered. For infection, HD11 cells were incubated with the lentiviral supernatant supplemented with Polybrene to enhance infection efficiency. Following a 12-hour infection period, the medium was replaced, and selection pressure was applied using puromycin to selectively eliminate non-transduced cells. After 7-10 days of selection, the surviving puromycin-resistant cell population, which exhibited robust ZsGreen fluorescence, was expanded as a stable pool for subsequent functional validation of NLRP3 overexpression.

Statistical analysis

All data are presented as the mean ± standard error of the mean (SEM) from at least three independent experiments. Statistical analyses were performed using GraphPad Prism software (version 9.0). The significance of differences between two groups was assessed by Student's t-test. Comparisons among multiple groups were analyzed by one-way analysis of variance (ANOVA) or two-way ANOVA, followed by Tukey’s post hoc test for multiple comparisons. A probability value of P < 0.05 was considered statistically significant. Detailed statistical tests used for each experiment are specified in the corresponding figure legends.

Results

Effects of cold stress on spleen histopathology and oxidative stress in Danzhou chickens

Chickens were allocated into a control group (CON, 30 ± 1°C) and a cold stress group (CS, 10 ± 1°C) for 48 hours. All chickens received the same diet with ad libitum access to feed and water (Fig. 1A). After treatment, serum and spleen tissues were collected for analysis. Histopathological examination of spleen tissues by HE staining revealed distinct alterations. The CON group exhibited a normal architecture with intermixed red and white pulp. In contrast, the CS group showed a reduction in lymphoid nodules and lymphocytes, along with the presence of necrotic cellular debris (characterized by nuclear pyknosis and fragmentation, indicated by red arrows) and proliferated macrophages (blue arrows) (Fig. 1B). We next evaluated the impact of cold stress on the splenic oxidative status. Cold stress induced a state of pronounced oxidative damage, marked by a significant increase in the lipid peroxidation product MDA (Fig. 1C). This was accompanied by a coordinated suppression of the antioxidant defense system, including reduced activities of total superoxide dismutase (T-SOD) and GSH-Px, and a decline in T-AOC (Fig. 1D-F). Furthermore, glutathione redox homeostasis was substantially disrupted, characterized by decreased levels of reduced GSH and T-GSH, alongside elevated levels of GSSG and increased GR activity (Fig. 1G-J). In summary, these results demonstrate that acute cold stress induces significant histopathological injury and disrupts the antioxidant defense system, shifting the intracellular redox balance toward a pro-oxidant state in the chicken spleen.

Fig. 1.

Histological changes and oxidative indicators in chicken spleen after cold stress. (A) Schematic diagram of the experimental design and sample collection. (B) Histopathological examination of spleen tissues via HE staining. The CON group shows normal architecture with intermixed red and white pulp. The CS group exhibits reduced lymphoid nodules and lymphocytes, along with presence of necrotic cell debris (red arrows) and proliferated macrophages (blue arrows). (C) MDA content in spleen tissue. (D–F) Activities of T-SOD and GSH-Px, and T-AOC level in spleen tissue. (G–J) Levels of GSH, GSSG, T-GSH and GR activity in spleen tissue. Data are expressed as mean ± SEM and analyzed by t-test. *p < 0.05, **p < 0.01, ***p < 0.001 vs. CON group.

Effects of cold stress on the transcriptome of Danzhou chicken spleen

To systematically elucidate the molecular mechanisms underlying cold stress-induced spleen injury, we performed transcriptome sequencing on spleen tissues from the CON and CS groups. The global transcriptomic landscape was profoundly altered by cold stress. Principal component analysis (PCA) clearly separated the CON and CS samples, indicating distinct gene expression profiles between the two conditions (Fig. 2A). Differential gene expression analysis identified a total of 1,468 significantly differentially expressed genes (DEGs), comprising 583 up-regulated and 885 down-regulated genes in the CS group compared to the CON group (Fig. 2B). Hierarchical clustering analysis of these DEGs further confirmed the clear separation between groups with good intra-group reproducibility (Fig. 2C), demonstrating stable and significant reprogramming of the splenic transcriptome induced by cold stress. To decipher the biological functions and pathways affected, we performed Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis on the DEGs. The most significantly enriched pathways were closely associated with immune-inflammatory responses and tissue remodeling, including ECM-receptor interaction, Cell adhesion molecules, Phagosome, and Cytokine-cytokine receptor interaction (Fig. 2D). This suggests that cold stress triggers robust innate immune activation and may disrupt tissue integrity in the spleen. To gain deeper insight into coordinated biological processes beyond predefined gene sets, we conducted Gene Set Enrichment Analysis (GSEA). Notably, GSEA revealed a significant negative enrichment for the “Cellular Senescence” gene set (Normalized Enrichment Score, NES = −2.341, p = 0.001) (Fig. 2E), indicating a widespread down-regulation of genes associated with this pathway. Concurrently, the “Phagosome” pathway was significantly and positively enriched (NES = 2.153) (Fig. 2F), highlighting the activation of this critical innate immune function. In summary, transcriptomic profiling demonstrates that cold stress induces extensive gene expression reprogramming in the chicken spleen, characterized by the activation of immune and inflammatory pathways (notably phagocytosis), suppression of cellular senescence signals, and alterations in extracellular matrix and adhesion pathways.

Fig. 2.

Cold stress reprograms the splenic transcriptome in chickens.

(A) Principal component analysis (PCA) showing clear separation between CON and CS samples along PC1 (37.6%) and PC2 (14.1%). (B) Volcano plot of differentially expressed genes (DEGs). Red: 583 up-regulated; blue: 885 down-regulated (|log₂FC| > 1, adj. P < 0.05); gray: non-significant. (C) Hierarchical clustering heatmap of 1,468 DEGs. Red indicates high expression, blue low expression. (D) KEGG pathway enrichment analysis of DEGs. Dot size represents gene count; color indicates adjusted P-value. The most significantly enriched pathways included ECM-receptor interaction, cell adhesion molecules, phagosome, and cytokine-cytokine receptor interaction. (E) GSEA for “Cellular Senescence” showing significant negative enrichment (NES = –2.341, P = 0.001). (F) GSEA for “Phagosome” showing significant positive enrichment (NES = 2.153).

Cold stress induces inflammatory responses in Danzhou chicken spleen via alterations in gene and protein expression

To investigate the impact of cold stress on the inflammatory response, we analyzed key inflammatory mediators in chicken spleen tissues. Cold stress significantly upregulated the expression of multiple inflammatory cytokines and signaling components. At the mRNA level (Fig. 3A–F), the expression of IL-1β, TNF-α, TLR4, COX2, Nrf2, and IL-18 was significantly elevated compared to the control group. Western blot analysis further confirmed the upregulation at the protein level (Fig. 3G–L), showing significantly increased levels of Nrf2, IL-18, and IL-1β. Furthermore, the increased ratio of phosphorylated P65 to total P65 (p-P65/P65) indicated the activation of the NF-κB pathway. ELISA measurements of secreted cytokines (Fig. 3M–O) corroborated these findings, demonstrating significantly higher levels of IL-1β, TNF-α, and IL-18 in the cold-stressed group. In summary, these data demonstrate that cold stress activates inflammatory responses in the chicken spleen, implicating the TLR4/NF-κB and Nrf2 signaling pathways in this process.

Fig. 3.

Inflammatory responses induced by cold stress in chicken spleen tissues.(A-F) The relative mRNA expression levels of IL-1β, TNF-α, TLR4, COX2, Nrf2, and IL-18 in spleen tissues. All were elevated in the CS group compared to the CON group.(G-L) Western blot analysis and quantification of inflammation-related proteins (Nrf2, P65, P-P65, IL-18, and IL-1β) in spleen tissues.(M-O) Concentrations of IL-1β, TNF-α, and IL-18 in spleen tissues as determined by ELISA. Data are expressed as mean ± SEM and analyzed by t-test. *p < 0.05, **p < 0.01, ***p < 0.001 vs. CON group.

Cold stress induces pyroptosis in Danzhou chicken spleen

To investigate whether cold stress mediates spleen injury through the pyroptosis pathway, we examined key indicators of the NLRP3/caspase-1/GSDMD axis. Immunofluorescence staining revealed that compared with the control group, the fluorescence intensity of NLRP3 protein was significantly stronger in the spleen tissues of the CS group (Fig. 4A), indicating that cold stress induced the expression and aggregation of the NLRP3 inflammasome in spleen cells. Quantification of the immunofluorescence intensity confirmed a significant increase in NLRP3 expression in the cold stress group (Fig. 4B). Measurement of cellular injury markers showed that the release of LDH was significantly higher in the spleen tissues of the CS group than in the CON group (Fig. 4C), suggesting that cold stress caused cell membrane damage and cytotoxicity in the spleen. Western blot analysis of key pyroptosis pathway proteins (Fig. 4D–J) revealed an overall upregulation in the CS group, specifically evidenced by significantly increased protein levels of NLRP3, ASC, GSDMD, and its cleaved form GSDMD-N. Concurrently, caspase-1 activation was enhanced, as evidenced by a decrease in its pro-form (Pro-caspase-1) and an increase in its cleaved active form (Cleaved caspase-1). These results indicate that cold stress activates the NLRP3 inflammasome, thereby promoting caspase-1 cleavage and activation, which ultimately leads to GSDMD-mediated pyroptosis. This mechanism may be one of the key pathways through which cold stress induces spleen inflammation and injury.

Fig. 4.

Cold stress induces pyroptosis in chicken spleen via the NLRP3/caspase-1/GSDMD axis. (A) Immunofluorescence staining of NLRP3 protein in spleen tissues. The fluorescence intensity of NLRP3 was notably stronger in the CS group compared to the CON group. (B) Quantification of NLRP3 immunofluorescence intensity shown in (A). (C) LDH content in spleen tissues. (D-J) Western blot analysis and quantification of pyroptosis-related proteins (NLRP3, Pro-caspase-1, Cleaved caspase-1, GSDMD, GSDMD-N, and ASC) in spleen tissues. Data are expressed as mean ± SEM and analyzed by t-test. *p < 0.05, **p < 0.01, ***p < 0.001 vs. CON group.

Galangin alleviates cold stress-induced splenic injury in Danzhou chickens through inhibition of oxidative stress, inflammation, and pyroptosis

To investigate whether galangin pretreatment confers preventive protection against cold stress-induced splenic injury, chickens were prophylactically administered different doses of galangin (12.5, 25, and 50 mg/kg) for three consecutive days prior to cold exposure (10 ± 1°C for 48 h). Compared with the CS group, galangin pretreatment significantly reduced the content of MDA in spleen tissues at all three doses (Fig. 5A), while significantly elevating T-AOC, with the 25 mg/kg and 50 mg/kg doses showing the most pronounced effects (Fig. 5B). ELISA analysis revealed that galangin significantly suppressed CS-induced production of the pro-inflammatory cytokines IL-1β and IL-18 (Fig. 5C and D). Furthermore, galangin treatment markedly reduced LDH activity in the spleen, indicating attenuated cell membrane damage, with the 50 mg/kg dose exhibiting the strongest protective effect (Fig. 5E). Based on these results, the 50 mg/kg dose was selected for subsequent mechanistic studies. Histopathological examination using H&E staining showed that cold stress caused marked structural damage, including reduced lymphoid nodules, necrotic cellular debris, mild sinus dilation, and brown pigment deposition, all of which were significantly ameliorated by galangin pretreatment (Fig. 5F). Western blot analysis revealed that galangin significantly reversed CS-induced upregulation of Nrf2 and phosphorylation of NF-κB p65 (Fig. 5G-J). Moreover, cold stress markedly activated the NLRP3/caspase-1/GSDMD pyroptosis pathway, as evidenced by increased protein expression of NLRP3, ASC, GSDMD, GSDMD-N, and cleaved caspase-1. Galangin intervention effectively suppressed the activation of this pathway, significantly downregulating the expression of NLRP3, ASC, GSDMD, GSDMD-N, and cleaved caspase-1, while restoring pro-caspase-1 levels (Fig. 5K-Q). Collectively, these results demonstrate that galangin protects against cold stress-induced splenic injury by enhancing antioxidant capacity, suppressing inflammation, and inhibiting the NLRP3-mediated pyroptosis pathway.

Fig. 5.

Galangin alleviates cold stress-induced splenic injury in chickens. (A-E) Effects of galangin (12.5, 25, and 50 mg/kg) on (A) MDA content, (B) T-AOC level, (C) IL-1β content, (D) IL-18 content, and (E) LDH activity in the spleen of cold-stressed chickens. (F) Representative H&E staining images of chicken spleen sections from control, CS, and CS+Gal (50 mg/kg) groups ( × 200, scale bar = 50 μm). Orange arrows indicate necrotic cells; yellow arrows indicate brown pigment deposition. (G-J) Western blot analysis and quantification of Nrf2, p-P65, and P65 protein expression in chicken spleen tissues. (K-Q) Western blot analysis and quantification of NLRP3, ASC, GSDMD, GSDMD-N, pro-caspase-1, and cleaved caspase-1 protein expression in chicken spleen tissues. Data are expressed as mean ± SEM and analyzed by one-way ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001 vs. CS group.

Galangin alleviates cold stress-induced oxidative damage in chicken macrophage (HD11) cells

The protective effect of galangin against cold stress was investigated using the chicken macrophage cell line HD11. Initial assessment confirmed that concentrations of 25–200 μM had no significant cytotoxicity under normal conditions (Fig. 6A). In the CS model, galangin pre-treatment ameliorated the CS-induced loss of cell viability in a concentration-dependent manner, with 50 μM showing the most potent effect (Fig. 6B); this concentration was therefore selected for all subsequent experiments. Microscopic observation revealed that CS caused marked morphological deterioration, including reduced cell density, rounding, and detachment. This damage was largely prevented by galangin pre-treatment, while the flavonoid alone had no adverse effect (Fig. 6C). We systematically evaluated key indicators of intracellular redox status (Fig. 6D–K). CS triggered a pronounced oxidative imbalance, characterized by a significant increase in MDA, alongside decreased activities of T-SOD and GSH-Px, reduced T-AOC, and diminished levels of GSH and T-GSH. Concurrently, GSSG levels and GR activity were elevated. Notably, galangin pre-treatment effectively reversed all these CS-induced alterations: it lowered MDA content; enhanced T-SOD and GSH-Px activities and T-AOC; restored GSH and T-GSH levels; and reduced both GSSG content and GR activity. Treatment of normal cells with galangin alone had no significant effect on these parameters. In summary, our in vitro results demonstrate that galangin alleviates cold stress-induced oxidative damage in HD11 macrophages by enhancing the cellular antioxidant defense system and inhibiting lipid peroxidation.

Fig. 6.

Galangin mitigates cold stress-induced oxidative damage in HD11 cells. (A) Effect of different concentrations of galangin (0, 25, 50, 100, 200 μM) on the viability of HD11 cells assessed by CCK-8 assay. (B) Determination of the optimal concentration of galangin to counteract cold stress-induced loss of cell viability. (C) Representative microscopic images showing the morphological changes of HD11 cells in the Control, Control+Gal, Cold stress, and Cold stress+Gal groups. (D–K) Levels of oxidative stress and antioxidant markers, including MDA, T-SOD, GSH-Px, T-AOC, GSH, GSSG, T-GSH, and GR activity. Data are expressed as mean ± SEM and analyzed by one-way ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001 vs. CON group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs. CS group.

Galangin alleviates cold stress-induced inflammation in HD11 cells

We next assessed whether galangin modulates the inflammatory response in HD11 cells. Cold stress significantly promoted the secretion of the pro-inflammatory cytokines IL-1β, TNF-α, IL-6, and IL-18, an effect that was effectively suppressed by galangin pre-treatment (Fig. 7A-D). Consistent with these findings, Western blot analysis revealed that CS upregulated the intracellular protein levels of Nrf2, phosphorylated P65 (P-P65), IL-18, and IL-1β, while galangin pre-treatment significantly reversed these increases (Fig. 7E-J). At the transcriptional level, CS induced a significant upregulation in the mRNA expression of the pro-inflammatory genes IL-18, Nrf2, IL-6, IFN-γ, and NF-κB, and suppressed the anti-inflammatory factor IL-10. Galangin pre-treatment effectively downregulated this CS-induced pro-inflammatory gene expression profile and concurrently promoted IL-10 transcription (Fig. 7K-P). Collectively, these data demonstrate that galangin alleviates cold stress-induced inflammation in HD11 macrophages by suppressing the expression and secretion of key pro-inflammatory mediators and enhancing anti-inflammatory signaling.

Fig. 7.

Galangin mitigates CS-induced inflammatory responses in HD11 cells. (A–D) Levels of inflammatory cytokines (IL-1β, TNF-α, IL-6, IL-18) in cell supernatant measured by ELISA. (E–I) Western blot analysis and quantification of inflammation-related proteins (Nrf2, P65, P-P65, IL-18, IL-1β). (J) Representative western blot images. (K–P) Relative mRNA expression levels of inflammation-related genes (IL-18, Nrf2, IL-10, IFN-γ, IL-6, NF-κB). Data are expressed as mean ± SEM and analyzed by one-way ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001 vs. CON group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs. CS group.

Galangin alleviates cold stress-induced HD11 cells injury by suppressing the NLRP3-mediated pyroptosis pathway

We next investigated whether galangin protects HD11 cells by regulating the NLRP3-mediated pyroptosis pathway. Cold stress significantly upregulated the protein levels of NLRP3, ASC, GSDMD, and its cleaved form GSDMD-N, while promoting caspase-1 activation (decreased pro-caspase-1, increased cleaved caspase-1) (Fig. 8A-G). Pre-treatment with galangin effectively reversed these changes. Correspondingly, galangin significantly reduced the CS-induced release of LDH (Fig. 8H), indicating attenuated cell membrane damage.

Fig. 8.

Galangin mitigates CS-induced injury in HD11 cells by targeting the NLRP3-mediated pyroptosis pathway. (A–G) Western blot analysis of pyroptosis-related proteins (NLRP3, Pro-caspase-1, Cleaved caspase-1, GSDMD, GSDMD-N, ASC) and representative images in HD11 cells. (H) LDH release in cell culture supernatant. (I–J) Validation of NLRP3 overexpression: Western blot analysis and quantification in NC+CS+Gal vs. OE-NLRP3+CS+Gal groups. (K–R) Western blot analysis and quantification of pyroptosis-related proteins (NLRP3, Pro-caspase-1, Cleaved caspase-1, GSDMD, GSDMD-N, ASC) with representative images and quantification in NC+CS+Gal vs. OE-NLRP3+CS+Gal groups. (S–T) Levels of inflammatory cytokines (IL-1β, IL-18) in cell supernatant measured by ELISA. (U–Z) Relative mRNA expression levels of inflammation-related genes (IL-18, TLR4, IL-6, IL-10, Nrf2, NF-κB). Data are expressed as mean ± SEM and analyzed by one-way ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001; #p < 0.05, ##p < 0.01, ###p < 0.001. In panels B–H, * vs. CON group, # vs. CS group. In panel J, * vs. NC group. In panels L–Z, * vs. NC+CS+Gal group.

To determine the necessity of NLRP3 in this protection, we overexpressed NLRP3 in HD11 cells (OE-NLRP3) (Fig. 8I, J). Under CS and galangin co-treatment, NLRP3 overexpression reversed the inhibitory effect of galangin on the pyroptosis pathway, leading to a re-upregulation of NLRP3, ASC, GSDMD, GSDMD-N, and cleaved caspase-1 compared to the control vector group (NC) (Fig. 8K-R). This molecular reversal was functionally corroborated by a significant increase in the secretion of IL-1β and IL-18 (Fig. 8S, T). At the transcriptional level, NLRP3 overexpression similarly counteracted galangin's effects, causing a rebound in the mRNA expression of IL-18, TLR4, IL-6, Nrf2, and NF-κB, while suppressing IL-10 expression (Fig. 8U-Z). Collectively, these data demonstrate that galangin alleviates CS-induced injury in HD11 cells by specifically suppressing the NLRP3 inflammasome and its downstream pyroptosis pathway.

Molecular docking predicts the binding of galangin to NLRP3

Molecular docking was performed to explore the structural interaction between galangin and the NLRP3 protein. Galangin docked into the active pocket of NLRP3 with high affinity, exhibiting a binding energy of −8.0 kcal/mol (Fig. 9). Analysis of the binding mode revealed that galangin forms a stable network of interactions with key residues. These include a carbon-hydrogen bond with GLY178, a pi-cation interaction with HIS469, as well as pi-sigma, pi-sulfur, and pi-pi T-shaped stacking interactions with MET181, TRP362, and HIS469. Hydrophobic contacts, such as pi-alkyl interactions with MET181 and ALA112, further stabilize the complex. This multifaceted interaction profile suggests a strong and specific binding mode. The docking results provide a structural basis for galangin’s inhibitory effect on the NLRP3 inflammasome, supporting its role as a direct molecular target.

Fig. 9.

Molecular docking analysis of galangin with NLRP3. The predicted binding mode of galangin within the NLRP3 active site is shown, including (from left to right) an overview of the complex, a close-up view of the binding pocket, and a 2D interaction diagram. The calculated binding energy is −8.0 kcal/mol.

Discussion

Poultry production in regions with fluctuating climates faces significant economic losses due to cold stress, which compromises growth, welfare, and health (Lesiów and Xiong, 2024; Li et al., 2025a, 2025b). While the general detrimental effects are recognized, the specific mechanisms impairing central immune organs like the spleen remain poorly defined. Our study demonstrates that acute cold exposure induces splenic injury in chickens through an integrated mechanism of oxidative stress, inflammatory activation, and, pivotally, NLRP3 inflammasome-mediated pyroptosis. We further identify the natural flavonoid galangin as an effective prophylactic agent that mitigates this damage primarily by inhibiting the NLRP3 pathway. Crucially, our study design positions galangin as a preventive strategy, as it was administered prior to cold exposure, rather than as a post-injury treatment. Histopathological and biochemical analyses confirmed direct tissue injury and a profound disruption of redox homeostasis. The marked increase in lipid peroxidation (MDA), coupled with the suppression of key antioxidant enzymes (T-SOD, GSH-Px) and glutathione system components, indicates that cold stress overwhelms the spleen's endogenous defenses. This aligns with the established role of oxidative stress as a primary mediator of cold-induced injury in other tissues, such as the myocardium and intestine (Bi et al., 2024; Wei et al., 2024).

Transcriptomic profiling revealed widespread gene expression reprogramming in the spleen, with functional enrichment strongly pointing to the activation of innate immune and pro-inflammatory pathways. Building on this, our data specifically implicate the NLRP3 inflammasome-pyroptosis axis as a central executioner of damage in this key immune organ. We validated the engagement of the classical TLR4/NF-κB inflammatory pathway, a critical signaling mechanism known to mediate various stress-induced inflammatory responses (Lv et al., 2024), including cold stress in the intestine (Bi et al., 2024). More importantly, we provide novel evidence that cold stress triggers the assembly of the NLRP3 inflammasome in the avian spleen, leading to caspase-1 activation, GSDMD cleavage, and pyroptotic cell death—a conserved pathway for executing lytic, pro-inflammatory cell death (Fu and Wu, 2023; Huang et al., 2021; Swanson et al., 2019). This mechanism directly explains the observed LDH release and likely fuels a vicious cycle of inflammation, positioning NLRP3 activation as a critical link.

Given its documented anti-inflammatory and antioxidant properties(Khawaja et al., 2024; Qian and Suo, 2023), we investigated galangin as a targeted countermeasure. Galangin is known to modulate key signaling pathways, such as Nrf2/Gpx4 and GSTP1/JNK (Shu et al., 2024; Yang et al., 2023). In our study, galangin pre-treatment in HD11 macrophages effectively counteracted the cold stress-induced pathological triad: it restored antioxidant function, suppressed pro-inflammatory cytokine release, and, most importantly, inhibited the entire NLRP3/caspase-1/GSDMD pyroptosis axis. The pivotal role of NLRP3 as the specific target was unequivocally established by a genetic rescue experiment, in which NLRP3 overexpression reversed/counteracted the suppressive effects of galangin on both pyroptosis and inflammation. This finding aligns with the broader recognition that flavonoids can ameliorate inflammatory conditions by targeting the NLRP3 inflammasome pathway and, to our knowledge, our study is the first to identify NLRP3 as a direct functional target of galangin in the context of cold stress-induced inflammation. To provide a structural basis for this interaction, molecular docking simulations predicted a stable binding pose for galangin within a potential active pocket of NLRP3, involving key residues such as GLY178 and HIS469 (Wang et al., 2024). While subsequent functional assays are required for confirmation, this in silicoanalysis offers a plausible model for direct inhibition and aligns with the growing body of research identifying natural compounds, including other flavonoids and quinones, as high-affinity NLRP3 inhibitors (Chen et al., 2020; Fang et al., 2023).

This study has several limitations. First, the experimental design evaluated galangin exclusively as a pretreatment; therefore, its effects should be interpreted as preventive rather than therapeutic. Future studies are needed to determine whether galangin can reverse established cold stress-induced injury when administered after exposure. The precise upstream sensor that activates NLRP3 in response to cold in avian cells remains unidentified. Furthermore, the in vivo efficacy and optimal dosage of galangin as a practical dietary supplement require validation in long-term feeding trials under field-relevant conditions. Additionally, reciprocal NLRP3 loss-of-function experiments were not performed and will be addressed in future work. Meanwhile, we did not include a galangin-only control group under normothermic conditions. Although our in vitro data and published literature indicate no adverse effects of galangin alone, future long-term feeding trials with a full set of controls (including a galangin-only group) are warranted to rigorously confirm its safety and efficacy in poultry.

In conclusion, our work establishes NLRP3-mediated pyroptosis as a key pathological mechanism in cold stress-induced spleen injury in chickens. We further identify galangin as a potent inhibitor of this pathway, demonstrating its protective effects in vivo and validating NLRP3 as a direct functional target through in vitro overexpression experiments. Galangin functions through integrated antioxidant support and specific suppression of the NLRP3 inflammasome (Fig. 10). These insights advance the mechanistic understanding of environmental stress pathophysiology in poultry and highlight galangin as a promising, natural candidate for developing nutritional strategies to enhance resilience in the poultry industry.

Fig. 10.

Proposed mechanism of galangin alleviates cold stress-induced spleen injury.

Data availability

The authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials.

CRediT authorship contribution statement

Xueqi Tian: Writing – original draft, Investigation, Conceptualization. Changyuan Dai: Data curation. Weiqin Fan: Formal analysis. Chang Cheng: Investigation. Wenjie Lu: Visualization. Hui Peng: Writing – review & editing, Validation, Resources. Diqi Yang: Writing – review & editing, Supervision, Project administration.

Disclosures

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Diqi Yang and Hui Peng reports was provided by School of Tropical Agriculture and Forestry, Hainan University. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.