Generation and characterization of induced pluripotent stem cell (iPSC) lines from patients affected with Tay-Sachs and Sandhoff disease

Abstract

Tay-Sachs and Sandhoff diseases, are sphingolipidoses caused by rare genetic mutations in the HEXA and HEXB genes, that encode the alpha and beta subunits of lysosomal hexosaminidase, respectively. Here, we report the generation and characterization of three Tay-Sachs and one Sandhoff iPSC lines derived from patients with late-onset disease carrying mutations at the HEXA or HEXB gene. The Tay-Sachs patients carried either homozygous or complex heterozygous mutations in the HEXA gene. The Sandhoff patient carried a heterozygous mutation in the HEXB gene. These four iPSC lines will serve as a valuable resource for the development of in vitro lysosomal storage disease models and therapeutic drug development.

1. Resource Table

Unique stem cell line identifier	NCATSi001-A, NCATSi002-A, NCATSi003-A, NCATSi004-A
Alternative name(s) of stem cell line	HT1185A (c.805G > A/c.805G > A), HT1186A (c.533G > A/c.805G > A), HT1187B (c.805G > A/c.1073G > A), HT1188B (c.522 T > G/unknown)
Institution	National Center for Advancing Translational Sciences, National Institutes of Health, Rockville, MD, USA
Contact information of the distributor	Carlos Tristan carlos.tristan@nih.gov
Type of cell line	iPSC
Origin	Human
Additional human source info requiredfor human ESC or iPSC	Age: UnknownSex: HT1185A (male), HT1186A (female), HT1187B (male), HT1188B (male)Ethnicity: Unknown
Cell Source	Fibroblast
Clonality	Clonal
Method of reprogramming	Sendai virus
Genetic Feature(s)	HT1185A; HEXA (c.805G > A)/(c.805G > A)HT1186A; HEXA (c.533G > A/c.805G > A)HT1187B; HEXA (c.805G > A/c.1073G > A)HT1188B; HEXB (c.522 T > G/unknown)
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	RT-PCR
Associated disease	Tay-Sachs and Sandhoff Disease
Gene/locus	HEXA and HEXB
Date archived/stock date	10/9/24
Cell line repository/bank	N/A
Ethical approval	Tissue samples in this study were from patients enrolled in an NIH protocol, “Natural History of Glycosphingolipid Storage Disorders and Glycoprotein Disorders” (IRB 09-HG-0107, NCT00029965), approved by the National Human Genome Research Institute IRB.

2. Resource Utility

Four iPSC lines were created from Tay-Sachs or Sandhoff patients carrying HEXA or HEXB mutations. These lines differentiate into all three germ layers, providing a resource for generating disease relevant cell types and enabling therapeutic development and in vitro studies of sphingolipidoses.

3. Resource details

Sphingolipidoses are a group of rare, inherited lysosomal storage disorders caused by defects in enzymes involved in sphingolipid metabolism. These enzymatic deficiencies lead to accumulation of sphingolipids within lysosomes. In general, these disorders have a collective frequency of 1 in 8,000 individuals (Schultz et al., 2011). Among them, Tay-Sachs and Sandhoff diseases result from deficiencies in the heterodimeric enzyme β–hexosaminidase A resulting from mutations in the HEXA gene (Tay-Sachs disease) or HEXB (Sandhoff diseases), respectively (Toro, et al., 1999). The failure to break down GM2 leads to its progressive accumulation in neuronal lysosomes, causing neuropathology and neurodegeneration. The prognosis for individuals affected with Tay-Sachs or Sandhoff disease is poor, as there is currently no treatment to cure or slow the progression of these diseases (Picache et al., 2022). Therefore, the development of cellular models for these diseases is critically needed to enable the drug discovery and therapeutic development.

To this end, fibroblasts from three individuals affected with late-onset Tay-Sachs disease and one individual with late-onset Sandhoff disease were obtained from anterior forearm skin biopsies and cultured in MEF medium. The Tay-Sachs patients carried the following HEXA gene mutations: homozygous c.805G > A (G269S)/c.805G > A (G269S), complex heterozygous c.533G > A (R178H)/c.805G > A (G269S), or complex heterozygous c.805G > A (G269S)/c.1073 + 1G > A (IVS9 + 1G > A). The Sandhoff patient-derived line carried a heterozygous c.552 T > G (Y184X)/unknown mutation in the HEXB gene.

Fibroblasts were reprogrammed using the CytoTune iPS 2.0 Sendai Reprogramming Kit (Invitrogen) that contains three vectors encoding the transcription factors, Klf-4, OCT3/4, Sox2, and c-Myc. Following successful reprogramming, single-cell clonal iPSC lines were generated and expanded for three passages on Matrigel-coated plates in StemFlex medium. At passage three, iPSC lines were transferred onto vitronectin-coated plates and cultured for an additional 7–10 passages in E8 Medium.

To improve cell viability and recovery, the CEPT cocktail was used at each passage and at cryopreservation (Chen et al., 2021). All four cell lines displayed typical undifferentiated stem cell morphology and markers of undifferentiated hPSCs, NANOG, OCT4 and SOX2 (Fig. 1A and Table 1). Quantitative RT-PCR was used to confirm the expression of NANOG, OCT4 and SOX2 transcripts in all four cell lines at passage 10–11 (Supplementary Fig. 1A and Table 2). Sanger sequencing was performed for each cell line to verify mutations at the HEXA or HEXB genes (Fig. 1B). Sendai virus clearance was assessed for all iPSC lines at passages 10–13, in comparison to positive control HT1186A at passage 3 post transduction (Supplementary Fig. 1B). To evaluate differentiation potential, all cell lines were differentiated into ectoderm, mesoderm and endoderm, and differentiation was evaluated by Western blot and immunocytochemistry (Fig. 1C, Supplementary Fig. 1C).

Fig. 1.

Induced pluripotent stem cell lines generated from patients with either Tay-Sachs or Sandhoff disease. (A) Tay-Sachs disease patient derived cell lines (HT1185A, HT1186A, HT1187B) or Sandhoff cell lines (HT1188B) display typical iPSC morphology and express self-renewal markers NANOG, OCT4 and SOX2. Scale bar is 75 μm. (B) Sanger sequencing of HEXA and HEXB mutations in iPSC lines HT1185A, HT1186A, HT1187B, and HT1188B, blue highlight indicates mutation (C) Western blot of cells differentiated into ectoderm (PAX6), mesoderm (Brachyury) and endoderm (SOX17).

Table 1.

Classification	Test	Result	Data
Morphology	Microscopy Bright field	Normal	Fig. 1 panel A
Phenotype	Qualitative analysis (Immunocytochemistry)	OCT4, NANOG, SOX2	Fig. 1 panel A
	Quantitative analysis (RT-qPCR)	Oct4, Nanog, Sox2 gene expression	Supplementary Fig. 1 panel A
Genotype	Karyotype (CGH array) and resolution	46, XY; 46, XX; 46, XY; 46, XY Resolution: 50–100 kb	Supplemental
mtDNA analysis (IF APPLICABLE)	N/A	N/A
Identity		Performed
	STR analysis	24 sites tested; matched	Submitted to the journal archive
Mutation analysis (IF APPLICABLE)	Sequencing (Sanger)	Homozygous and Heterozygous	Fig. 1 panel B
	Southern Blot OR WGS	N/A
Microbiology and virology	Mycoplasma	Mycoplasma testing by luminescence. Negative	Supplemental
Differentiation potential	Directed differentiation	Ectoderm (PAX6), mesoderm (Brachyury), endoderm (SOX17	Fig. 1 panel C Supplementary Fig. 1 panel C
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping	N/A	N/A
Genotype additional info (OPTIONAL)	HLA tissue typing	N/A	N/A

Table 2.

Reagents details.

	Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat #	RRID
Markers of undifferentiated hPSCs	Mouse anti-OCT4	IF;1:100	Santa Cruz Cat# SC5279	AB_628051
	Goat anti-SOX2	IF;1:100	R&D Cat# AF2018	AB_355110
	Rabbit anti-NANOG	IF;1:200	Cell Signaling Technology Cat# 4903	AB_10559205
		WB; all 1:50
Differentiation Markers	Rabbit anti-PAX6	IF; 1:100 IF; 1:100	Biolegend Cat# 901,302	AB_2749901
	Rabbit anti-Brachyury	IF;1:1000	Cell Signaling Technology Cat# 81,694	AB_2799983
	Rabbit anti-SOX17	WB; all 1:50	Cell Signaling Technology Cat# 81,778	AB_2650582
House-keeping Markers	Alpha tubulin	WB;1:200	Abcam Cat# ab7291	AB_2241126
Secondary antibodies	Donkey anti-mouse Alexa Fluor	IF; 1:1000	Thermo Fisher Scientific Cat# A10037, A32849,	AB_11180865
	568	WB; No dilution	A21206	AB_2762840
	Donkey anti-goat Alexa Fluor 647		ProteinSimple Cat# 042-206, 042-205, 043-522-2	AB_2535792
	Donkey anti-rabbit Alexa Fluor 488
	Anti-Rabbit Secondary HRP
	Anti-Mouse Secondary HRP
	Anti-Goat Secondary HRP
	Primers
	Target	Size of band	Forward/Reverse primer (5–3)
Markers of undifferentiated hPSCs (RT-qPCR)	Nanog	N/A	IDT Assay ID: Hs.PT.58.21480849
	OCT4	N/A	IDT Assay ID: Hs.PT.58.14648152.g
	SOX2	N/A	IDT Assay ID: Hs.PT.58.237897.g
House-Keeping Genes (RT-qPCR)	GAPDH	N/A	IDT Assay ID: Hs.PT.39a.22214836
	ACTB	N/A	IDT Assay ID: Hs.PT.39a.22214847
Sendai virus detection (PCR)	SeV	181 bp	GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC
	KOS	528 bp	ATGCACCGCTACGACGTGAGCGC/ACCTTGACAATCCTGATGTGG
	Klf4	410 bp	TTCCTGCATGCCAGAGGAGCCC/AATGTATCGAAGGTGCTCAA
	c-Myc	523 bp	TAACTGACTAGCAGGCTTGTCG/TCCACATACAGTCCTGGATGATGATG
House-Keeping Gene (PCR)	GAPDH	197 bp	GGAGCGAGATCCCTCCAAAAT/GGCTGTTGTCATACTTCTCATGG
Genotyping Primers (PCR)	0c.805G > A (G269S)	477 bp	GTAAAACGACGGCCAGTTTGAAGATAGTCCCTGACACC/GGAAACAGCTATGACCATGTCCATTGTCCAAAGTGAGTTCT
	0c.533G > A (R178H)	381 bp	GTAAAACGACGGCCAGTCCCTGAGAACAGTCACAGATTG/GGAAACAGCTATGACCATGCCACACCCAGTCCATACATTC
	c.1073 + 1G > A (IVS9 + 1G > A)	489 bp	GTAAAACGACGGCCAGTGGCTTCTGAGATCCTTGCTTAT/GGAAACAGCTATGACCATGCTGTTTGTGCCAGTGCTCTA
	c.552 T > G (Y184X)	282 bp	GTAAAACGACGGCCAGTGAACTCCATCTTGAGTTGCTTTAAT/GGAAACAGCTATGACCATGGCTTGTCTCACAAGAAAGATGC

High-resolution karyotyping of each iPSC line showed a normal human diploid karyotype, with few detectable variants as summarized (Supplementary Table s3). STR profiling was performed for each iPSC line using the GenePrint 24 System (Promega) (submitted to the journal archive). Mycoplasma testing was conducted at passage 3 and 11 using the MycoAlert Mycoplasma Detection Kit and all cell lines were free of contamination (Supplementary).

4. Materials and Methods

4.1. Cell culture and reprogramming

Patient derived fibroblasts were cultured in DMEM medium (Thermo Fisher) supplemented with 10% fetal bovine serum, 100 ug/ml streptomycin, 100 units/ml penicillin, and maintained in a humidified 5% CO₂ atmosphere at 37 °C. Fibroblasts were reprogrammed into iPSCs using Sendai reprogramming vectors (Beers, et al., 2015). Induced PSC lines were then cultured on Matrigel (Corning) coated 6-well plates in StemFlex medium (Gibco) in a humidified 5% CO₂ atmosphere at 37 °C. The iPSCs were passaged with 0.5 mM EDTA (Gibco) when cultures reached 70% confluency and at a 1:5 to 1:10 split ratio. After the first three passages, iPSCs were culture on and adapted to vitronectin (Gibco) coated 6-well plates in Essential 8 (E8; Gibco) medium for 7–8 passages. At each passage, cell culture media was supplemented with CEPT. The iPSCs were cryopreserved using E8 medium supplemented with 10% DMSO and CEPT.

4.2. Immunocytochemistry

The iPSCs were fixed with 4% paraformaldehyde in DPBS for 10 min at room temperature (RT). Cells were permeabilized and blocked with 0.1% Triton X-100 and 5% Bovine Serum Albumin in DPBS (Perm-Block Buffer) for 1 h at RT. All staining was performed in Perm-Block Buffer. Samples were then incubated with primary antibodies overnight at 4 °C and secondary antibodies in dark for 2 h at RT (Table 2). Nuclei were stained with 5 ng/ml Hoechst 33,342 (Thermo Fisher) diluted in DPBS for 10 min. Images were obtained with a Leica epifluorescence microscope.

4.3. Quantitative RT-PCR

Total RNA was extracted from iPSCs using the RNeasy Mini Kit (Qiagen) on a QIAcube Connect (Qiagen) and reverse transcribed into complementary DNA using the High-capacity RNA-to-cDNA Kit (Applied Biosystems). Predesigned PrimeTime Probe-based qPCR assays (IDT) (Table 2) were used to quantify gene expression using a QuantStudio 12 K Flex system (Applied Biosystems).

4.4. Mycoplasma detection

Detection of mycoplasma was performed using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza) using an aliquot of spent cell culture medium.

4.5. Sendai virus detection

After 7 to 13 passages on vitronectin-coated plates in E8 media, total RNA was extracted using the RNeasy Mini Kit (Qiagen) on a QIAcube Connect (Qiagen). RNA (500 ng) was reverse transcribed into complementary DNA using the High-capacity RNA-to-cDNA Kit (Applied Biosystems). The Platinum SuperFi PCR Master Mix (Invitrogen) as used to amplify SEV, c-Myc, KOS and KLF4 target sequences, multiplexed with GAPDH as an internal control using the appropriate primers (Table 2) and the PCR program: 98 °C for 2 min, 35 cycles of 98 °C for 10 s, 60 °C for 10 s, 72 °C for 30 s, followed by 72 °C for 5 min on a C1000 Touch Thermal Cycler (Bio-Rad).

4.6. Mutation validation

Mutations at the HEXA and HEXB genes were verified by Sanger sequencing, following isolation of amplified PCR products generated using the appropriate primers for each gene (Table 2).

4.7. Short tandem repeat (STR) and karyotype analysis

STR analysis was performed by Cell Line Genetics (Madison, WI) using the GenePrint 24 system (Promega) with a five-dye profile of 23 STR loci and Amelogenin. High resolution karyotype analysis was performed by Cell Line Genetics (Madison, WI) using a SurePrint G3 (Agilent) human comparative genomic hybridization (CGH) 8X60K array.

4.8. Directed differentiation (Ectoderm, Mesoderm, endoderm and Hypothalamic neurons)

For differentiation into ectoderm and mesoderm, cells were plated onto VTN-coated plates at 5 × 10⁴ cells/cm² in E8 supplemented with CEPT. For differentiation into ectoderm, when 70% confluent, medium was changed to E6 with 100 nM LDN-193189 and 2 μM A83–01 and maintained with daily media changes until day 7, when assayed. For mesoderm and endoderm, cells were differentiated using mesoderm induction medium (STEMCELL Technologies), or the definitive endoderm kit (STEMCELL Technologies), according to the manufacturer’s protocol until assayed on day 5.

4.9. Western blot

For Western blot cells were pelleted and by lysed by sonication in RIPA Buffer (Thermo Scientific) supplemented with Halt protease inhibitor cocktail (Thermo Scientific). Western blotting was performed using a Wes capillary system (ProteinSimple) and antibodies specified in Table 2.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2026.103949. Supplementary Fig. 1. (A) RT-qPCR analysis demonstrates that all generated iPSC lines express OCT4, SOX2 and NANOG at levels comparable to previously established iPSC line LiPSC GR1.1 and below SOX2 expression levels of LiPSC GR1.1 line differentiated to ectoderm. (B) RT-PCR analysis of Sendai virus clearance at passage 10–13, using primers for SeV, c-Myc, KOS and Klf-4 in multiplex with GAPDH demonstrate that all iPSC lines were free of Sendai virus when compared to cells at passage 3 post viral transduction. (C) Immunocytochemistry of cells directed to differentiate into ectoderm (PAX6), mesoderm (Brachyury) and endoderm (SOX17). Scale bar is 75 μm.

Data availability

Data will be made available on request.