Parasarocladium yichunense, a new species of Hypocreales in China

Abstract

This study describes Parasarocladium yichunense, a new species of Hypocreales isolated from leaf cradles of Reynoutria japonica, which were constructed by the weevil Euops chinensis for oviposition and fungal cultivation. Its taxonomic position within the genus Parasarocladium was determined using an integrative approach combining morphological, cultural, and multi-locus analyses based on the ITS, LSU, ACT, tef1, and tub2 regions. Phylogenetically, P. yichunense forms a well-supported, distinct monophyletic clade sister to the clades comprising P. debruynii and P. dipikae. Parasarocladium yichunense differs from its phylogenetically close relative, P. debruynii, in exhibiting slower growth on culture media, longer conidiophores (up to 120 μm), longer phialidic conidiogenous cells (2.3-40 μm), and larger conidia [3-11.8(-13.4) × 1.5-4.6 μm]. This discovery expands the known diversity of Parasarocladium and contributes to the growing documentation of fungal symbionts in leaf-rolling weevil mutualisms.

1. Introduction

Hypocreales, an order within the phylum Ascomycota and class Sordariomycetes, exhibits a global distribution with remarkable species diversity across tropical, subtropical, and temperate regions (Rossman et al., 1999). These fungi occupy diverse ecological niches including terrestrial, freshwater, and marine environments, where they colonize substrates such as soil, water, air, plants, insects, mosses, lichens, and other fungi (Hyde et al., 2020; Rossman et al., 1999).

Within this order, Sarocladiaceae was first introduced by Crous et al. (2018) to accommodate the distinctive lineage of Parasarocladium and Sarocladium. Parasarocladium is distinguished from Sarocladium by its branched tufts of up to four conidiophores and the characteristic of CAACTTT motif at 5' end of the 5.8S rDNA (Summerbell et al., 2018). Currently, the genus Parasarocladium comprises 15 accepted species, as documented in the Index Fungorum and MycoBank databases (Table 1), predominantly inhabiting soil, marine environments, and leaf surfaces. In this study, two fungal strains exhibiting morphological features consistent with Parasarocladium were isolated and purified from leaf cradles of Reynoutria japonica Houtt. These cradles were constructed by Euops chinensis Voss for internal oviposition and fungal inoculation. Penicillium herquei Bainier & Sartory has been reported as the casual fungus of R. japonica leaf cradles (Li et al., 2012). Here, we characterized a new Parasarocladium species using integrated morphological, cultural, and multi-locus analyses.

Table 1. Fungal taxa, voucher specimen numbers, isolation source and GenBank accession numbers for ITS, LSU, actin (ACT), and translation elongation factor 1-alpha (tef1) sequences used for phylogenetic analyses. “-” means information not available from GenBank database. Sequences newly generated in the present study were shown in bold.

Taxon	Voucher	ITS	LSU	ACT	tef1	Isolation source	References
Parasarocladium aestuarinum	CMG30	MK986713	-	MK984313	-	Saline water	1
P. alavariense	CMG 32	MK986715	-	MK984315	-	Rhodophyta	1
P. breve	CBS 150.62	NR_189477	NG_056979	-	OQ471110	Soil	2
P. chondroidum	CBS 652.93	NR_189478	NG_242062	-	OQ471111	Gramineae	2
P. debruynii	CBS 144942	NR_163316	NG_066301	MK069413	-	Soil	3
P. dipikae	BRIP 68235	OM417251	OM333565	-	-	Sporobolus natalensis	4
P. funiculosum	CBS 141.62	OQ429786	OQ055682	-	OQ471307	Soil	2
P. fusiforme	CMG 36	MK986719	-	MK984319	-	Ulva sp.	1
P. gamsii	CBS 726.71	NR_159615	NG_056985	-	OQ471112	Soil	5
P. mabikii	SFC20240607-M025	PQ355570	PQ355589	PQ355463	PQ355493	Mud flat	6
P. multimorphologicum	SFC20240607-M022	PQ355573	PQ355592	PQ355466	PQ355496	Seaweed leaf	6
P. radiatum	CBS 142.62	NR_161112	NG_070520	-	OQ471308	Soil	7
P. sinense	ZY 22.071	OR680550	OR680618	-	OR865900	Soil	8
P. tasmanniae	CBS 146807	NR_171987	NG_074483	MW173094	-	Tasmannia insipida	8, 9
P. wereldwijsianum	CBS 147226	NR_173018	MW88383	MW890030	MW890113	Soil	10
P. yichunense	CGMCC 3.29486	PV745127	PV745129	PV751030	PV932120/PV941791	Leaf cradle of Reynoutria japonica	This study
P. yichunense	CGMCC 3.29487	PV745128	PV745130	PV751031	PV932121/PV941792	Leaf cradle of R. japonica	This study
Sarocladium zeae	CBS 800.69	NR_130685	NG_067385	HG965000	OQ471189	Zea mays	7

References: 1: Gonçalves et al. (2020), 2: Hou et al. (2023), 3: Crous et al. (2018), 4: Steinrucken et al. (2022), 5: Summerbell et al. (2011), 6: Lee et al. (2025), 7: Vu et al. (2019), 8: Zhang et al. (2024), 9: Crous et al. (2020), 10: Crous et al. (2021).

2. Materials and Methods

2.1. Fungal collection

Leaf cradles of R. japonica were collected in Jiangxi Province, China, in May 2023. For fungal isolation, middle-layer leaf material from these cradles was homogenized in 1 mL of sterile deionized water using a tissue grinder. The homogenate was serially diluted (10-fold) in sterile distilled water and plated onto potato dextrose agar (PDA) amended with streptomycin (50 μg/mL). Plates were incubated at 25 °C and monitored daily until the emergence of fungal colonies. Emerging mycelia were subcultured onto fresh PDA to obtain pure isolates. Two novel Parasarocladium-like strains (designated HNKU-501 and HNKU-502) were isolated and deposited in China General Microbiological Culture Collection Center (CGMCC) with accession numbers CGMCC 3.29486 and CGMCC 3.29487, respectively.

2.2. Culture characteristics

Fungal inocula consisted of both mycelial blocks (1-2 mm diam) and a 3 μL spore suspension (2 × 10⁶ conidia/mL), and these were inoculated onto PDA, malt extract agar (MEA; 4 g peptone, 3 g yeast extract powder, 10 g glucose, 10 g malt powder, 13 g agar per liter deionized water), and oatmeal agar (OA; 30 g oatmeal, 20 g agar per liter deionized water). Cultures were incubated at 25 °C for 7 days, after which colony characteristics including colony diameters and pigmentation, were recorded.

2.3. Morphological characterization

Morphological features of the Parasarocladium isolates were characterized by examining reproductive structures formed after 7 d of incubation on PDA at 25 °C (Crous et al., 2018; Nguyen & Lee, 2024). Mycelial fragments from the cultures were excised and mounted in sterile distilled water for microscopic examination. Their morphologies were observed using a ZEISS Axioscope 5 light microscope equipped with phase contrast at 100× magnification under oil immersion.

2.4. DNA extraction and sequencing

Genomic DNA was extracted from mycelia using the chelex-100 method (Hirata & Takamatsu, 1996; Walsh et al., 1991). The DNA template amplification was carried out by polymerase chain reaction (PCR) using primer pairs ITS5/ITS4 for the internal transcribed spacer (ITS) region, and LSU1/LSU2 for the large subunit (LSU) (Scholin et al., 2004; White et al., 1990). Besides, new primers Act-F1 and Act-R1 (Table 2) for actin (ACT) were designed to avoid degenerate bases present in universal primers (Voigt & Wöstemeyer, 2000). The ACT primers were developed based on conserved nucleotide regions identified from twenty sequences that pertain to different species of Acremonium (HE608625, HE608622, HE608630, HE608629, HE608628, HE608624, HE608623, HE608621, HE608620, AF056976), Parasarocladium (MK069413, MK984319, MK984315, MK984313, PQ355467, PQ355465, MW890030), and Sarocladium (HE608631, MF987666, MF987665) retrieved from GenBank. To enable a more robust comparison within Parasarocladium, novel primer pairs for translation elongation factor 1 (tef1) and beta-tubulin (tub2) genes were developed for the fungal stains in this study. The tef1 primers tef-F3 and tef-R2 were designed based on conserved regions of tef1 across Parasarocladium species outlined in Table 1. In addition, primers tef-F1 and tef-R1 were also designed based on the tef1 sequence (MK069410) of P. debruynii. For tub2, the P. debruynii sequence (MK069407) was used as a reference to design the new primers tub-F1 and tub-R1. All PCR amplifications followed the protocol described by Qiu et al. (2018), and the resulting amplicons were sequenced by Azenta (Tianjin, China) using the respective amplification primers. Primer sequences are listed in Table 2.

Table 2. Primer sequences used in this study.

Gene	Primer	Direction	Sequences of primer	References
ITS	ITS5	Forward	GGAAGTAAAAGTCGTAACAAGG	White et al. (1990)
	ITS4	Reverse	TCCTCCGCTTATTGATATGC
LSU	LSU1	Forward	ACCCGCTGAACTTAAGCATA	Scholin et al. (2004)
	LSU2	Reverse	CCTTGGTCCGTGTTTCAAGA
ACT	Act-F1	Forward	AGGCTCAGTCCAAGCGTGGTAT	In this study
	Act-R1	Reverse	GAGATCCACATCTGCTGGAAGGT
tef1	tef-F3	Forward	GTGAGTTCGAGGCTGGTATCTC
	tef-R2	Reverse	CACCAGACTTGATGAACTTGGG
	tef-F1	Forward	ATCGAGAAAAGCGAGAAGGTAAG
	tef-R1	Reverse	CGAACTTCCAGAGGGCAAT
tub2	tub-F1	Forward	ATGTAAGTTTGATACGCCTGCC
	tub-R1	Reverse	GGACTGACCGAAGACGAAGT

2.5. Molecular phylogeny

BLASTn searches against the GenBank nucleotide database identified closest matches for the newly generated ITS, LSU, ACT, tef1 and tub2 sequences, which were incorporated into sequence alignments. The ITS sequences generated in this study were aligned with corresponding sequences from all 15 currently recognized Parasarocladium species (Table 1) using MUSCLE within MEGA7 program (Kumar et al., 2016), followed by manual refinement. Due to incomparable tef1 sequence regions between P. debruynii (MK069410) and other Parasarocladium species shown in Table 1, P. debruynii was not included in the tef1 phylogenetic analysis. Given the limited availability of tub2 sequences across Parasarocladium spp., four distinct phylogenetic datasets (ITS, tef1, ITS+LSU, ITS+LSU+ACT) were analyzed sequentially to determine the taxonomic position of the Parasarocladium isolates. Sarocladium zeae (W. Gams & D.R. Sumner) Summerb. (Strain: CBS 800.69) was designated as the outgroup. Maximum-parsimony trees were constructed in MEGA7 using the Tree-Bisection-Regrafting (TBR) algorithm with 1,000 bootstrap replicates. New sequences generated in this study were deposited in GenBank, and the taxonomic novelty was registered in MycoBank. The corresponding sequence alignments were deposited in TreeBASE under the accession number 32225.

3. Results

3.1. Taxonomy

Parasarocladium yichunense P.L. Qiu, sp. nov.　Figs. 1, 2.

MycoBank no.: MB859475.

Fig. 1 - Morphology of Parasarocladium yichunense (CGMCC 3.29486). A-I: Conidiophores; J-L: Chlamydospores; M-O: Conidia. Bars: 10 μm.

Fig. 2 - Colonies of Parasarocladium yichunense on potato dextrose agar (PDA), malt extract agar (MEA), and oatmeal agar (OA) media for 7 d at 25 °C, using both fungal colony and spore suspension for inoculation.

Diagnosis: phylogenetically closely related to P. debruynii, but morphologically distinguished by longer conidiophores, elongated phialidic conidiogenous cells, and larger conidia, despite similar colony morphology on standard media.

Type: CHINA, Jiangxi Province, Yichun City, collected from leaf cradle of R. japonica constructed by E. chinensis, 15 May 2023, isolated by P. L. Qiu (Holotype, CGMCC 3.29486, preserved as metabolically inactive culture).

Available sequences from the holotype: PV745127 (ITS), PV745129 (LSU), PV751030 (ACT), PV932122 (tub2), PV932120 and PV941791 (tef1).

Etymology: The epithet yichunense refers to the collection locality.

Description: Sexual state not observed. Vegetative hyphae smooth, septate, hyaline. Conidiophores solitary, arising directly from mycelium, branched, erect, straight or irregularly curved, dichotomously branched, septate, hyaline, up to 120 μm long. Conidiogenous cells phialidic, arising laterally from hyphae, monopodially branched, subulate to cylindrical, near the septum, solitary or in pairs, 2.3-40 × 1.1-3.1 μm. Conidia unicellular, aseptate, polymorphic (oblong, ellipsoidal, bacilliform, fusiform, oval), hyaline, 3-11.8(-13.4) × 1.5-4.6 μm. Chlamydospores globose, solitary, 3.5-10.3(-13.1) μm diam, containing distinctive spherical inclusion.

Culture characteristics: Colonies on PDA inoculated with either a fungal plug or spore suspension reached average diameters of 17.5 and 18.5 mm, respectively, after 7 d at 25 °C. Colonies exhibited moist, slimy, effuse growth with flat topography. The obverse showed rosy central pigmentation transitioning to white margins; while the reverse appeared pale pinkish-white. On MEA, colony diameters averaged 19.4 mm (fungal plug) and 20.3 mm (spore suspension) under identical conditions. Notably, plug-inoculated colonies developed distinct pink centers and formed pronounced, radially oriented folds penetrating the agar. Conversely, spore suspension-inoculated colonies remained uniformly white and fold-free during incubation. On OA, colonies measured 23 mm (fungal plug) and 23.3 mm (spore suspension) after 7 d at 25 °C. Both obverse and reverse surfaces displayed uniform white coloration without discernible contrast.

Distribution: Currently known only from Yichun City, Jiangxi Province, China.

Additional specimen examined: CHINA, Jiangxi Province, Yichun City, from different leaf cradle of R. japonica constructed by E. chinensis, 15 May 2023, P. L. Qiu (CGMCC 3.29487; PV745128 for ITS, PV745130 for LSU, PV751031 for ACT, PV932123 for tub2, PV932121 and PV941792 for tef1).

3.2. Phylogenetic analyses

Phylogenetic reconstructions based on four datasets (ITS, tef1, ITS+LSU, ITS+LSU+ACT) yielded largely congruent tree topologies, differing only marginally in bootstrap support values (Fig. 3; Supplementary Figs. S1, S2, S3). The maximum-parsimony tree derived from the concatenated ITS+LSU+ACT dataset (Fig. 3) resolved P. yichunense as an independent, well-supported clade (bootstrap support: 94%) with P. debruynii (CBS 144942, ex-type) and P. dipikae (BRIP 68235, ex-type) as its sister taxa. These results, coupled with distinctive morphological features, confirm that strains CGMCC 3.29486 and CGMCC 3.29487 represent a new species within Parasarocladium.

Fig. 3 - A maximum parsimony tree constructed with concatenated sequences of ITS, LSU and actin (ACT), showing the phylogenetic position of Parasarocladium yichunense within Parasarocladium species. Sarocladium zeae CBS 800.69 was used as outgroup. The bootstrap support values greater than 70% are indicated above/below the branches.

4. Discussion

Parasarocladium yichunense shares close phylogenetic affinity with P. debruynii but exhibits obvious morphological and physiological distinctions. The former species is likely to exhibit slower growth on PDA (vs. 32 mm diam) (Nguyen & Lee, 2024), MEA (vs. 38-50 mm diam) and OA (vs. 45-55 mm diam) compared to P. debruynii (Crous et al., 2018) when cultured for 7 d at 25 °C (Crous et al., 2018; Nguyen & Lee, 2024). Although P. yichunense bears a striking resemblance to P. debruynii in colony morphology, it has longer conidiophores (up to 120 μm vs. 75 μm) and larger phialidic conidiogenous cells (2.3-40 μm vs. 13-27 μm), as well as significantly larger conidia [3-11.8(-13.4) × 1.5-4.6 μm vs. 3-5 × 1-2 μm (average 4 × 2 μm)] (Crous et al., 2018). Another key distinguishing feature of P. yichunense is the production of globose chlamydospores, which are not observed in P. debruynii.

Parasarocladium yichunense exhibits higher genetic affinity for P. debruynii, whereas a more pronounced genetic divergence is observed in comparison to P. dipikae, based on phylogenetic trees. Tan and Steinrucken (2024) first described P. dipikae based on phylogenetic analysis. Despite the direct morphological comparisons between P. yichunense and P. dipikae have not yet been conducted, the genetic profile of P. yichunense is clearly distinct from that of P. dipikae. This is supported by a BLASTn search of the ITS sequence of P. yichunense in GenBank, which shows 96.77% (509/526) similarity with P. dipikae (OM417251; type strain: BRIP 68235).

Although the LSU and ACT regions of P. yichunense are highly similar to those of P. debruynii, differing by only one and two nucleotides, respectively, the similarities in the ITS, tef1, and tub2 regions are 98.89%, 97.22%, and 98.89%, respectively. These results confirm that tef1 and tub2 are effective markers for distinguishing closely related Parasarocladium species. The comprehensive morphological, cultural, and multi locus analyses conducted in this study collectively support the conclusion that the isolated Parasarocladium strains represent a previously unreported species. Future research may focus on elucidating its ecological role within leaf-rolling weevil mutualisms.

Disclosure

The authors declare no conflicts of interest.

Funding information

This work was financially supported by a grant from the Startup Fund from the Nankai University to Xingzhong Liu (030/C029215002).