Evaluation of systemic and mucosal immune responses in Nile tilapia following intraperitoneal and immersion vaccination with inactivated tilapia lake virus (TiLV) vaccine

Abstract

Tilapia lake virus (TiLV), an orthomyxovirus, poses a significant threat to global tilapia aquaculture. However, there has been limited success in developing commercial vaccines. The current study assessed the protective efficacy of a cell culture-derived, formalin-inactivated whole virus vaccine for Nile tilapia (Oreochromis niloticus) administered via injection or immersion. Upon viral challenge, the vaccinated fish yielded relative percent survivals of 100% and 83.88% to injection and immersion vaccinations, respectively. Immune responses were assessed through standardized IgM and IgZ indirect ELISAs in blood and mucus, and through immune gene expression profiling in spleen and kidney tissues. IgM levels were significantly elevated in vaccinated fish from 14 days post-vaccination and remained detectable up to 180 days, with peak responses at days 28 (in serum) and 42 (in mucus). Similarly, IgZ level was significantly higher in vaccinated fish than in the control throughout the study period, with a peak at 28 days. Innate and adaptive immune genes (IgM, IgD, IgZ, MHC I, MHC II, CD4, IL1β, Mx, NFκβ, RSAD2, IRF3, and TLR2) were consistently up-regulated in vaccinated fish. Collectively, the results indicate that the inactivated whole-virus vaccine is capable of stimulating coordinated humoral and cellular responses against TiLV, supporting its potential use in commercial settings.

Introduction

Aquaculture is one of the major food-producing sectors that plays a key role in food, nutritional and economic security of the ever-increasing world population. The global aquaculture production has increased by 25.7% between 2000 and 2018 with a total value of USD 401 billion, confirming its contribution to the world economy¹. Nile tilapia (Oreochromis niloticus) is an important cichlid for aquaculture, being farmed due to its robustness, quick growth, high protein content, and tolerance to a wide range of water and climatic conditions². It is the second most farmed fish after the carps³ and regarded as the ‘Food fish of the 21st Century’². Tilapia has an estimated worldwide production of 5.93 million metric tons in 2022, generating approximately revenue of 13.7 billion USD⁴. Originally native to Africa and the Middle East, tilapia is now cultivated in over 145 countries worldwide⁵. Although low price and ease of culture have led to global trade and intensification of tilapia farming, in retrospect, it has given rise to the emergence of diseases that impede the growth of the tilapia aquaculture.

Tilapia are generally considered to be a disease-resistant fish species as compared to other fishes⁶. However, over a period of time, they are infected with different groups of pathogens, including bacteria, fungi, parasites and viruses^7–11. Within the viral diseases, there have been reports of ten viral infections in tilapia, including three RNA and seven DNA viruses¹². Lymphocystis disease virus (LCDV)¹³, Bohle iridovirus (BIV)¹⁴, iridovirus-like agent¹⁵, tilapia larvae encephalitis virus (TLEV)¹⁶, infectious spleen and kidney necrosis virus (ISKNV)¹⁷, tilapia parvovirus (TiPV)¹⁸ and novel megalocytivirus¹⁹ are among the DNA viruses known to infect tilapia. In addition, infectious pancreatic necrosis virus (IPNV)²⁰, nervous necrosis virus (NNV)²¹ and tilapia lake virus (TiLV)²² are the RNA viruses that have been reported to infect tilapia¹².

Since its emergence, TiLV has been associated with high mortality rates (up to 90%), especially in juvenile and young adult tilapia^3,12,23. The first outbreak of TiLV occurred during the summer of 2009, with mass mortalities of both farmed and wild hybrid tilapia observed throughout Israel. The causative agent was subsequently identified in 2013^22,24. Following its initial identification in Israel, TiLV has been detected subsequently in multiple geographic regions, with disease outbreaks reported across Asia, Africa, and North and South America, including countries such as Ecuador, Egypt, Thailand, India, and the United States⁶. Since its emergence, TiLV has been associated with severe outbreaks characterized by mortality rates of up to 80–90%, particularly in fry and juvenile stages²¹, leading to substantial production and economic losses. Retrospective and surveillance studies suggest that international trade of infected seed stocks has contributed to the transboundary spread of the virus to multiple countries²⁵. In India, TiLV has been detected across several major aquaculture regions, including Karnataka, Maharashtra, Kerala, West Bengal, and Tamil Nadu, confirming its expanding geographic distribution and raising concerns regarding the sustainability of tilapia farming^24–29. The widespread emergence of TiLV underscores the urgent need for strengthened surveillance, improved biosecurity, and effective preventive measures, including vaccination, to mitigate economic losses and protect the long-term stability of the global tilapia industry. The virus is an enveloped, single-stranded RNA virus with an icosahedral morphology, exhibiting particle sizes ranging approximately from 55 to 100 nm³⁰. Based on taxonomic assessments, TiLV is currently classified within the family Amnoonviridae, genus Tilapinevirus, species Tilapia tilapinevirus, reflecting revisions from its earlier description as an orthomyxo-like virus³¹. It is a deca-segmented virus with a genome size of 10,323 kb that encodes 14 functional genes and 14 viral proteins³². TiLV infection in tilapia is associated with a broad spectrum of clinical manifestations, including behavioural abnormalities like lethargy, surface swimming, and reduced feeding, systemic signs such as anaemia and abdominal swelling with ascites, and external lesions characterized by exophthalmia, corneal opacity, skin erosion, haemorrhagic patches, and body discolouration¹².

General approaches to disease prevention include improved biosecurity, water quality management and early disease detection through surveillance. However, these measures alone are not sufficient to control viral diseases. In this scenario, vaccination is widely recognized as a reliable and sustainable approach for long-term disease management in aquaculture. Inactivated vaccinations constitute the majority of commercially available viral vaccines in aquaculture. Several vaccine candidates from Israel, China and Thailand are under development or at trial stages against TiLV^3,32–36, however, there is no commercial vaccine available so far⁶.

Inactivated vaccines are generally preferred for their stability, safety, ease of preparation and commercial viability³⁴. Vaccination in fishes is carried out through oral, injection (intraperitoneal or intramuscular), or immersion routes. Among these, injection-based vaccination (IP or IM) requires relatively smaller antigen quantities and ensures that each fish receives an accurate and uniform vaccine dose³⁷. Although this method generally induces a prolonged immune response compared to the others, it also presents notable limitations: being labor-intensive, applicable only to fish of specific sizes and life stages, and can cause stress in the vaccinated fish⁶. On the other hand, the immersion method mimics the natural infection conditions. This approach offers several practical advantages, including reduced handling stress, operational simplicity, rapid application, and economic feasibility, as it enables the immunization of large numbers of fish simultaneously. However, its protective efficacy is often limited by suboptimal antigen uptake, which can result in comparatively lower immune stimulation³⁸. In general, the earlier vaccine development studies against TiLV reveal variations but a promising degree of protection. For example, a higher level of protection (RPS 56.0 to 85.7%) using inactivated (heat or formalin) vaccine has been described as compared to new generations (DNA or subunit) vaccines with a low degree (RPS of 27.8 to 85.7%) of protection as reviewed by Kembou-Ringert et al⁶. However, a limited knowledge of tilapia mucosal immune responses and pathways therein has led to poor emphasis on routes of vaccination.

Here, we have evaluated the comparative protective efficacy of a whole virus inactivated vaccine for protection against TiLV infection in Nile tilapia administered through intraperitoneal (IP) injection and immersion. The primary objective of this study was to appraise the vaccine in tilapia by assessing survival outcomes, viral loads, and understanding coordination between both arms of humoral and cellular immune responses. Particular emphasis was placed on quantifying specific immunoglobulins like IgM and IgZ antibodies using indirect ELISA, both in serum and mucus. By integrating serological assays with molecular immune markers, this work addresses that shortfall and contributes to the ongoing efforts to establish effective vaccination strategies for sustainable tilapia aquaculture.

Materials and methods

Experimental fish

A total of 400 Nile tilapia (Oreochromis niloticus) of GIFT variety (body weight 45 ± 5 g) were obtained from the farm of the state government, Bhubaneswar, India. Out of these, 180 numbers were used for studying the vaccine efficacy through the intraperitoneal injection method, while 150 numbers were used for an immersion vaccine trial. All the fish were acclimated in 500 L fibreglass tanks with proper aeration and were maintained at 28 ± 1 °C throughout immunization and challenge trials, in the wet laboratory. They were fed with commercial feed corresponding to 3% body weight of total fish per day in two divided doses, and the water parameters were maintained by exchanging 20% water and faecal material every day. Before the commencement of the experiment, five fish were randomly selected and screened by PCR to ensure that the fish used in the study were free of both TiLV and TiPV infections. The details of tissue sampling (liver and spleen) and nucleic acid extraction are described later. For TiLV detection, cDNA was synthesized from tissue RNA and the cDNA templates were subjected to PCR using the NE1/NE2 primers²². For TiPV screening, tilapia tissue DNA samples were subjected to PCR amplification with the TiPV1607F/2141R primers¹⁸.

Preparation of TiLV vaccine material

The vaccine material was prepared from the TiLV ultrapellet obtained from the Aquatic Animal Health Laboratory, PG & Research Department of Zoology, C. Abdul Hakeem College, Tamil Nadu, India³⁹. TiLV was propagated in susceptible tilapia gill and heart-derived cell lines following the method described by Nanthini et al.³⁹. Infected cultures exhibiting distinct cytopathic effects were subjected to freeze-thaw thrice to facilitate viral release. The resulting cell lysates were clarified by centrifugation at 5000 rpm for 20 min to remove cellular debris. The clarified supernatant was then ultracentrifuged at 40,000 rpm for 3 h to obtain the viral ultrapellet. The supernatant was discarded, and the pellet was resuspended in 1 mL sterile 1X PBS. The concentrated viral preparation was subsequently inactivated and used for vaccine formulation. The presence of TiLV in the preparation was confirmed by qPCR using primers 112 F/R before inactivation. Total protein concentration of the viral preparation was determined using the Pierce™ BCA Protein Assay Kit (Cat. No. 23225, Thermo Scientific, USA) and adjusted to approximately 10 mg/mL prior to virus inactivation. For inactivation, TiLV ultrapellet was treated with 0.006% formalin (MP Biomedicals, USA) and incubated for 24 h at 25 ˚C³. The inactivated virus was then used for a blind passage in tilapia gill cell line available in our laboratory. No cytopathic effects were observed, indicating successful viral inactivation. Subsequently, the vaccine material was stored at 4 ˚C until use. The intraperitoneal vaccine was adjuvanted with Freund’s incomplete adjuvant (FIA) (MP Biomedicals, USA) in 1:1 ratio, and Montanide IMS 1312 VG PR (Seppic, France) was used at a 1:1 ratio for immersion vaccination before the trials.

Vaccine trials

Injection vaccine trial against TiLV

One hundred and twenty healthy tilapia were randomly divided into 6 tanks (each containing 20 fish); three vaccinated (IPV 2- IPV 4) and three control tanks (IPC 2-IPC 4) as detailed in Fig. 1. For vaccination, the inactivated vaccine material was dissolved in 1X PBS adjusting the final concentration to be 1 mg per ml and injected 100 µl (with FIA) intraperitoneally at a dose of 1 mg/kg body weight into 60 tilapia and the other three tank fish were injected with 1X PBS (with FIA) as a control. The 1X PBS received by the control group underwent similar formalin treatment and incubation to simulate the inactivation of the vaccine material. A single booster dose was given 14 days after the first dose using the same antigen concentration and adjuvant formulation as in the initial immunization. All tilapia were challenged intraperitoneally with TiLV (1.2 × 10⁸ copy numbers per 100 µl) after 21 days of the booster dose. The infectious virus was collected from the National Referral Laboratory for Freshwater Fish Diseases, Bhubaneswar, India). All the fish were observed for 28 dpc (days post-challenge). The relative percent survival (RPS) was calculated according to Amends method [RPS = {1 − (% mortality of immunized group/% mortality of control group)} × 100]⁴⁰.

Fig. 1.

Schematic representation of the experimental design for evaluating systemic and mucosal immune responses following intraperitoneal and immersion vaccination with formalin-inactivated TiLV in Nile tilapia. IPV: intraperitoneal injected vaccinated group, IPC: intraperitoneal injected control group, IMV: immersion vaccinated group and IMC: immersion control group.

In another experiment, 60 tilapia were divided into one vaccinated and one control group IPV 1 and IPC 1, respectively (each containing 30 fish) and the above immunization protocol was repeated to study the changes in immune gene expression as well as serum and mucosal IgM levels, as detailed later.

Immersion-based vaccine trial against TiLV

Total 150 tilapia (75 in treatment + 75 in control) of average body weight 45 g were randomly allocated for the experiment. The vaccine dose was calculated based on the total fish biomass. For each immersion batch, 75 fish were included, corresponding to a total biomass of 3,375 g. The antigen dose was standardized at 4 µg per gram body weight, resulting in a total antigen requirement of 13.5 mg. Based on a stock concentration of 10 mg/mL, 1.35 mL of antigen was used for the vaccine preparation. The antigen was emulsified with an equal volume (1.35 mL) of Montanide IMS 1312 VG PR adjuvant (1:1 ratio) under gentle stirring until a stable and uniform emulsion was formed. The prepared antigen–adjuvant emulsion was then dispersed in 100 L of aerated tap water to prepare the immersion bath.

Seventy-five fish were immersed in the vaccine bath for 5 h under continuous aeration. This corresponded to a biomass density of approximately 33.7 g/L, which is within acceptable limits for immersion procedures under aerated conditions. Aeration was maintained to ensure adequate dissolved oxygen levels and homogeneous distribution of the vaccine emulsion, while excessive bubbling was avoided to minimize mechanical stress and prevent disruption of the emulsion. Fish were continuously monitored during the exposure period, and no abnormal behavioural or physiological stress responses were observed. Control fish were immersed under identical conditions in 100 L of aerated water containing 1X PBS and Montanide adjuvant without antigen.

Following exposure, the first 30 vaccinated and 30 control fish were distributed into tanks tank IMV 1 and IMC 1, respectively, to study the antibody response and immune gene expression (Fig. 1). The remaining fish were divided into 6 tanks (three vaccinated named IMV 2-IMV 4 and three control tanks IMC 2-IMC 4; each of having 15 fish). A single booster dose was also given after 14 days of the 1st dose in a similar manner. All these tilapia (45 vaccinated + 45 control) were challenged with TiLV, similarly as described earlier, after 21 days of the booster dose. The fish were observed continuously for 28 days post-challenge (Fig. 1), with mortality rates recorded regularly to calculate the relative percent survival (RPS).

Collection of samples from vaccinated and control fish

For immune response study, both control and vaccinated (IP and immersion) tilapia were subjected to sampling at regular intervals post-vaccination. Eight fish from the vaccinated and another eight fish from the control group were randomly selected for the collection of blood and skin mucus at 7, 14, 21, 28, 42, 56, 90 and 180 days post 1st dose of vaccine. Blood samples were collected from the caudal vein and allowed to clot overnight at 4 °C. Serum was separated by centrifugation (fixed angle rotor 220.87, Z 216 MK, Hermle, Germany) at 6000 × g for 10 min at 4 °C and stored at − 20 °C until use. The mucus samples were collected by swiping a clean slide along the dorsal surface of the fish and were suspended at 30% (w/v) in TBS (0.02 M Tris, 0.15 M NaCl, pH 7.4) containing 20% DMSO and protease inhibitor cocktail (Thermo Scientific, USA). The samples were centrifuged at 10,000 × g for 10 min, and the supernatant was carefully collected and kept at − 20 °C.

Tilapia kidney and spleen tissue samples were collected at 7, 14, 21, 28, 42 and 56 d post-vaccination from both vaccinated and control tilapia (n = 3) for immune-related gene expression analysis. They were preserved in TRIzol reagent (Invitrogen, USA) and kept at − 20 °C until RNA extraction was performed. Fish were anaesthetized with MS222 (Tricaine methane sulphonate, Sigma) during handling and sacrificed with overdose of anaesthesia. All experiments were carried out in accordance with the Institute’s Animal Ethics guidelines and were approved by the Institutional Animal Ethics Committee (IAEC) (ICAR-CIFA/Eth. Comm./2024–25/10/07.10.2024), following the regulations of the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), Government of India.

Besides, all the dead fish following the virus challenge were collected aseptically, dissected and liver, kidney and brain tissues were immediately collected and stored at − 80 °C. These tissues were subjected to RNA extraction, quality and quantity check, followed by cDNA synthesis and finally qPCR for TiLV detection following the standard protocol of our laboratory⁴¹.

Calculation of the TiLV copy number in tilapia tissues

In order to study the protective efficacy of the vaccine, the clinical features of the disease and mortality were monitored daily post-challenge. The tissues collected from dead fishes (both control and vaccinated), and survivors on 28 dpc were run for qPCR analysis. The viral load was quantified through qPCR targeting TiLV genomic segment 3 with the specific primers TiLV-112 F (CTGAGCTAAAGAGGCAATATGGATT) and TiLV-112R (CGTGCGTACTCGTTCAGTATAAGTTCT)⁴². Before that, a routine RT-PCR was carried out to generate specific amplicon of 112 bp and verified by electrophoresis on a 1.5% agarose gel and sequencing. The purified PCR product was cloned into the pJET1.2/blunt vector and introduced into E. coli DH10β competent cells for transformation. Plasmid was extracted using a commercial gel extraction kit (QIAquick, Qiagen, Germany) following the manufacturer’s instructions. For standard curve generation, 10-fold serial dilutions of plasmid equivalent to 10¹ to 10¹⁰ copies per 10 µl of the target amplicon were prepared using nuclease-free water and were used as templates for establishing the standard curve. The viral copy number was calculated from this curve following Paul et al.⁴³.

Determination of immunoglobulin M (IgM) titer by ELISA

The antigen-specific IgM response in serum and mucus following vaccination was studied using an indirect ELISA system developed in our laboratory⁴⁴. Before proceeding with the ELISA, the optimal concentration of antigen for coating and the optimum dilution of the serum samples were standardised through ELISA. The mucus samples, already diluted before storage, were used directly as samples in the process. TiLV ultrapellet was used as antigen at a concentration of 2 µg/ml and rabbit anti- tilapia IgM serum diluted to 1:10000 was used as the antibody following Padhiary et al.⁴⁴.

Development and determination of immunoglobulin Z (IgZ) titre by ELISA

An indirect ELISA was developed to quantify IgZ levels in mucus samples collected from immersion-vaccinated fish. A commercially procured antibody specific to Nile tilapia IgZ (CP-16-24; Abgenex Pvt. Ltd., India) was used as the primary antibody, defined here as the antibody directly binding to IgZ, captured in the assay system. The antibody was generated against a previously characterized IgZ-specific peptide region conjugated to KLH using the P62–KLH method as described by Velázquez et al.⁴⁵. The selected peptide sequence exhibits minimal homology with other tilapia immunoglobulin isotypes, including IgM. Prior to its application in ELISA, the antibody was biotinylated twice to enhance binding efficiency and signal detection.

The indirect ELISA protocol initiated with coating the 96-well plate with 50 µl of TiLV ultrapellet as antigen at a concentration of 2 µg/ml and kept at 4 °C overnight. The next day, the wells were blocked with blocker casein in TBS (Thermo Scientific, USA) followed by washing three times at 3-minute intervals with TBST. The mucus samples from tilapia vaccinated by immersion mode and their respective controls were only used as samples for IgZ quantification, and 50 µl of mucus was used per well. After incubation for 1 h, the plates were washed, and 50 µl of biotinylated CP-16-24 at a concentration of 8 µg per ml was added to each well. The plates were then incubated for another hour. Following the TBST wash, 50 µl of streptavidin (diluted 1:5000) was added and incubated for 1 h. After a final washing step, 100 µl of TMB/H₂O₂ substrate solution was applied to each well and allowed to react for 10 min in the dark. The enzymatic reaction was terminated by adding 50 µl of 1 N H₂SO₄. Absorbance was taken at 450 nm using the microplate reader. Each sample was run in duplicate.

Transcription level of immune-related genes

The kidney and spleen tissues stored for the immune-gene expression study were processed for RNA extraction using TRI reagent (Sigma, St. Louis, MO, USA) following the manufacturer’s protocol. The quality and quantity of extracted RNA were checked using Nanodrop (NanoDropOne, Thermo Scientific, USA). Genomic DNA contamination was removed using DNase treatment, and cDNA synthesis (20 µl reactions) was performed using Verso cDNA synthesis kit (Thermo Scientific, USA). The modulation of expression of various innate and adaptive immune genes in vaccinated and control fish was analysed using a quantitative real-time PCR, with specific primers as listed in Table 1. Before qPCR, their respective annealing temperatures were standardized by semi-quantitative PCR. The qPCR reaction was carried out using PowerUp SYBR Green Master Mix (Thermo Scientific, USA) on a QuantStudio^TM 5 Real-Time PCR system (Thermo Scientific, USA). Each reaction (10 µl final volume) contained 5 µl of SYBR Green master mix, 0.3 µl forward and reverse primers (10 µM each), 1.0 µl cDNA and 3.4 µl nuclease-free water. The reaction consisted of an initial denaturation at 95 °C for 2 min, followed by 40 amplification cycles of denaturation at 95 °C for 30 s, annealing at the optimal temperature of each primer pair (as shown in Table 1) and extension at 72 °C for 30 s. The transcription levels of immune-related genes in vaccinated and control tilapia were normalized to the internal reference β-actin gene (Table 1), and relative fold changes were calculated using the method⁴⁶, with the corresponding control group at the same sampling time serving as the calibrator.

Table 1.

Primers used in the immune gene expression study.

Sl no.	Immune gene	Primer 5’-3’	Ta in °C	References
1	IgM	F-GGATGACGAGGAAGCAGACT R-CATCATCCCTTTGCCACTGG	60	3
2	IgT	F-TGACCAGAAATGGCGAAGTCTG R-GTTATAGTCACATTCTTTAGAATTACC	53	3
3	IgD	F-AACACCACCCTGTCCCTGAAT R-GGGTGAAAACCACATTCCAAC	60	3
4	IL1β	F-GGCATCAAAGGCACAAACC R-AGAGAAATCGCACCATGTCG	60	47
5	Mx	F- ACCCTTGAGCTGGTGAATCA R-ATCCTGAGTGAATGCGGTCA	62	47
6	NFκβ	F-CGACCACTACCTACACGCTC R-GATGTCGTTTGAGGCATCGC	61	33
7	CD4	F-GCTCCAGTGTGACGTGAAA R-TACAGGTTTGAGTTGAGCTG	60	3
8	MHC I	F-TTCTCACCAACAATGACGGG R-AGGGATGATCAGGGAGAAGG	60	48
9	MHC II	F-AGTGTGGGGAAGTTTGTTGGAT R- ATGGTGACTGGAGAGAGGCG	60	48
10	RSAD-2	F-ATCAACTTCTCTGGCGGA R-AGATAGACACCATATTTCTGGAAC	61	49
11	TLR-2	F-GTATCTCAGTGCTCGTCGCTCA R-TTTCATTATCGTCTCCAGTGCG	57	33
12	IRF-3	F-ACCGACGGCTTTACAGAGAA R-TCCTCGTCACTGCAGTCTTT	60	47
13	β-actin	F-AACAACCACACACCACACATTTC R-TGTCTCCTTCATCGTTCCAGTTT	Control	33

Statistical analysis

Statistical analysis of cumulative survival between the vaccinated group and the control group post-challenge was analysed using the Kaplan–Meier curve. Data at each time point in ELISA as well as in the gene expression study, were presented as mean ± standard error (SE). Statistical differences between the vaccinated and control groups were assessed using Student’s t-test in GraphPad Prism version 5.01 (GraphPad Software Inc. San Diego, CA, USA), with a significance threshold set at p < 0.05. To evaluate differences within each group across various time points, Duncan’s multiple range test was employed using SPSS Statistics 26 (IBM, Chicago, USA), with statistical significance considered at p < 0.05.

Results

Protection of vaccinated fish against TiLV challenge

The cumulative mortality was monitored in both the vaccinated as well as control groups following TiLV challenge up to 28 days to evaluate the protective efficacy of the vaccines (both injection and immersion). In the case of the injection, the control group fish showed first mortality at 2 dpc (days post-challenge) and continued up to 18 dpc. The highest mortality was observed at 10 dpc (n = 18) followed by 7 dpc (n = 10) as shown in Fig. 2(a). A total of 49 fish died out of 60 in the control group. In contrast, no mortality was observed in the vaccinated group even after 28 dpc, although mild symptoms including reduced feed intake, lethargy and redness were recorded in 17 out of 60 vaccinated fish (28.33%).

Fig. 2.

Mortality of control and vaccinated tilapia after TiLV challenge represented by Kaplan-Meier survival curve. (a) Survival curve in the injection vaccination group, (b) Survival curve in the immersion vaccination group.

In the case of immersion vaccination, the mortality began in the control group at 4 dpc and continued till 15 dpc with peak mortality on the 10 dpc (n = 9) (Fig. 2b). In the vaccinated group, the mortality commenced on 8 dpc and continued till day 15. In total, 31 of the 45 control tilapia died during the virus challenge, whereas mortality in the vaccinated group was limited to 5 individuals. The cause of mortality in the dead ones was confirmed by RT-PCR.

The Kaplan–Meier analysis was performed and the survival curves were prepared for both the injection and immersion groups. The relative percent survival (RPS) was 100% following injection vaccination and 83.88% after immersion vaccination, demonstrating that both routes conferred substantial protective efficacy post-virus challenge.

TiLV copy numbers in challenged tilapia

Quantitative real-time PCR (qPCR) was performed to determine TiLV viral loads in the liver, kidney, and brain tissues of challenged tilapia. At first the standard curve of TiLV was efficiently constructed, with correlation coefficients of 0.9775 from which the copy numbers are calculated (Fig. 3a). In case of injection vaccination, maximum mortality occurred in the control group fish at 10 dpc (Fig. 2a), which also revealed the highest viral burdens (Fig. 3b), particularly in the kidney (7.7 × 10^8±0.18 copies), followed by the liver (1.89 × 10⁷^±0.07 copies) and brain (2.17 × 10⁵^±0.03 copies) per 100 ng RNA. In contrast, both vaccinated and control survivors sampled at 28 dpc exhibited markedly lower viral copy numbers. However, viral loads in control survivors (kidney: 1.31 × 10³^±0.04; liver: 9.71 × 10^2±0.01; brain: 4.67 × 10^2±0.006) were consistently lower than those of vaccinated survivors (kidney: 1.23 × 10⁴^±0.1; liver: 1.65 × 10³^±0.044; brain: 0.6 × 10³^±0.01) copies per 100 ng RNA.

Fig. 3.

Protective effect of vaccine after virus challenge. (a) standard curve for the detection of TiLV load; (b) quantitative analysis of TiLV viral load in kidney, liver and brain tissues of tilapia in the injected group. The samples from the control dead group were collected on 10 dpc, while the samples from control and vaccinated survivors collected at 28 dpc; (c) quantitative analysis of TiLV viral load in kidney, liver and brain tissues of tilapia in the immersion group. The samples from the control and vaccinated dead group were collected on 10 dpc, while the samples from the control and vaccinated survivors were collected at 28 dpc.

The virus challenge in immersion vaccination group led to mortality in both vaccinated and control tilapia (Fig. 2b). Though the highest mortality occurred in control group at 10 dpc but very high viral copies were found in case of vaccinated dead tilapia (Fig. 3c). The kidney, liver and brain tissues of vaccinated dead tilapia possessed 1.29 × 10^9±0.09, 3.57 × 10^8±0.03 and 1.09 × 10^6±0.09, copies per 100 ng RNA. This suggests that vaccinated fish often require a higher number of viral copies to cause mortality compared to unvaccinated controls, as vaccine-induced immunity can elevate the threshold of viral replication necessary for disease progression. The kidney tissue of control dead tilapia contained 8.48 × 10^7±0.23 copies per 100 ng RNA, followed by the liver (1.84 × 10⁷^±0.14) and brain (1.17 × 10^6±0.3), which were slightly less than the vaccinated dead group. In contrast, both vaccinated and control survivors sampled at 28 dpc exhibited evidently lower viral copy numbers. Viral loads in vaccinated survivors (kidney: 1.90 × 10^5±0.02; liver: 0.5 × 10^6±0.17; brain: 0.4 × 10^4±0.22) were a little higher than those of control survivors (kidney: 2.02 × 10^3±0.66; liver: 2.9 × 10^2±0.23; brain: 1.63 × 10^2±0.13). Overall, these results confirmed that vaccination effectively reduced TiLV replication and dissemination in tilapia.

Measurement of immunoglobulin M (IgM) response by iELISA

To study the humoral and mucosal immune responses induced by vaccination, tilapia serum and mucus IgM levels were measured using standardized indirect ELISAs.

In case of IP vaccination, the concentration of IgM in sera increased gradually post 1st dose of vaccination and reached the highest concentration at 28 d in the immunized group, as shown in Fig. 4a. In contrast, the control group maintained significantly lower IgM levels (p < 0.05) throughout the study period. Similarly, in mucus samples, the vaccinated group exhibited higher IgM levels at day 14 and a peak at day 42 compared to the control group (Fig. 4b). Notably, a significant difference in antibody levels between the two groups was maintained consistently from 14 d in both serum and mucus till 6 months post-vaccination, suggesting activation of systemic and mucosal humoral immunity.

Fig. 4.

Specific IgM levels in the serum (a) and mucus (b) of control and immunized tilapia (n = 8) at various time points following 1st dose of injection vaccination. Asterisks (*) denote significant differences between the control and vaccinated groups at each time point (p < 0.05).

To assess the immersion vaccine-induced humoral and mucosal responses, IgM levels in serum and mucus were also quantified using indirect ELISA. As shown in Fig. 5a, serum IgM in the vaccinated group increased progressively after the first immunization, reaching its maximum at 28 days post-vaccination (dpv), whereas in the control group, it remained at significantly lower concentrations throughout the experimental period (p < 0.05). A comparable trend was observed in mucus samples (Fig. 5b), where IgM levels in vaccinated fish started increasing from day 14 and peaked at 28 dpv. Importantly, the elevation in IgM levels post-vaccination in both serum and mucus persisted throughout the six-month study period following vaccination. Additionally, the modulation of IgM level post-vaccination remains similar to that of injection vaccination, though the attainment of the peak in mucus was earlier than that of injection vaccination. Immersion vaccination also elicited a pronounced increase in mucus IgZ levels in tilapia compared with the control group, which remained consistently low throughout the sampling period (Fig. 5c). A measurable rise in IgZ was evident as early as day 7 post-vaccination, indicating rapid mucosal immune activation. IgZ levels continued to escalate over time, reaching a clear peak on day 28, where the absorbance values were the highest among all time points. Following this peak, IgZ concentrations gradually declined but remained significantly elevated till day 180 as compared to control (Fig. 5c).

Fig. 5.

IgM levels in the serum (a) and mucus (b), and IgZ level in mucus (c) of control and immunized tilapia (n = 8) at various time points following 1st dose of TiLV vaccination. Asterisks (*) denote significant differences between the control and vaccinated groups at each time point (p < 0.05).

Transcription level of immune-related genes

The transcriptional responses of innate and adaptive immune genes were evaluated in the kidney and spleen tissues at 7, 14, 21, 28, 42 and 56 days post first dose of vaccination in both vaccinated and non-vaccinated control fish following injection and immersion vaccine trials (Figs. 6 and 7, respectively). Overall, vaccinated fish showed upregulation in the expression of all examined genes, indicating activation of both humoral and cellular immune responses.

Fig. 6.

qPCR analysis of the expression of immune-related genes in (a) kidney and (b) spleen of control and tilapia vaccinated by the injection method. Data are presented as the mean ± SE (n = 6). The letters (a, b, c, d, e, f and p, q, r, s, t, u) denote statistical significance at various time points within vaccinated and control groups.

Fig. 7.

qPCR analysis of the expression of immune-related genes in (a) kidney and (b) spleen of control and immersion vaccinated tilapia. Data are presented as the mean ± SE (n = 6). The letters (a, b, c, d, e, f and p, q, r, s, t, u) denote statistical significance at various time points within vaccinated and control groups.

In injection vaccination, the adaptive immune markers viz., IgM, IgT, and IgD transcripts were significantly elevated in both spleen and kidney tissues, with consistent high expression of IgM in the spleen throughout the study period. CD4 attains its highest peak at 21 d in both kidney and spleen. At the same time, MHC I and MHC II genes were upregulated notably, particularly at 21 dpv in the spleen and at 28 dpv in the kidney. suggesting enhanced antigen presentation and T-cell activation in response to a booster dose of vaccination.

Regarding innate immune responses, early and strong induction was observed for RSAD2 and Mx. IL1β, IRF-3, TLR2 and the transcription factor NFκB were also significantly upregulated and possibly translated into the protective response of the vaccine.

Immune-gene profiling revealed a clear, time-dependent activation of both humoral and cell-mediated responses in the kidney following immersion vaccination. Across all gene targets, vaccinated fish displayed markedly higher transcript levels than controls, indicating that immersion delivery effectively stimulated systemic immune tissues.

All immunoglobulin genes showed vaccine-induced transcriptional activation (Fig. 7), but the magnitude of expression was higher in the spleen than in the kidney. Similarly, elevation in expression of CD4, MHC I and MHC II genes was noticed indicating active antigen processing and presentation throughout the immune-priming period. Innate immune and antiviral gene responses followed a distinct pattern. IL-1β exhibited an early and sharp rise, consistent with rapid inflammatory signalling in the kidney as well as in the spleen following immersion exposure. TLR transcripts were elevated 21 dpv, reflecting pathogen-recognition–driven activation of downstream signalling pathways. This was accompanied by increased expression of NFκB, supporting the engagement of pro-inflammatory and downstream transcriptional networks. Antiviral genes, including Mx, RSAD2, and IRF3 were also significantly upregulated, with the strongest induction typically occurring between 14 and 42 dpv indicating activation of interferon-mediated antiviral mechanisms.

Discussion

The safety, simplicity and effectiveness of inactivated viral vaccines in fish are mostly available commercially in comparison to nucleic acid-based vaccines or subunit or recombinant vaccines⁶. Inactivated vaccines, although relatively simple in formulation, have always offered consistent protection against several viral pathogens in fish, such as infectious salmon anaemia virus (ISAV), infectious pancreatic necrosis virus (IPNV) in salmonids and viral hemorrhagic septicemia virus (VHSV) in cyprinids⁶. These vaccines are advantageous due to their safety, as they do not involve live pathogens, and their stability during production and storage. Recent studies have demonstrated that nano- and polymer-based delivery systems can significantly enhance the efficacy of inactivated viral vaccines. For instance, PLGA and chitosan encapsulated inactivated vaccines have been shown to improve antigen stability, immune modulation, and protective efficacy against viral haemorrhagic septicaemia virus (VHSV) in olive flounder^50–52. However, their main limitations include the requirement for booster doses and adjuvants to achieve long-lasting immunity. Further, a good number of publications have evaluated inactivated TiLV vaccines with varied effectiveness^{3, 32–36}. However, none of the studies have looked into the measurement of mucosal immunity in terms of looking into the immunoglobulin Z or IgZ (also known as IgT and can be used interchangeably) levels in the mucus and its translation into rendering protection, if any, following vaccination. Tilapia lake virus (TiLV) has recently appeared as a highly virulent pathogen, responsible for severe mortality and substantial economic losses in tilapia on a global scale. Reliance solely on biosecurity and management practices has proven insufficient for controlling TiLV, leading to the urgent need for vaccination strategies, capable of conferring durable protection. The current study focuses on a formalin-inactivated TiLV vaccine administered through injection as well as immersion to look into their comparative effectiveness and also understanding the mechanism of interaction between dual arms of immunity. Injection provides higher protection than immersion because it delivers a precise and uniform antigen dose directly into the body, ensuring rapid and strong activation of the systemic immune system. In contrast, immersion relies on antigen uptake across mucosal surface, where absorption is variable and sometimes inefficient, especially for inactivated whole-virus vaccines. This leads to lower antigen internalization and reduced systemic priming. However, immersion vaccination offers practical advantages for large-scale aquaculture, particularly for juvenile fish, and may be optimized through dose refinement and booster strategies. The effectiveness also measured by additionally looking into mucosal immunity, including humoral immunity, which jointly translated into protection. Further, to prolong immunity which remains as one of the limitations of inactivated vaccines, we used FIA and Montanide as adjuvants for injection and immersion vaccines, respectively. While the pathological features of TiLV infection have already been established and preliminary vaccine candidates are currently being explored, there remains a critical research gap in demonstrating long-term immune protection and identifying a reliable immunological method to correlate vaccine efficacy. By integrating serological assays with molecular immune markers, this work addresses that shortfall and contributes to the ongoing efforts to establish effective vaccination strategies for sustainable tilapia aquaculture.

Diverse vaccine candidates are under development for TiLV, ranging from conventional inactivated formulations to advanced DNA, subunit, and nanoparticle-based vaccines, each contributing valuable insights toward effective disease control in tilapia aquaculture³⁴. demonstrated that β-propiolactone (BPL)-inactivated vaccines, with or without Montanide IMS 1312 VG adjuvant, conferred high levels of protection in tilapia, with relative percent survival (RPS) values of 85.7% and 64.3% at higher antigen doses (10⁸ and 10⁷ TCID₅₀/ml, respectively). Similarly, Mai et al.³ evaluated heat-killed (HKV) and formalin-killed (FKV) vaccines without adjuvants against the TiLV strain TH-2018-K. Both vaccines provided significant protection, achieving survival rates of 81.3% (RPS of 71.3%) for HKV and 86.3% (RPS of 79.6%) for FKV, with mortality onset occurring approximately 7 days post-challenge. In addition to inactivated vaccines, nucleic acid-based approaches have also shown varied potential. A DNA vaccine encoding TiLV ORF10, cloned into the eukaryotic vector pcDNA3.1, produced strong protection, with an RPS of 85.7% at a dose of 45 µg plasmid DNA³³. Subunit vaccines have been tested as well, although with comparatively lower efficacy. For instance, a VP20-based vaccine (TiLV segment 8) expressed in E. coli conferred only moderate protection, with survival and RPS values of 52.5% and 51.3%, respectively. But further priming with VP20-plasmid-based DNA vaccine (pV-optiVP20) led to a 72.5% survival rate against TiLV32. Recombinant proteins from TiLV segments 9 (Tis9) and 10 (Tis10) also provided partial protection in hybrid red tilapia, with RPS values of 27.8% and 44.5%, respectively, at 28 days post-challenge³⁶. More recently, novel nanotechnology-based approaches have been introduced. A chitosan nanoparticle (CN)-based immersion vaccine encapsulating formalin-inactivated TiLV (strain VET-KUTV08) demonstrated superior efficacy compared to its unencapsulated counterpart, yielding an RPS of 68.2% versus 25.0% under cohabitation challenge conditions⁵². In the present study, the simple inactivated TiLV vaccine induced protective immunity that resulted in 100% RPS when administered through IP injection and 83.88% RPS in the case of immersion vaccination, further denoting FKV effectiveness and its commercial application in either mode. The higher percentage of protection achieved here might be due to the standardized antigen concentration, use of an adjuvant that enhances antigen presentation and the inclusion of a booster dose, all under controlled environmental conditions. These parameters, along with GIFT variety and challenge protocol, likely contributed to the superior protection observed, underscoring the importance of optimized vaccination strategies in tilapia.

The effectiveness of the formalin-inactivated TiLV was also supported by a reduction in viral load in different tissues post-challenge through a developed RT-PCR quantification tool. The infection pattern following both vaccination routes demonstrated that immunisation reduced TiLV replication, though the degree of protection differed between injection and immersion delivery. In the injection trial, the high mortality of control fish at 10 dpc corresponded with their markedly elevated viral loads, particularly in the kidney. Vaccinated fish showed substantially lower viral replication during this acute phase, indicating effective early control of the infection. By 28 dpc, both vaccinated and control survivors exhibited greatly reduced viral titres, though vaccinated survivors retained slightly higher residual loads, likely reflecting differential infection kinetics driven by early immune priming rather than incomplete protection. The control survivors exhibited lower viral loads, which may be due to effective viral clearance in a few comparatively resistant fish. This observation aligns with vaccine experiments conducted by Mai et al. (2021), Zeng et al. (2021) and Yu et al. (2022). In the immersion trial, mortality also peaked in the control group, but the highest viral burdens were found in vaccinated fish that succumbed to infection. This indicates that immersion vaccination enhanced survival despite detectable viral loads, providing partial but meaningful resistance. It also indicated individual variation in resistance plays a significant role in protection against TiLV and opens up scope of selective breeding for resistance. Although vaccinated dead fish carried higher viral copies than control dead ones, survivors from both groups showed much lower titres at 28 dpc, with vaccinated survivors again presenting slightly higher residual loads. This comparatively higher residual viral copy number does not necessarily indicate ongoing pathogenic replication but may instead represent controlled, non-lethal viral persistence under effective immune regulation. In teleost fish, vaccination typically induces protective rather than sterilizing immunity, whereby viral replication is substantially restricted but not completely eliminated. Immune priming due to vaccination facilitates rapid activation of humoral and cellular responses upon virus exposure, limiting tissue damage while allowing transient or low-level of viral persistence. Similar outcomes have been observed in tilapia following vaccination against TiLV, where survival was associated with immune activation rather than complete viral clearance^{29, 48}. Overall, both delivery methods suppressed TiLV amplification and exhibited the ability of the inactivated vaccine to limit TiLV dissemination and disease progression.The observed kinetics of serum and mucosal IgM responses indicate a dynamic humoral immune response elicited by the vaccine. In the present study, longitudinal sampling was performed to monitor the kinetics of humoral and mucosal immune responses within one vaccinated and one control group over time. This approach allowed assessment of dynamic immune changes while minimizing the total number of animals used, in accordance with ethical principles of reduction in experimental animals. Although sampling procedures were conducted using minimally invasive techniques and adequate recovery periods were provided between time points, repeated handling may have induced a degree of physiological stress that could potentially influence certain immune parameters, which should be considered while interpreting the results. The gradual increase post 21d reflects the effect of the booster dose administered at 14 days, suggesting the beginning of activation of humoral immune response. The peak of serum IgM at 28 days post-vaccine 1st dose suggest that systemic antibody production was stimulated early post-vaccination, irrespective of route of administration, correlating with activation of B cells. The later peak of mucosal IgM at 42 dpv likely reflects the delayed development of localized mucosal immunity in the case of an injection vaccine, which is critical for protection at epithelial surfaces where TiLV infection can initiate. This delayed mucosal response aligns with previous studies demonstrating that mucosal antibody production often lags behind systemic responses in teleost fish³. IgM levels remained detectable up to 6 months post-vaccination, suggesting durable antibody-mediated protection. However, the decline in IgM levels following peak responses may indicate the transition from an active immune phase to immune memory or homeostasis. Overall, these findings highlight the vaccine’s capacity to induce both systemic and mucosal antibody-mediated immunity, which contribute to protection against TiLV.

The piscine IgZ is the key mediator of mucosal immune response. It was initially discovered in zebrafish and trout, respectively^53–54. IgZ response following vaccination has been rarely investigated in earlier studies, although it plays a crucial role during viral entry through mucosal routes. This limited evaluation is mainly due to the unavailability of a specific quantifying system. Specialised ELISA system for IgZ is difficult to design as the concentration is very low in the mucus and it degrades quickly. Also, the absence of specific antibodies against IgZ for fish hinders the ELISA-based analyses. Hence, monoclonal antibodies (MAbs) that specifically recognize immunoglobulins (Igs) could be used for evaluating antibody responses. Here, we quantified the IgZ response in tilapia mucus following immersion vaccination by iELISA. The sustained mucosal IgZ response observed in this study further highlights the potential importance of mucosal immunity in TiLV protection, particularly relevant for immersion vaccination strategies. The immune-related gene expression has been studied to provide a comprehensive picture of vaccine-induced protection. The dynamics of mucus IgZ following immersion vaccination provide clear evidence of a strong and durable mucosal immune response in tilapia. The early rise in IgZ by day 7 suggests that the vaccine efficiently engages mucosal B cells shortly after exposure, consistent with the rapid activation typically observed at epithelial interfaces where pathogens first interact with the host. The marked peak at day 28 reflects a period of maximal IgZ production, likely corresponding to clonal expansion and differentiation of IgZ-secreting cells within mucosal-associated lymphoid tissues. Although IgZ levels gradually declined after this peak, it remained significantly elevated relative to the control group throughout the 180 days trial. This pattern highlights a sustained mucosal antibody response, suggesting that the immersion vaccine is capable of generating both an early and long-lasting IgZ-mediated protective effect at mucosal surfaces. Although IgZ ELISA was performed for immersion-vaccinated fish to assess mucosal immunity, quantification was not extended to the injection group because IgZ is primarily a mucosal isotype and was detected at levels near the assay threshold following systemic vaccination. Preliminary analyses showed high variability; therefore, IgZ responses in the injection group were instead supported by gene expression analysis. Overall, the ELISA results demonstrate strong and durable induction of IgZ in the mucus of vaccinated tilapia, reflecting effective stimulation of mucosal immunity following immersion vaccination. Such long-term persistence is particularly important for aquatic species that continuously encounter waterborne pathogens. The extended IgZ elevation also suggests the possibility of memory-like responses within the teleost mucosal immune system, supporting the notion that immersion vaccination can elicit both immediate and prolonged humoral protection at the mucosal surface. Collectively, these findings reinforce the value of immersion vaccination as an effective strategy for inducing robust IgZ-mediated defence in tilapia.

Analysis of immune gene expression in vaccinated tilapia consistently demonstrates that vaccination stimulates both innate and adaptive immune responses, though the magnitude and timing of transcriptional changes vary across tissues and vaccine types. For example, DNA vaccination (pcDNA3.1–ORF10) significantly enhanced the expression of several immunity-related genes, including IgM, TLR2, MyD88, IL-8, TNF-α, IFN-γ, and NFκB in the spleen, liver, and kidney. The highest upregulation was observed for IgM in the spleen and IFN-γ in the liver, while pro-inflammatory cytokines such as IL-8 and TNF-α were strongly elevated in the kidney³³. Comparable results were reported with many inactivated vaccines, particularly when administered with adjuvants. Elevated expression of CD4, MHC I and MHC II, alongside cytokines such as TNF-α, IL-1β and IFN-γ, suggests that both T-cell mediated and antibody-mediated responses are critical for developing protective immunity against TiLV^{3, 6, 32, 34}. In our study, injection vaccination against TiLV elicited a strong immune response in Nile tilapia, engaging both innate and adaptive mechanisms. Transcriptional activation of innate immune markers, including IL-1β, Mx, RSAD2 (viperin), IRF-3, NFκB, and TLR2, indicated rapid recognition of viral antigens and initiation of antiviral pathways. These genes are central to pathogen sensing, pro-inflammatory signalling, and direct inhibition of viral replication, and their early induction likely contributed to limiting TiLV replication post-challenge. In parallel, the vaccine promoted sustained upregulation of adaptive immune genes such as IgM, IgT, IgD, CD4, MHC I and MHC II. Although the precise function of IgD in teleost fish remains incompletely characterized, previous studies suggest its involvement in pattern recognition, B-cell activation, immune regulation and mucosal immune responses⁵⁵. The increased IgD expression detected in the present study may indicate activation of B-cell and their potential contribution to antiviral defence mechanisms. This response may reflect early adaptive immune modulation induced by vaccination, complementing IgM-mediated systemic immunity. This transcriptional profile reflects broad activation of humoral and cell-mediated responses. Additionally, induction of IgT, an immunoglobulin that leads to mucosal immune response in teleosts, suggests that vaccination enhances mucosal defence. The increased expression of antigen-presenting molecules (MHC I and MHC II) and T-cell markers (CD4) further underscores efficient antigen processing and presentation, leading to effective T-cell activation and the potential for long-term immune memory. The elevated gene expression levels observed at later time points may represent sustained immune stimulation following booster administration, indicating maintenance of immunological activation rather than transient peak responses. These findings are consistent with previous studies reporting similar gene expression profiles, reinforcing the potential of inactivated TiLV vaccines to provide comprehensive and long-lasting immunity.

Immune profiling during immersion vaccination revealed distinct, time-dependent gene-expression dynamics in major immune organs. All immunoglobulin genes were strongly upregulated, with the spleen showing a higher magnitude of activation than the kidney, consistent with its role as a central lymphoid organ. Similarly, increases in CD4 and both MHC classes suggest active antigen presentation throughout the immune-priming period in both tissues. Antiviral markers, including Mx, RSAD2, and IRF3, showed peak expression between days 14 and 42, indicating sustained interferon-mediated antiviral activity following booster immersion exposure. Together, these findings demonstrate that TiLV vaccination activates complementary innate and adaptive pathways, supporting antiviral defence across systemic and mucosal tissues. The coordinated induction of inflammatory, antiviral, antigen-presenting, and immunoglobulin genes underscores the capacity of both injection and immersion delivery to prime robust protective immunity in tilapia.

This study provides a structured comparative evaluation of injection and immersion vaccination strategies against TiLV by integrating transcriptional profiling with systemic and mucosal immune assessments over an extended post-immunization period. By monitoring early innate antiviral gene activation alongside long-term IgM and IgZ responses up to 180 days, the study explains the coordination between innate and adaptive immunity in Nile tilapia. The association between early immune gene upregulation and sustained antibody production offers insight into vaccine-induced immune kinetics. Monitoring immune responses over time offers a broader basis for assessing vaccine efficacy in teleosts and strengthens the understanding of immune durability in fish vaccination strategies.

Conclusion

Taken together, our study provides compelling evidence that the inactivated TiLV vaccine is able to activate tilapine immune system via injection as well as immersion route. The early activation of innate antiviral genes and subsequent adaptive responses helps in durable immune protection upto six months as observed in the study. It is also capable of eliciting persistent humoral and mucosal immune responses in the form of rise in IgM and IgZ in tilapia, significantly reducing viral infection, and enhanced survival following viral challenge. These results emphasise the importance of combining immune monitoring tools such as ELISA with functional challenge studies to comprehensively evaluate vaccine efficacy. By highlighting both the protective potential and the underlying immunological mechanisms of the vaccine, this work contributes to the advancement of TiLV vaccine development and enhances our understanding of vaccine-induced immune dynamics in fish.

Author contributions

Swatiprava Padhiary : Investigation, Methodology, Formal analysis, Data curation, Validation, Writing—original draft, Anirban Paul : Conceptualization, Investigation, Formal analysis, Writing—review & editing, Project administration. Jyotirmaya Mohanty : Conceptualization, Investigation, Methodology, Formal analysis, Writing—review & editing, Project administration, Supervision. A.S. Sahul Hameed : Conceptualization, Methodology, Project administration. Devika Pillai : Conceptualization, Supervision, Project administration. Pramoda Kumar Sahoo : Conceptualization, Methodology, Data curation, Visualization, Funding acquisition, Project administration, Resources, Supervision, Writing—review & editing.

Funding

Department of Biotechnology, Govt. of India, New Delhi, India (Grant no. BT/PR35775/AAQ/3/969/2019).

Data availability

The data that support the findings of this study are available on request from the corresponding author.

Declarations

Competing interests

The authors declare no competing interests.