FOXO3 regulated granulosa cells apoptosis and AKT1 phosphorylation in Muscovy duck follicles (Cairina moschata)

Abstract

The intense broody behavior of Muscovy ducks (Cairina moschata) is a substantial negative impact on the efficiency of egg production. Forkhead box O3 (FOXO3) is a key regulator of female reproduction. It can enhance ovarian functions such as ovulation and follicle development. This study aimed to investigate the differential expression of FOXO3 between laying and broody ducks, to characterize its regulatory effects on granulosa cells (GCs) function, and to evaluate its potential as a molecular breeding marker for reducing broodiness. Quantitative real-time PCR (RT-qPCR) analysis demonstrated that FOXO3 expression was significantly higher in ovarian tissues of laying Muscovy ducks (LD) compared to broody Muscovy ducks (BD) (P < 0.01). FOXO3 expression was also significantly higher in larger developing follicles (>6 mm) than in follicles measuring 2-6 mm. Enzyme-Linked Immunosorbent Assay (ELISA) results showed that serum prolactin (PRL) levels were significantly higher in BD than in LD group (P < 0.01). Functional assays were performed in primary granulosa cells (GCs) using FOXO3 overexpression and siRNA-mediated knockdown. Overexpression of FOXO3 inhibited GCs proliferation, markedly increased the Caspase3, BAX/BCL2 protein ratio (P < 0.01), and enhanced cellular apoptosis level (P < 0.01). FOXO3 overexpression also significantly increased the autophagy-related proteins LC3 (P < 0.01) and Beclin1 (P < 0.05), while downregulating hormone‑related genes specifically expressed in GCs (StAR, CYP11A1, FSHR, ESR2, LHR). Further investigation showed that high FOXO3 expression increased AKT1 phosphorylation. Conversely, FOXO3 knockdown downregulated mRNA levels of apoptosis and autophagy‑related genes, including Caspase3, BAX, LC3, Beclin1, and FasL, with corresponding reductions in LC3 (P < 0.01) and Beclin1 (P < 0.05) protein levels. Hormone‑related genes (CYP11A1, FSHR, ESR2) and p-AKT1 protein levels showed minimal change under low FOXO3 expression. These findings suggest that high levels of FOXO3 increase AKT1 phosphorylation, regulate GCs apoptosis and influence the expressional level of hormone-related genes in Muscovy duck follicles. FOXO3 regulates the GCs apoptosis in follicles, as well as follicular development. This provides novel insights into its role in reducing broody behavior and potential applications in Muscovy duck breeding.

Introduction

As is the case with other native breeds of poultry in China, Muscovy ducks (Cairina moschata) exhibit a strong tendency towards broodiness, which has a significant impact on their egg production efficiency in industries (Hou et al., 2022; Xiang et al., 2023). This reduced productivity is largely due to intermittent broody behavior and ovarian degeneration (Wu et al., 2021). In the original Muscovy duck population, the duration of broodiness varied considerably among individuals. Ducks exhibiting broodiness typically showed significantly reduced feed and water intake. The volume of broody ducks’ ovarian tissue demonstrates substantial alterations, characterized by a diminution and cessation of ovulation (Shimmura et al., 2015; Yao et al., 2019). Brooding behavior is regulated by hormones secreted by the hypothalamic-pituitary-gonadal (HPG) axis (Guchhait et al., 2018), including gonadotropin-releasing hormone (GnRH), prolactin (PRL), progesterone (PROG), follicle-stimulating hormone (FSH), and estradiol (E2) (Brown et al., 2023; Zhou et al., 2023). The changes in hormone levels induce alterations in ovarian characteristics during the brooding period, such as PRL. This rise in PRL is triggered when neural signals from the clutch of eggs, sensed via the brood patch, stimulate hypothalamic VIP neurons (Ye et al., 2019). In birds, PROG is primarily secreted by GCs in the dominant follicle following selection. At this stage, the GC’s cellular morphology changes from flattened appearance to cuboidal cells, differing from mammals(Hou et al., 2024). A detailed understanding of the endocrine profile and ovarian characteristics associated with broodiness is therefore essential for genetic and management interventions aimed at optimizing egg-laying performance in Muscovy duck.

GCs are essential supporting cells for follicular development and serve as the primary cell for steroid hormone synthesis (Nie et al., 2024). The HPG axis regulates follicular development primarily through gonadotropins. These hormones, released from the pituitary in response to hypothalamic signals, act by binding to their cognate receptors on GCs (Chakravarthi et al., 2021). Through this binding, gonadotropins regulate key processes in GCs, including proliferation, apoptosis, and hormone synthesis, to drive follicular selection and development. Importantly, GCs proliferation and differentiation establish the necessary microenvironment for oocyte growth (Shen et al., 2023). And the functional status of GCs directly determines follicular development, selection, and atresia (Lu et al., 2020). Consequently, the balance between GCs proliferation and apoptosis is critical for maintaining normal growth and maturation of follicle, and its dysregulation is a primary cause of follicular atresia.

To explore the molecular mechanisms underlying broody-related reproductive inhibition, we focused on the Forkhead Box O3 (FOXO3) transcription factor. It functions as a pivotal regulator orchestrating fundamental cellular processes such as proliferation, apoptosis, and metabolism across multiple species (Cao et al., 2023; Wang et al., 2023). It is significantly involved in insulin signaling and oxidative stress responses (Menon and Ghaffari, 2018). In avian, FOXO3 regulates muscle cell growth and differentiation(Chen et al., 2019), as well as feather follicle function(Wang et al., 2023). Its role in controlling reproductive traits has been documented in chickens, geese, and pigeons. Preliminary study has identified FOXO3 as a potential regulator of ovulation in Muscovy ducks (Lin et al., 2021), and it acts as a pro-apoptotic factor in chicken and goose GCs (Cao et al., 2022; Liu et al., 2021). New research has associations of polymorphisms of FOXO3 gene with egg-laying intervals in pigeon, about 6 SNPs were identified(Peng et al., 2025). Although mammalian studies have well-established the role of FOXO3 in modulating cell apoptosis, its role in avian species, especially in Muscovy ducks, remains poorly defined.

Accumulating evidence in birds highlights the PI3K/AKT signaling pathway as a key regulator of ovarian follicular development. In chickens, activation of the PI3K/AKT/mTOR axis promotes GCs proliferation during early development of the follicles (Wadood et al., 2025). Conversely, its transcriptional repression during the broody period drives follicular atresia(Wang et al., 2026). In geese, BMP4 and leptin exert anti‑apoptotic and proliferative effects on GCs via PI3K/AKT dependent pathways(Wen et al., 2015; Yuan et al., 2019). Mechanistically, PI3K/AKT phosphorylates and inactivates downstream FOXO transcription factors. For example, FSH induced PI3K/AKT signaling promotes nuclear exclusion of FOXO3/4, thereby enhancing GCs proliferation(Zhao et al., 2025), while dephosphorylated FOXO3 drives GCs apoptosis in chickens. Collectively, the PI3K/AKT/FOXO3 signaling axis links hormonal cues from the HPG axis to GCs fate decisions, controlling GCs survival, proliferation, and apoptosis in birds.

Based on these findings, we hypothesize that FOXO3 promotes GCs apoptosis in Muscovy ducks through up-regulation of pro‑apoptotic genes, thereby contributing to broodiness‑associated follicular atresia. The PI3K/AKT/FOXO3 axis serves as a key regulatory node linking HPG axis signals to GCs fate decisions, making it a promising target for genetic improvement of broody traits. Accordingly, the objectives of this study were to characterize the tissue‑specific expression pattern of FOXO3 during laying and brooding stages, and to investigate its pro-apoptotic effect on GCs. Our study aims to provide a molecular basis for breeding high egg production traits with reduced broodiness in Muscovy ducks.

Materials and methods

Animals and sample collection

300-day-old female female Muscovy ducks from the MB strain were randomly selected from the Putian Xiuyu Muscovy Duck Breeding Plant (Fujian, China). Ducks were housed with free access to water and fed a diet twice daily. All procedures conducted in the current experiments received approval from the Fujian Agriculture and Forestry University Institutional Animal Care and Use Committee (PZCASFAFU25034).

Following CO₂ inhalation euthanasia, the hypothalamus, pituitary, infundibulum, magnum, isthmus, shell gland, and ovary tissues were collected from all ducks. Ovaries from LD were further dissected to isolate follicles by size. Pre-hierarchical follicles include small white follicles (SWFs, 2-3 mm), large white follicles (LWFs, 3-6 mm), small yellow follicles (SYFs, 6-8 mm), large yellow follicles (LYFs, 8-10 mm), and hierarchical follicles (F6 to F1, 10-50 mm; Fig. 1A). All samples were flash-frozen in liquid nitrogen and stored at −80°C.

Fig. 1.

Comparison of morphology and histological characteristics of ovarian tissues at 300 days of age in broody ducks (BD) and laying ducks (LD). (A) Morphological comparison of ovarian tissues from 300-day BD and LD groups. (B) Hematoxylin-eosin staining of ovarian tissues from 300-day BD and LD groups (200X and 400X). Note: normal follicle (NF), atretic follicle (AF), granulosa cell (GC).

Rapid amplification of cDNA ends (RACE)

Full-length FOXO3 cDNA was amplified from Muscovy duck ovarian tissue total RNA by reverse transcription using the SMARTer® RACE 5’/3’ Kit (Takara, Japan), following the manufacturer’s protocol. All primers were designed from Anas platyrhynchos and listed in Supplementary Table S1. Amplified products were resolved on a 1 % agarose gel, purified, and then sequenced by Huanshi Weiguang Biotechnology Co., Ltd. (China).

RNA extraction, cDNA synthesis and quantitative real-time PCR(RT-qPCR)

The total RNA was extracted using TRIzol Reagent (TIANGEN, China) following the standard protocol (Roy et al., 2020). RNA purity was assessed prior to reverse transcription, which was carried out with the Prime Script RT reagent Kit with gDNA Eraser (Takara, Japan). RT-qPCR was performed using SYBR Green Master Mix (Applied Biosystems, US) on an ABI 7500 system under the following conditions: 95°C for 2 min; 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s. Gene expression was normalized to GAPDH (Feng et al., 2024) and calculated via the 2^-△△Ct method (Schmittgen and Livak, 2008). All primer sequences are provided in Table 1. The MIQE guidelines were followed throughout the experiment(MIQE and Huggett, 2020).

Table 1.

RT-qPCR primers.

Gene name	GenBank ID	Primer sequence 5′−3′	Product size (bp)
FOXO3	XM_038176048	F: GCAGCAGGAGCAAGGAGGTTATG	135
		R: CTCGCAGGGAGCAGATCAAATCG
GAPDH	XM_038180584	F: GGTAGTGAAGGCTGCTGCTGATG	100
		R: GGAGGAATGGCTGTCACCGTTG
PCNA	XM_038166796	F: CTGGGACTTGAGGGGGAGAT	73
		R: TGGCAGACACCATTTCCTTC
Caspase3	XM_021279218	F: TGAGGCAGACAGTGGACCAGATG	108
		R: GCATTCCGCCAGGAGTAATAGCC
BCL2	XM_027451679	F: CATGTGCGTGGAGAGCGTCAAC	124
		R: ACTGATCCAGCCTCCGTTGTCC
BAX	XM_038172585	F: GAGAGCGGCGACAAGGATTACATC	99
		R: CTCGTTCATGCCCAGGATCATCAG
Beclin1	XM_013199763	F: ATCACGCTATGGTGGCTTTCTTGG	129
		R: TGCCGCCTGTGTCTTCAATCTTG
LC3	XM_013195940	F: GGCTTTCTTCCTGCTGGTGAACC	88
		R: ATCCTCATCCTTCTCCTGCTCGTAG
Fas	XM_027459847	F: TGGAACCCTACTAAGCAGCCTGAG	111
		R: TAAGATTGTCCGCCTTCCTGATTGC
FasL	XM_013190106	F: GCTGTGCCAATGCCAGTACCTC	108
		R: TGCTCCTTTCCCTGTTGCTCTTTG
P27	NM_001310406	F: GAAGAAGCACCGCAAGGAGATG	96
		R: TGCCACTCGTACCTGCCTTC
CDK6	XM_038174908	F: CAGAGCCTGGAGTGCCTACTG	107
		R: TGGGGCAATCTCAAGCAGAAATG
FSHR	XM_021267214	F: AGCCTCACTCAAGGTTCCTCTCATC	89
		R: AAGGGTTGGCACAGGAATTGATGG
ESR2	XM_038179360	F: CCCTCCCAGCAGCAAACAACTC	149
		R: TTCAGCATCTCCAGCAGCAAGTC
LHR	XM_038176401	F: ACTGGAGTCCCTGCCTAGTT	181
		R: GTCATCTCTGTAGTTCTCTGTCCT
StAR	XM_038166838	F: CGCAGCCAGCATCCTTCA	144
		R: GCAGGTGTCGGTAGGAGATG
CYP11A1	XM_027466310	F: TCGGCTGGGTGGGATAAGAG	212
		R: ACCTGCTCAAAGGGACGAG
PTEN	XM_027460418	F: GGAAAGGGACGAACTGGTGT	147
		R: CACGTAGCGTCTCTGACTGG
AKT1	XM_027459119	F: TTAGGCCTTTGGAGCTCGG	140
		R: TCCTTCTCGGCTACTTATGGC
PI3K	XM_027464233	F: TGTATGATGCAGCTATTGACC	190
		R: ACACGCTCTCTTTTATAACCA

H&E staining

Ovarian morphology was assessed using H&E staining. Briefly, BD and LD ovarian tissues were fixed in a 4 % neutral buffered paraformaldehyde solution (Biosharp, China) for 24 h. Subsequently, the tissues were dehydrated, embedded in paraffin, and sections at 3-5 μm thickness. These sections were then stained with hematoxylin and eosin (Beyotime, China).

Serum hormone analysis

Blood samples were collected from the wing veins of 40 female Muscovy ducks (twenty laying ducks; twenty broody ducks). Before blood samples were collected, all experimental ducks were fasted and deprived of water overnight. Blood was collected into anticoagulant-free collection tubes. After collection, samples were allowed to stand at room temperature for 2 h, then centrifuged at 2,800 rpm for 20 min to obtain serum. The serum was stored at −20°C for subsequent assays. The serum hormone analysis used the enzyme linked immunosorbent assay (ELISA) kit from Shanghai Enzyme-linked Biotechnology Co., Ltd., China. Following the manufacturer’s instructions to analysis the duck FSH, PRL, PROG, E2. All serum samples were included in the same assay to avoid inter-assay variability.

Isolation and cultivation of GCs

The primary ovarian GCs of Muscovy duck were isolated and cultured according to the method established in our previous study (Pan et al., 2020), which integrated mechanical and enzymatic digestion techniques based on protocols adapted from poultry studies(Gilbert et al., 1977). Briefly, SYFs (6-8 mm in diameter) were collected from 300-day laying ducks and rinsed with saline to remove debris. After removing connective tissue and blood vessels, the follicles were cut open, and the granulosa layer was carefully separated, minced into 1-3 mm³ pieces, and digested with 0.1 % type II collagenase (BioFroxx, Germany) at 37 °C for 8-10 min. Digestion was terminated by adding an equal volume of M199 medium (HyClone, US) containing 5 % FBS (Bio-PRODUCTS, US). The cell suspension was filtered through a 70 μm strainer (FALCON, US), centrifuged at 1,800 rpm for 5 min, and the pellet was resuspended in M199 medium supplemented with 5 % FBS and 1 % penicillin-streptomycin (HyClone, US). Cells were seeded into 6-well plates at a density of 2 × 10⁶ cells per well and maintained at 37 °C under 5 % CO₂. Cell morphology was observed every 24 h under a microscope. After 48 h of adhesion, primary GCs cultured on coverslips were identified by immunofluorescence (IF) staining using a diluted anti‑FSHR antibody (Proteintech, China). The cells were fixed with 4 % paraformaldehyde (Biosharp, China), permeabilized with 0.5 % Triton X-100(Solarbio, China), and blocked with 5 % normal goat serum (Solarbio, China). Subsequently, they were incubated with primary and fluorescent secondary antibodies (Elabscience, China), counterstained with 0.4 % DAPI (Elabscience, China), and imaged using a fluorescence microscope (Nikon, Japan).

Cells transfection

GCs were transfected at 80 % confluence using Lipofectamine 3000™ (Invitrogen, US) with FOXO3 overexpression plasmid (pC-FOXO3), empty vector (pC3.1), or siRNA (si-NC, si-2711, si-2032, si-1596). Transfection efficiency was evaluated by RT-qPCR after 24 h. The overexpression plasmid and all siRNAs were designed and synthesized by Sangon Biotech (Shanghai, China). The siRNA sequences are shown in Table 2.

Table 2.

siRNAs information.

siRNA name	Sequence 5′−3′
si-NC	F: UUCUCCGAACGUGUCACGUTT
	R: ACGUGACACGUUCGGAGAATT
si-2711	F: GGUCAUGGGACACGAGAAATT
	R: UUUCUCGUGUCCCAUGACCTT
si-2032	F: GGACAAUGAAUUUGAACGATT
	R: UCGUUCAAAUUCAUUGUCCTT
si-1596	F: GGGAAGAGCUCCUGGUGGATT
	R: UCCACCAGGAGCUCUUCCCTT

Western blot (WB) analysis

WB analysis was performed according to the following procedure. In brief, GCs were homogenized in ice-cold RIPA (Epizyme, China) and then centrifuged at 10,000 g for 15 min at 4°C to obtain the supernatant. The RIPA buffer was supplemented with a 100× protease and phosphatase inhibitor cocktail (Epizyme, China). Proteins were separated by 10 % and 12.5 % SDS-PAGE (Epizyme, China) and transferred to PVDF membranes (Bio-Rad, US). After blocking with 5 % BSA (Biosharp, China) at room temperature for 2 h, the membranes were incubated with primary antibodies at 4°C overnight. The primary antibodies used included anti-BAX (Zenbio, China), anti-BCL2 (Zenbio, China), anti-Beclin1 (Proteintech, China), anti-LC3 (HUABIO, China), anti-AKT1 (HUABIO, China), anti-phospho-AKT1 (Ser473, HUABIO, China), and anti-GAPDH (ABclonal, China). After incubation with primary antibodies, the membranes were incubated with secondary antibodies (Abcam, UK) at room temperature for 2 h. Finally, the proteins were visualized by Western Bright ECL Kit (Advansta, US), and quantitative analysis of the blots was performed using Image J software (National Institutes of Health, US).

Cell apoptosis, cycle, viability assay

GCs were seeded in 6-well plates at a density of 5 × 10⁵ cells per well. Upon reaching approximately 70-80 % confluence, the cells were transfected with either pC-FOXO3 or the empty vector control pC3.1. At 24 h post-transfection, cells were collected for apoptosis and cell cycle analysis using flow cytometry (BD, US). Apoptosis was assessed using an Annexin V-FITC/PI apoptosis detection kit (Beyotime, China). Cell cycle distribution was examined by Cell Cycle Analysis Kit (Beyotime, China).

For cell viability measurement, GCs were seeded in 96-well plates and transfected as described. Cell viability was measured at 24 h and 48 h post-transfection using a CCK-8 assay kit (Beyotime, China), and absorbance was read at 450 nm using a ND-2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA).

Statistical analyses

The results are expressed as the mean ± SD. All statistical analyses were performed using SPSS 27.0 (IBM Corp., US) and illustrations drawn with Prism 9.0 GraphPad Software (GraphPad Software, US). Comparative analysis between the two groups was performed using t-test. Multiple groups were compared using one-way ANOVA, followed by Duncan’s multiple comparison test. Significant differences are indicated by different lowercase letters. The symbol “*” represents P < 0.05, “**” represents P < 0.01.

RESULTS

Cloning and sequence analysis of Muscovy duck FOXO3

The full-length cDNA of FOXO3 was successfully amplified from the ovary of laying Muscovy ducks. PCR amplification and sequencing confirmed that the amplified product corresponded to the target FOXO3 nucleotide sequence. The total length of FOXO3 gene was 6,265 bp, of which the 5′UTR was 886 bp long, the 3′UTR was 3,402 bp long, and the predicted CDS was 1,977 bp long. The raw sequencing data have been deposited in the NCBI SRA database under accession number SRR30169942. Subsequent sequence identity analysis revealed that the FOXO3 sequence shared more than 92 % identity with those from other waterfowl species, as determined using DNAMAN (LynnonBiosoft, US). Please refer to Supplementary file 1.

Morphological differences between BD and LD ovarian tissues

As illustrated in Fig. 1A–B, the ovarian tissue of LD contains fully developed pre-hierarchical and hierarchical follicles, whereas BD exhibit severe ovarian regression, with characterized by uniformly small follicles (<6 mm) and insufficient accumulation of yolk material. H&E staining revealed that the LD group GC’s cellular morphology was layer of cuboidal cells, clear boundaries between the GC layer and the theca layer. In the BD group, follicular atresia is characterized by follicular atrophy and cytoplasmic darkening. Additionally, the boundary between the granulosa cell layer and the theca becomes indistinct, and GCs detach from the follicular border.

Higher expression of FOXO3 in LD’s ovarian tissue and higher PRL levels in BD group

Compared with the LD group, serum levels of FSH, E2, and PROG was significantly lower in the BD group. In contrast, PRL levels were significantly higher in the BD group than in the LD group (P < 0.01, Fig. 2A). As shown in Fig. 2B, FOXO3 mRNA expression in reproductive tissues from the LD and BD groups was measured by RT-qPCR. FOXO3 expression was higher in the LD group than in the BD group across multiple reproductive tissues, including the infundibulum, magnum, isthmus, shell gland (P < 0.01). FOXO3 expression was higher in the LD ovary than in the BD ovary (P < 0.01). Expression was also higher in the hypothalamus and pituitary tissue of the LD group (P < 0.05). FOXO3 was expressed in the LD ovary and in follicles at all stages. The FOXO3 expression levels in SWF, LWF, and SYF were the lowest, significantly lower than those in LYF and in F6 to F1 follicles (P < 0.05), with the highest expression observed in the F6 follicle (P < 0.05). These results indicate that FOXO3 is highly expressed in ovarian tissue and in larger developing follicles during the laying period.

Fig. 2.

FOXO3 expression pattern in Muscovy duck ovarian tissues at 300-day of BD and LD groups, and differences in serum hormone levels. (A) The level of FSH, E2, PRL, PROG in BD and LD groups (n = 20). (B) Differential expression of FOXO3 mRNA in reproductive tissues of BD and LD groups (n = 3). Note: Identical lowercase letters are indicative of a non-significant difference(P > 0.05); different lowercase letters indicate a significant difference (P < 0.05). “*” means P < 0.05, and “**” means P < 0.01.

Efficiency of FOXO3 overexpression and siRNA knockdown

The morphology of primary GCs was observed at 24 h and 48 h post-seeding, and their identity was confirmed by IF using the FSHR as a marker (Fig. 3A). The efficiency of FOXO3 overexpression and knockdown was assessed by RT-qPCR 24 h after transfection. As shown in Fig. 2B, FOXO3 expression was significantly higher in the pC-FOXO3 group than in the pC3.1 group (P < 0.01). Three siRNA groups (si-2711, si-2032, si-1596) showed significantly reduced FOXO3 expression compared to the negative control siRNA (si-NC). Among them, si-2711 was the most effective in reducing FOXO3 expression (P < 0.01), achieving a 90 % knockdown efficiency.

Fig. 3.

Cultivation, identification, and transfection efficiency assessment of primary GCs. (A) Primary GCs culture and IF identify. a-c: 0 h-48 h, observation of cell adhesion. d-f: FSHR, GCs marker (red); DAPI, nucleus (blue); Merge. Scale bar is 100 μm. (B) FOXO3 expression levels in GCs following transfection with pC-FOXO3 or siRNAs (n = 3). Note: “*” means P < 0.05, and “**” means P < 0.01.

FOXO3 knockdown had no significant effect on apoptosis related proteins, but increased StAR and LHR mRNA

The mRNA levels of proliferation-related gene (PCNA), apoptosis-related (Caspase3, BAX, BCL2, Fas, FasL) and autophagy-related (LC3, Beclin1) genes, and hormone-related gene (StAR, CYP11A1, FSHR, ESR2, LHR), as well as the protein levels of Caspase3, BAX, BCL2, LC3, and Beclin1, were measured following transfection with si‑NC and si‑2711. As shown in Fig. 4A–B, transfection with si‑2711 significantly reduced the mRNA expression of Caspase3 and BAX compared to the si‑NC group (P < 0.01), while the mRNA and protein expression of BCL2 was significantly increased (P < 0.05). No significant change was observed in the Caspase3, BAX/BCL2 protein ratio. The mRNA expression of PCNA also showed no significant change (P > 0.05). Both the mRNA and protein levels of the autophagy‑related genes Beclin1 (P < 0.05) and LC3 (P < 0.01) were decreased. In contrast, the expression of FasL was significantly upregulated (P < 0.01), whereas Fas showed no significant change. Fig. 4C shows the relative mRNA expression of hormone-related genes. In the si-2711 group, the expression of CYP11A1, FSHR, ESR2 was not significantly different from that in the si-NC group (P > 0.05), and the expression of StAR, LHR was significantly higher than that in the si-NC group (P< 0.05). Collectively, these results indicate that FOXO3 knockdown had no significant effect on the cleaved Caspase3, BAX/BCL2 protein ratio or on the mRNA expression of PCNA, CYP11A1, FSHR, and ESR2. However, it significantly altered the mRNA expression of several apoptosis- and autophagy-related genes (Caspase3, BAX, BCL2, Beclin1, LC3, FasL) as well as upregulating StAR and LHR.

Fig. 4.

FOXO3 knockdown had no significant effect on apoptosis related proteins, but increased StAR and LHR mRNA. (A-B) The mRNA and protein expression level of apoptosis-related genes and autophagy-related genes after transfection with si-2711 (n = 3). (C) The mRNA expression level of hormone-related gene after transfection with si-2711 (n = 3). Note: “*” means P < 0.05, and “**” means P < 0.01.

FOXO3 overexpression promotes GCs apoptosis and downregulates the expression of hormone-related genes mRNA

The mRNA levels of proliferation-related gene (PCNA), apoptosis-related (Caspase3, BAX, BCL2, Fas, FasL) and autophagy-related (LC3, Beclin1) genes, as well as the protein levels of Caspase3, BAX, BCL2, LC3, and Beclin1, were measured following transfection with pC‑FOXO3 or the empty control plasmid pC3.1. As shown in Fig. 5A–B, transfection with pC‑FOXO3 significantly increased the mRNA levels of the pro‑apoptotic genes Caspase3 and BAX (P < 0.01), decreased the mRNA levels of the proliferation-related gene PCNA. The protein levels of cleaved Caspase3, BAX (P < 0.05), as well as the BAX/BCL2 protein ratio (P < 0.01), were markedly increased. Both the mRNA and protein levels of the autophagy‑related genes Beclin1 (P < 0.05) and LC3 (P < 0.01) were upregulated, compared with the pC3.1 control. In contrast, the mRNA and protein expression of the anti‑apoptotic gene BCL2 were significantly decreased (P < 0.01). No significant changes were observed in the mRNA expression of Fas or FasL (P > 0.05). These results suggest that FOXO3 overexpression promotes the expression of pro‑apoptotic genes and autophagy-related genes.

Fig. 5.

FOXO3 overexpression promotes apoptosis and downregulates the expression of hormone-related genes mRNA. (A-B) The mRNA and protein expression level of apoptosis-related genes and autophagy-related genes after transfection with pC-FOXO3 (n = 3). (C) Cell viability measured by CCK-8 assay at 24 h and 48 h after transfection with pC-FOXO3 (n = 3). (D) Apoptosis analyzed by flow cytometry in cells transfected with pC-FOXO3 (n = 3). (E) Expression levels of cell cycle-related genes after transfection with pC-FOXO3 (n = 3). (F) Cell cycle distribution analyzed by flow cytometry after transfection with pC-FOXO3 (n = 3). (G) The mRNA expression level of hormone-related gene after transfection with pC-FOXO3 (n = 3). Note: “*” means P < 0.05, and “**” means P < 0.01.

Cell viability, apoptosis rate, and cell cycle distribution were assessed after transfection with pC‑FOXO3 or the control plasmid pC3.1, shown in Fig. 5C–F. Cell viability was measured using the CCK-8 assay, and was found to be significantly reduced at both 24 h and 48 h after FOXO3 overexpression (Fig. 5C, P < 0.01). As shown in Fig. 5D, the cell apoptosis rate was significantly increased in the FOXO3 overexpression group compared to the control group (P < 0.01), as assessed by flow cytometry. As shown in Fig. 4E, the expression of the cell cycle-related gene P27 was significantly upregulated (P < 0.01), while CDK6 expression was significantly downregulated after FOXO3 overexpression (P < 0.01). Furthermore, cell cycle distribution was altered following FOXO3 overexpression. The proportion of cells in the G0/G1 phase was significantly increased, while the proportion in S phase was significantly decreased (P < 0.01), as shown in Fig. 5F. Compared to the pC3.1 group, FOXO3 overexpression significantly downregulated the expression of CYP11A1, ESR2, LHR (P < 0.01), as well as StAR and FSHR (P < 0.05), analyzed from Fig. 5G. These results suggest that FOXO3 overexpression inhibit cell viability, promotes apoptosis and downregulates the expression of hormone-related gene mRNAs.

FOXO3 overexpression increased AKT1 phosphorylation

In this study, FOXO3 overexpression was found to increase the AKT phosphorylation, shown in Fig. 6A–D. After transfection with pC‑FOXO3, both total AKT1 and p-AKT1 protein levels were increased (P < 0.01). The mRNA levels of PI3K and AKT1 were also upregulated (P < 0.01). However, following si-2711 treatment, AKT1 mRNA expression decreased (P < 0.05), while total AKT protein and p-AKT1 protein levels showed no significant effect (P > 0.05). Moreover, PTEN expression remained stable under both pC‑FOXO3 and si-2711 treatment conditions (P > 0.05).

Fig. 6.

FOXO3 overexpression increased AKT1 phosphorylation. (A-B) The mRNA and protein expression level of AKT pathway related genes after transfection with si-2711 (n = 3). (C-D) The mRNA and protein expression level of AKT pathway related genes after transfection with pC-FOXO3 (n = 3). Note: “*” means P < 0.05, and “**” means P < 0.01.

Discussion

The Muscovy duck is a valuable meat-type breed. but its strong brooding instinct severely limits the egg-laying efficiency of breeding ducks. Therefore, reducing this trait has been a key long-term breeding objective in industrial farming systems to optimize production performance. Brooding behavior in Muscovy ducks is frequently associated with the cessation of follicular development and ovarian degeneration (Hou et al., 2023). In female birds, brooding behavior is a dynamically regulated process influenced by environmental, endocrine, and genetic factors. Previous multi-omics analyses have identified significant molecular differences between the laying and brooding periods, with differentially expressed genes, proteins, and metabolites mainly enriched in steroid synthesis, calcium ion signaling, GnRH signaling, MAPK, and PI3K/AKT pathways(Huang et al., 2024; Wu et al., 2021, 2019). Brooding is often accompanied by elevated PROG secretion. A finding consistent with our results, reflecting a physiological mechanism analogous to that observed in mammals where high PROG levels ensure that females attain the necessary physiological state for offspring nurturing (Hu et al., 2025). Comparative studies of the laying and brooding phases in Muscovy ducks can yield important insights for genetic selection and productivity improvement. Nevertheless, the regulatory mechanisms involved are far less characterized in Muscovy ducks than in domestic ducks. In modern commercial production, the genetic reduction of broodiness remains a key strategy to optimize egg-laying efficiency in Muscovy ducks.

Avian follicular development follows a strict hierarchy(Deutschlander, 2024) and is regulated by complex signaling pathways. At the core of this regulation are the proliferation and differentiation of GCs. Specifically, FSH, governed by the HPG axis, binds to its receptor FSHR on GCs to initiate follicular development (Qu et al., 2025). High levels of FSH indicate peak egg-laying (Ma et al., 2020). Unlike mammalian cyclic ovulation, the continuous ovulation in poultry relies on the functional synergy of GCs, theca cells (TCs), and oocytes during follicles growth and maturation (Johnson et al., 2015; Zhang et al., 2025). Furthermore, E2 synthesized by GCs acts through positive feedback regulation, synergizing with luteinizing hormone (LH) to maintain the dominant follicles until ovulation (Huang et al., 2025). On the contrary, extensive GCs apoptosis leads to follicular atresia, and limits reproductive performance. This phenomenon has been confirmed in chickens and geese (Jiang et al., 2025; Zhang et al., 2024). In this study, we successfully cultured follicular GCs from Muscovy ducks in vitro and subjected them to FOXO3 overexpression and knockdown to investigate the effect of FOXO3 expression levels on GC proliferation and apoptosis.

FOXO3 is an evolutionarily conserved transcription factor across mammals and birds (Hong et al., 2020; Pelosi et al., 2013). In mammals, FOXO3 protein is predominantly expressed in the nuclei of primordial oocytes within mature ovaries, where it maintains the ovarian primordial follicle reserve. Reduced FOXO3 expression in rats leads to premature activation of primordial follicles and premature ovarian failure, whereas elevated FOXO3 can reverse this phenotype(Pelosi et al., 2013). In our study, we observed that FOXO3 expression was significantly higher in larger follicles (>6 mm) than in small follicles (1-5 mm) during the laying period, which is consistent with earlier reports in chickens and geese (Cui et al., 2019; Liu et al., 2021). Moreover, FOXO3 expression was higher in the ovarian tissue of laying Muscovy ducks than in broody ducks. Previous studies did not examine ovarian FOXO3 expression patterns in the context of broodiness in chickens or geese. This expression pattern suggests that ovulation and oocyte maturation are influenced by FOXO3 in avian (Masliantsev et al., 2021; Wolc et al., 2019). The localization of the FOXO3 protein in chicken ovarian tissue is analogous to that observed in mammalian ovarian tissue (Geng et al., 2014). The level of non-phosphorylated FOXO3 protein was detected in oocytes and GCs of small follicles but only in the oocytes of larger follicles(Diaz et al., 2011). Based on these in vivo expression patterns, subsequent in vitro experiments were conducted using cultured primary GCs to further examine how FOXO3 influences GCs function.

The subcellular localization of FOXO3 affects its positive regulatory role in post-translational modifications, specifically phosphorylation levels. In chickens, FSH treatment significantly increased the levels of p-FOXO3/4 proteins and induced the nuclear export of FOXO3/4 in granulosa cells, thereby promoting granulosa cell proliferation and reducing apoptosis(Zhao et al., 2025). In mammals, GDF9 may promote granulosa cell proliferation and inhibit follicular apoptosis by regulating p-AKT and p-FOXO3a(Monte et al., 2021). Inhibiting the PI3K pathway with LY294002 blocked primordial follicle activation and increased oocyte nuclear p-FOXO3a, confirming that PI3K/AKT-mediated FOXO3a phosphorylation is essential for cell survival. The present study demonstrates that FOXO3 overexpression inhibits cell viability, induces apoptosis in Muscovy duck GCs. FOXO3 overexpression upregulates the cell cycle inhibitor P27, the pro-apoptotic genes BAX and Caspase3, while downregulating the anti-apoptotic gene BCL2. Notably, FOXO3 overexpression also increases AKT1 and PI3K mRNA levels and elevates AKT1 phosphorylation. In vitro FOXO3 overexpression model, p-AKT1 increased, indicating PI3K/AKT activation that normally promotes FOXO3 phosphorylation and cytoplasmic retention. However, the effect remained pro-apoptotic, likely because excessive total FOXO3 saturated the FOXO3 inactivation machinery. Thus, in laying duck ovaries, high FOXO3 expression may be paralleled by increased FOXO3 phosphorylation. In human GCs from patients with polycystic ovary syndrome, FOXO3 mRNA and non-phosphorylated protein levels are increased, and apoptosis is significantly negatively correlated with p-FOXO3 levels (Mikaeili et al., 2016). In sheep pituitary cells, Activin A and FSH synergistically increase p-AKT and p-FOXO3 (Wang et al., 2025). These findings highlight that p-FOXO3, rather than total FOXO3, serves as a positive regulator of GC viability. Total FOXO3 accumulation generally promotes apoptosis, while p-FOXO3 exerts cytoprotective effects. Although we did not directly measure p-FOXO3 levels in this study, the observed increase in p-AKT1 suggests potential activation of upstream PI3K/AKT signaling, which under other conditions leads to FOXO3 phosphorylation. Nevertheless, the effect of FOXO3 overexpression remained pro-apoptotic, implying that any possible increase in p-FOXO3 was insufficient to counteract the pro-apoptotic function of total FOXO3. Regarding steroidogenesis, FOXO3 overexpression in testicular Leydig cells reduces testosterone and StAR expression, and blocking the PI3K/AKT pathway abolishes LH-induced decreases in p-FOXO3(Choi et al., 2015). These data support a stage-specific functional switch in avian. In pre-hierarchical follicles, non-phosphorylated FOXO3 promotes apoptosis as a quality control mechanism. In large pre-ovulatory follicles, FOXO3 is inactivated via phosphorylation, allowing GCs survival and steroidogenesis function.

FOXO3 knockdown did not significantly change AKT1/p-AKT1 levels. It reduced the expression of the pro-apoptotic genes Caspase3 and BAX, along with the autophagy-related genes LC3 and Beclin1. And the BAX/BCL2 protein ratio remained unchanged. The expression of Fas and FasL remained unchanged following FOXO3 overexpression, but FasL decreased after knockdown. Previous reports in mammals support the role of FOXO3 as a regulator of cell cycle and apoptosis (Li et al., 2018; Pennycook and Barr, 2021), where it was shown to be involved in P27-mediated cell cycle arrest and BCL2 family-dependent apoptosis. Activated FOXO3 increases the expression of P53, P21, and their downstream proteins (Ock and Kim, 2021). This increase induces G2/M cell cycle arrest. The nuclear accumulation of FOXO3 in UM-1 cells increased the expression of pro-apoptotic proteins Bim and P27 while decreasing the expression of the anti-apoptotic protein BCL2(Yan et al., 2020). P27 is a negative regulator of the cell cycle. P27 expression is inversely correlated with CDKs expression (Abbastabar et al., 2018). FOXO3 effectively suppresses ovarian cancer cell proliferation(Tang et al., 2025). It inhibits CDK2/Cyclin E complex activity. The current data support the idea that FOXO3 regulates the cell cycle via P27 and associated pathways. These mechanisms are well characterized in mammals. They remain poorly understood in birds, especially waterfowl. The present study extends this knowledge. FOXO3 performs conserved functions in Muscovy duck GCs. Higher apoptosis is often linked to increased Fas/FasL expression (Lu et al., 2026). In the present experimental model, FOXO3 overexpression did not significantly increase Fas/FasL expression. This suggests the possible involvement of alternative apoptotic pathways. These pathways were not examined here.

The phosphorylated of AKT/FOXO3 axis is a key regulator of oxidative stress and ovarian function in mammals. For instance, VEGF enhances PI3K/AKT/mTOR signaling in rat models of premature ovarian failure (Dai et al., 2023). This enhancement promotes E2 production and follicle development. Similarly, phosphorylation of the AKT/FOXO3 pathway ameliorates ovarian dysfunction in mice by attenuating oxidative stress and apoptosis(Yu et al., 2024). The present study did not directly measure p-FOXO3 protein levels in vitro GCs. This limitation prevents discrimination between the roles of total FOXO3 and p-FOXO3 in apoptosis. Using PI3K/AKT pathway inhibitors would clarify whether the observed phenotypic changes depend on AKT activity. Future studies could examine the p-AKT/p-FOXO3 axis in avian GCs. Combined with the results from the preceding experiments, FOXO3 overexpression promoted GCs apoptosis but also increased p-AKT levels. These findings indicate that modulating FOXO3 protein activity, may suppress its pro-apoptotic function, thereby maintaining GCs survival during the laying period.

Conclusion

In summary, this study reveals the difference in FOXO3 expression between laying and brooding stages in vivo. In vitro, FOXO3 overexpression induces apoptosis in GCs and promotes AKT1 phosphorylation. These insights provide a molecular basis for understanding broodiness regulation and its potential application in genetic improvement of egg production in Muscovy ducks.

Data availability

The authors confirm that the data supporting the findings of this study are available within the article.

Funding

This work was supported by the National Natural Science Foundation of China (31001005), the Fujian Province Major Science and Technology Project (2024NZ029028), the Key Guiding Agricultural Project of Fujian Province (2025N0027) and the Fujian Agriculture and Forestry University Science and Technology Innovation Special Fund (KFB24016).

Ethical statement

All procedures conducted in the current experiments received approval from the Fujian Agriculture and Forestry University Institutional Animal Care and Use Committee (PZCASFAFU25034).

CRediT authorship contribution statement

Juan Chen: Writing – original draft, Validation, Methodology, Data curation. Yanan Liu: Writing – original draft, Validation, Methodology, Data curation. Kunlun Cao: Investigation. Keke Du: Investigation. Leyong Li: Formal analysis. Chunyi He: Formal analysis. Xu Wu: Supervision, Resources, Project administration.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix. Supplementary materials

Supplementary materials

Supplementary file 1. The primers of CDS region amplification, RACE amplification, full-length sequence validation. The predicted full-length cDNA of FOXO3 in Muscovy duck. And the total RNA by 1 % agarose gel electrophoresis.