Polymorphisms ADH1B rs1229984 and NAA25 rs4767364 correlate with head and neck cancer risk in Southern Punjab, Pakistan: a case-control study

Abstract

Background:

Genetic predisposition is one of the many factors contributing to the multifactorial etiology of head and neck cancers (HNCs), a varied group of tumors. This study examined the relationship between the risk of HNC in the population of Southern Punjab, Pakistan, and two single-nucleotide polymorphisms: ADH1B rs1229984 and NAA25 rs4767364.

Methods:

Sixty histologically verified HNC patients and 60 matched healthy controls, participated in a case-control study. A structured Performa was utilized to gather demographic information. Tetra-primer ARMS-PCR was used to genotype the genomic DNA that was isolated from blood samples. SPSS (v23) and online calculators were used to conduct statistical studies, such as odds ratios and chi-square tests.

Results:

The heterozygous CT genotype was more common in cases, and the ADH1B rs1229984 variant was statistically significantly associated with HNC (P = 0.034). Similarly, there was a higher frequency of the AG genotype in patients than in controls, indicating a stronger link (P = 0.003) with the NAA25 rs4767364 variant. Furthermore, there was a strong correlation between HNC risk and demographic factors such as age, smoking, anemia, and oral hygiene (tooth brushing; P < 0.001).

Conclusion:

The results imply that the Southern Punjab population may be more susceptible to HNC due to the polymorphisms of ADH1B rs1229984 and NAA25 rs4767364. Together with modifiable risk factors, these genetic markers may help guide future screening plans and advance the creation of individualized preventative and therapeutic treatments. To confirm these correlations and clarify underlying mechanisms, extensive research and functional evaluations are necessary.

Introduction

About 4% of all cancers worldwide are head and neck cancers (HNCs), a heterogeneous group of tumors that originate from the mucosal linings of the oral cavity, pharynx, and larynx^[1^]. Due to late-stage detection and inadequate molecular characterization, HNCs continue to pose a serious health burden despite improvements in diagnosis and therapy, especially in developing countries^[2^].

HIGHLIGHTS

• ADH1B and NAA25 polymorphisms were significantly associated with increased head and neck cancer (HNC) risk in Southern Punjab.

• Demographic and lifestyle factors have shown a great association with HNC susceptibility.

• The combined effect of genetic variants and modifiable risk factors highlights the demand for tailored screening and individualized prevention strategies for HNC.

The pathogenesis of HNC is largely influenced by well-established environmental and lifestyle risk factors, including tobacco use, excessive alcohol use, HPV infection, and poor oral hygiene^[3,4^]. However, there is mounting evidence that host genetic factors play a significant role in modifying individual susceptibility. Single-nucleotide polymorphisms (SNPs) have become promising biomarkers for cancer risk stratification, particularly those found in genes related to cellular regulation and metabolic detoxification^[5,6^].

Alcohol Dehydrogenase 1B (ADH1B) is one such gene that encodes an enzyme essential to the metabolism of ethanol, turning it to acetaldehyde, a recognized carcinogen that causes cytotoxicity and DNA damage^[7^]. The impact of a functional SNP, rs1229984 (Arg47His), on enzymatic activity has been extensively studied. The variant allele increases the production of acetaldehyde and has been linked to a higher risk of upper aerodigestive tract cancers, particularly in alcohol users^[8,9^]. There are still few research assessing this relationship among South Asian communities, especially those in Pakistan.

NAA25, which codes for a regulatory subunit of the NatB N-terminal acetyltransferase complex, is another intriguing but little-studied gene. Protein stability, subcellular localization, and interaction networks are all impacted by this complex’s role in co-translational protein modification^[10^]. Oncogenesis has been linked to protein acetylation dysregulation, especially in pathways controlling apoptosis and cell cycle regulation. Its function in HNC is yet unknown, even though altered NAA25 expression has been documented in colorectal, liver, and breast malignancies^[11^].

This study is to examine the relationship between ADH1B rs1229984 and NAA25 rs4767364 polymorphisms and the risk of HNC, given the increasing incidence of HNC in Pakistan and the dearth of genetic studies in the Southern Punjab population. This study aims to provide new insights into the genetic landscape of HNC in this high-risk population by combining genotypic data with important demographic and lifestyle factors. These findings could help guide precision medicine techniques and early detection efforts.

In line with current best practices for transparency and accountability in scientific reporting, this manuscript adheres to the TITAN guidelines for responsible disclosure of AI assistance in research and writing^[12^]. This study has been reported in line with the STROCSS guidelines^[13^].

Materials and methods

This study was conducted in two main parts: field work and laboratory work.

Study design and ethical approval

This case-control study was carried out to identify genetic variants of the ADH1B and NAA25 genes in patients with HNC. The study was conducted with the supervisor’s consent under a Memorandum of Understanding between MINAR (Multan Institute of Nuclear Medicine and Radiotherapy) and Bahauddin Zakariya University in Multan. Prior to being included in the study, each subject gave written informed consent.

Study population and sample collection

There were 120 participants in all, 60 of whom had histologically confirmed HNC and 60 of whom were age- and sex-matched healthy controls with no history or signs of malignancy. Blood samples (3–5 ml) were taken from participants who visited the MINAR diagnostic center from 4 July 2022 to 26 August 2022. Prior to DNA extraction, samples were gathered in EDTA tubes, properly labeled, and kept at −4°C.

Demographic and clinical data collection

Using a standardized Performa, demographic and clinical information were documented. Age, gender, smoking status, usage of alcohol or betel nut, dental hygiene habits (brushing/Miswak), anemia, and family history of cancer were among the data. Using this data, potential interactions between genetic variants and environmental/lifestyle factors in connection with HNC risk were examined.

Laboratory work

DNA extraction

A standard methodology based on phenol-chloroform was used to extract genomic DNA from peripheral blood leukocytes. In short, white cells were separated and lysed to liberate nuclear material, and red blood cells were lysed. Following organic extraction, ethanol was used to precipitate the pure DNA. A 1% agarose gel electrophoresis stained with ethidium bromide was used to assess the quality and concentration of extracted DNA, and DNA was detected under UV light (BIO-RAD system, USA). To be used later, the isolated DNA was kept at −20°C^[14^].

Agarose gel electrophoresis

DNA extraction was verified using agarose gel electrophoresis. Ethidium bromide-containing 1% agarose gels were made. After loading DNA samples with loading dye, they were run for 30 minutes at 120 V. A gel documentation system was used to see DNA bands under UV light (BIO-RAD, US)^[15^].

SNP variation detection by tetra-arm PCR

The ADH1B gene’s rs1229984 and the NAA25 gene’s rs4767364 were genotyped using Tetra-Arm PCR (Amplification Refractory Mutation System-Polymerase Chain Reaction)^[16^] (Table 1) after DNA extraction. In silico technologies like Primer 1 and Ensemble Genome Browser were used to build primers. The UCSC Genome Browser’s in silico PCR was used to confirm primer specificity. Each SNP’s PCR reaction mixture contained a particular set of primers (inner and outer), PCR water, master mix, and DNA template. PCR was carried out under ideal amplification conditions on a SimpliAmp Thermal cycler. The ideal annealing temperature was 55°C for ADH1B (rs1229984; Fig. 1), whereas 52°C was the ideal temperature for NAA25 (rs4767364; Fig. 2). The analysis of PCR results was done using agarose gel electrophoresis^[16,17^].

Table 1.

Primers, sequence of primer, and the product size of genetic variant.

Primers, sequence of primer, and the product size of ADH1B genetic variant
Serial no.	SNP	Primer type	Primer sequence	Amplification size	Product size of CT
1.	rs1229984	Forward inner	CTGTACCTGGTTTGACTGTATTT	416	C:273
		Reverse inner	GAGTGTTGGAGAAGGGTTG
		Forward outer	GTGCCTGGCTTCTAGTAGATAC		T:185
		Reverse outer	ATCTTTTCTGAATCTGAACAGC
Primers, sequence of primer and the product size of NAA25 genetic variant
Serial no.	SNP	Primer type	Primer sequence	Amplification size	Product size of AG
2.	rs4767364	Forward inner	TTCTAACACTGGGGTCCA	242	A:168
		Reverse inner	TCATTTTATACCTGTGGAGTAGAC
		Forward outer	CGGCAGAATAAACATGATC		G:116
		Reverse outer	CAAAGTGCAGGGATTACAG

Figure 1.

PCR profile for the amplification of ADH1B gene rs1229984 variant.

Figure 2.

PCR profile for the amplification of NAA25 gene rs4767364 variant.

Statistical analysis

IBM SPSS Statistics v23.0 (IBM Corp., USA) was used for all statistical analyses. The Hardy-Weinberg equilibrium (HWE) was used to compute genotypic and allelic frequencies using the Calculation Online tool. To evaluate the relationships between genotypes and HNC risk, the Chi-square test (χ²) was employed. To quantify risk estimations, the MedCalc online calculator was used to compute odds ratios (ORs) and 95% confidence intervals (CIs). P-values below 0.01 and 0.001 were classified as very and very highly significant, respectively, while P-values < 0.05 were deemed statistically significant.

Results

Demographic and clinical characteristics

This study included 120 participants in total, 60 of whom were HNC patients and 60 of whom were healthy controls who were matched for gender and age. Seventy-seven percent of HNC patients were male and between the ages of 40 and 60. Smoking (P = 0.007), chewing tobacco or betel nuts (P = 0.001), poor oral hygiene (P = 0.001), anemia (P = 0.005), and a positive family history of cancer (P = 0.013) were all significant risk factors for HNC. When compared to health controls, these variables displayed statistically significant differences, indicating possible lifestyle or environmental factors that may contribute to illness vulnerability (Table 2).

Table 2.

The HNC and control people’s demographic characteristics.

Variables	HNC (n = 60)	Control (n = 60)	DF	χ2 value	P-value
Gender (M/F)	35/25	25/35	1	3.333	0.068NS
	58.33%/41.66%	41.66%/58.33%
Age
(10–30 years old)	0(0%)	54(90%)
(31–50 years old)	38(63.33%)	6(10%)	2	99.273	0.000***
(51–80 years old)	22(36.66%)	0(0%)
Smoking (yes/no)	28/32	4/56	1	24.545	0.000***
	46.66%/53.33%	6.66/93.33%
Paan (yes/no)	11/49	4/56	1	3.733	0.053 NS
	18.33%/81.66%	6.66%/93.33%
Miswak (yes/no)	16/44	14/46	1	0.178	0.673 NS
	26.66%/73.33%	23.33/76.66
Brush (yes/no)	46/14	60/0	1	15.849	0.000***
	76.66%/23.33%	100%/0%
Anemia (yes/no)	36/24	8/52	1	28.134	0.000***
	60%/40%	13.33%/86.66%
Family history	11/49	8/52	1	0.563	0.453 NS
	18.33%/81.66%	13.33%/86.66%

According to statistical outcomes, smokers were more likely to have HNC (46.66%). A substantial risk factor for HNC overall was found to be smoking (P-value = 0.000***; Fig. 3). The bar graph shows the relationship between toothbrushing and the occurrence of HNC, indicating that 76.66% of people in the HNC group clean their teeth, compared to 100% of people in the Control group. Consequently, there is a negative correlation between brushing your teeth and HNC, and brushing your teeth was found to be a significant risk factor (P-value = 0.000***). The statistical analysis revealed that anemia was prevalent in 60% of HNC patients, whereas it was 13.33% in the latter group. It was a significant risk factor, according to this study (P-value = 0.000***; Fig. 3). Age was shown to be a significant factor in this analysis (P-value = 0.000***). The graph indicates that HNC is more common among those between the ages of 31 and 50.

Figure 3.

Association of smoking and anemia with head and neck cancer.

Genotype and allele frequencies of ADH1B rs1229984

Three different genotypes of ADH1B rs1229984 were identified by genotyping: TT (mutant homozygous), CT (heterozygous), and CC (wild type). The CT genotype predominated in HNC patients (60%) and was followed by CC (36.7%) and TT (3.3%). The CC genotype was more prevalent in controls (66.7%), whereas the CT and TT genotypes were 30% and 3.3%, respectively. Increased HNC risk was substantially correlated with the CT genotype (χ² = 9.84, P = 0.007; OR = 3.67, 95% CI: 1.55–8.66). Likewise, HNC patients had a substantially higher T allele frequency (18.3%) than controls (10%; P = 0.038), indicating that the T allele may be a contributing factor to HNC susceptibility (Table 3, Fig. 4).

Table 3.

Allelic frequency of ADH1B variant rs1229984 in control and HNC patients.

Gene and SNP	Allele	Control (n = 60)	HNC (n = 60)	Significance
ADH1B (rs1229984)	Wild type (C allele)	105 (87.5%)	94 (78.34)	OR = 1.3188
				95%Cl = 0.0255– 68.1456
				P-value = 0.8906
	Mutant (T allele)	15 (12.5%)	26 (21.66%)

Figure 4.

Agarose gel electrophoresis of PCR products of ADH1B (rs1229984).

A total of 273 bp indicates the homozygous wild-type C/C condition, while the homozygous mutant T/T is represented by a 185-bp band. Both bands, 185 bp and 273 bp in a sample, reflect the heterozygous C/T condition. In all circumstances, the 416 bp is the outer band that remains constant. The figure shows the heterozygous condition(C/T) by showing all three bands. Lane 5 contains a 100-bp ladder, while lanes 1–4 contain PCR products of HNC patients.

Genotype and allele frequencies of NAA25 rs4767364

Three genotypes were identified by genotyping for NAA25 rs4767364: GG (mutant homozygous), AG (heterozygous), and AA (wild type). The most common genotype among cases was AG (51.7%), which was followed by AA (31.7%) and GG (16.7%). In the controls, AA made up the majority (61.7%), followed by AG (30%) and GG (8.3%). The AG genotype and HNC were shown to be significantly correlated (P = 0.006; OR = 3.29, 95% CI: 1.45–7.45). Additionally, there was a significant link between the G allele and increased risk for HNC, as evidenced by the fact that the frequency of the G allele was significantly greater in cases (42.5%) compared to controls (23.3%; P = 0.001; Table 4, Fig. 5).

Table 4.

Genotyping frequency of NAA25 variant rs4767364 in control and HNC patients.

Genotype	Mutant type (GG)	Wild type (AA)	Heterozygous (AG)	P-value
Control (n = 60)	0 (0%)	56 (93.34%)	4 (6.67%)	0.003**
HNC (n = 60)	0 (0%)	44 (73.34%)	16 (26.67%)

Figure 5.

Agarose gel electrophoresis of PCR products of NAA25 (rs4767364).

Lanes 1–3 show the HNC patients’ samples (S1–S3), and they are all heterozygous A/G. Lane 4 has a 100-bp DNA ladder, while lanes 5–7 show the PCR products of control samples.

HWE analysis

The deviation of both SNPs from HWE was examined. Controls’ genotype distributions agreed with HWE (P > 0.05), suggesting that there was neither genotyping error nor population stratification.

Discussion

This study offers new information on the relationship between HNC susceptibility in the Southern Punjab population and ADH1B (rs1229984) and NAA25 (rs4767364) gene polymorphisms. We demonstrate a synergistic link between host genetics and environmental exposures by combining genotypic data with demographic and behavioral risk factors. This is an important feature in cancer epidemiology and personalized treatment.

A statistically significant correlation was found between the ADH1B rs1229984 polymorphism and HNC, namely the CT genotype, which was more common in cases than controls. The enzyme alcohol dehydrogenase 1B, which is essential for the metabolism of ethanol, is impacted by this SNP. Acetaldehyde, a recognized carcinogen that encourages DNA damage and tumor start, is produced quickly from ethanol by the mutant allele (T), which encodes a more active form of the enzyme^[9,18^]. Our findings are in line with the Taiwan research, which states that ADH1B rs1229984 polymorphism is prevalent in East Asian populations and has been strongly associated with alcohol-related cancer risk; however, the T allele exhibits complex associations: although it increases acetaldehyde production, meta-analyses suggest it may actually be associated with a lower risk of HNC in Asians^[19^]. It is interesting to note that although the T allele has historically been linked to protection against the negative effects of alcohol, its presence among communities that do not drink (like parts of Pakistan) may indicate different functions. Regardless of alcohol consumption levels, metabolic stress, oxidative damage, or epigenetic modifications brought on by acetaldehyde and other intermediates may still have carcinogenic^[20,21^]. Due to sociocultural sensitivities, detailed and reliable data for alcohol consumption could not be obtained comprehensively. In areas like Southern Punjab, the consumption of alcohol is frequently underreported due to significant social and cultural stigma, thus affecting the reliability of self-reported information. Given the known function of ADH1B in ethanol metabolism, the lack of specific alcohol intake data constitutes a limitation and could have influenced the evaluation of gene–environment interactions. However, this limitation illustrates a typical issue in epidemiological research carried out in comparable environments and should be understood within that framework. Regardless, the identified genetic associations continue to be significant, as they underscore a potential biological factor contributing to susceptibility to HNC in the examined population. It is suggested that future research employs more organized and private methods for gathering lifestyle information, especially regarding alcohol consumption, to gain a clearer understanding of these connections.

Our findings highlight the interaction between regional lifestyle-related risk factors, such as tobacco chewing and poor oral hygiene, and genetic predisposition. A mechanism involving reactive oxygen species (ROS) in tobacco-related carcinogenesis has been supported by reports of increased oxidative stress and decreased antioxidant capacity in saliva among Pakistani Naswar users^[22^]. Additionally, our findings are consistent with recent research demonstrating that young smokers have markedly increased ROS in their oral mucosal cells, which may increase the risk of cellular aging and DNA damage^[23^]. Oxidative stress is closely linked to HNC because it encourages mutagenesis, genomic instability, and oncogene activation^[24^]. Anemia, which is frequently an indication of persistent inflammation, malnourishment, or persistent infection, was substantially linked to HNC in our group. Pre-therapeutic anemia is found in over one-fifth of HNC patients, and even moderate cases are associated with worse survival outcomes, according to recent large-scale clinical data^[25^]. These results imply that a hypoxic, pro-oncogenic milieu that promotes tumor aggressiveness and angiogenesis may be facilitated by anemia.

Our results are among the first to show a strong correlation between HNC and NAA25 rs4767364. Although this SNP’s functional consequences are yet unclear, it might be a sign of more widespread genomic instability or dysregulation in carcinogenic pathways. To clarify its molecular significance, transcriptome profiling and functional tests will be helpful.

In the research we conducted, a number of lifestyle and demographic characteristics, such as smoking tobacco, using smokeless tobacco or betel-quid products, and having poor oral hygiene, were strongly linked to HNC in addition to genetic susceptibility. These risky practices are well ingrained in Pakistani culture and have a substantial correlation with the development of cancer^[26–28^]. The high frequency of these behaviors in Pakistan emphasizes the urgent need for risk-profile-specific public health interventions.

The urgent need for focused public health interventions and awareness campaigns in Pakistan is highlighted by the high prevalence of these risk factors in our population.

Our use of tetra-primer ARMS-PCR enabled a reliable and economical SNP genotyping technique that is especially appropriate for environments with restricted resources. Our data quality is further validated by the control group’s consistent genotype distributions with HWE, which highlights the validity and dependability of our genetic findings. These methodological advantages boost the validity of our findings and bolster their applicability to upcoming research on genetic vulnerability in HNC.

Limitations

One of the primary limitations of our research study is the sample size, i.e., 60 cases and 60 controls, which is small for a genetic association study, it may lower the statistical power and restrict the findings’ wider applicability. It is mainly due to the challenge of finding clinically confirmed cases of HNC in a constrained time frame and research region. However, this study is one of the preliminary to look into the relationship between ADH1B rs1229984 and NAA25 rs4767364 polymorphisms and HNC in the Southern Punjab population of Pakistan. It provides preliminary evidence, a solid foundation, and useful direction for future research studies despite its limited size. To validate and generalize these findings, more multi-center research with larger and more diverse populations is required.

Conclusion

ADH1B rs1229984 and NAA25 rs4767364 polymorphisms are identified in this study as possible genetic markers for the Southern Punjab population’s vulnerability to HNC. These results emphasize the significance of combining genetic screening with traditional risk assessments and advance our understanding of gene-environment interactions in cancer causation. To confirm these relationships and investigate their potential in early diagnosis, tailored prevention, and therapeutic approaches, more research using bigger populations and functional analysis is advised.

Ethical approval

Under the terms of the Memorandum of Understanding between MINAR (Multan Institute of Nuclear Medicine and Radiotherapy) and Bahauddin Zakariya University, Multan, the study was authorized by the institutional authorities.

Consent

Before the sample was collected, each subject gave their informed consent. Every participant gave permission for the use of their anonymized data for publication.

Sources of funding

No specific grant from a public, private, or nonprofit funding organization was obtained for this study.

Author contributions

S.S. and M.S.: Conceived the study, conducted the experimental work, performed data analysis, and wrote the main manuscript. W.S., U.-E.F., and M.K.: Contributed to data interpretation, literature review, and manuscript formatting. S.A.M. supervises the whole study. A.P.: Manuscript formatting, editing, and submission. All authors reviewed and approved the final version of the manuscript.

Conflicts of interest disclosure

There are no conflicting interests, according to the authors.

Guarantor

Sania Sadeeq.

Data availability statement

The corresponding author can provide the datasets created and/or examined during the current investigation upon reasonable request.