Mesenchymal stem cells inhibited chronic myeloid leukemia cells in vitro, correlating with oxidative stress

Abstract

Background

Chronic myeloid leukemia (CML) originates from bone marrow, and its progression to blast crisis phase is a primary cause of poor prognosis in patients. Investigating its underlying mechanisms may help improve patient survival.

Methods

Optical microscopy and Cell Counting Kit-8 assays were utilized to observe and assess the viability of K562 cells (human cells derived from CML) treated with or without mesenchymal stem cell (MSC)-conditioned medium. Flow cytometry was employed to assess apoptosis and cell cycle changes. Intracellular reactive oxygen species (ROS) were assessed utilizing a 2’,7’-dichlorofluorescin diacetate probe. Antioxidant enzymes (total superoxide dismutase [T-SOD], catalase [CAT], glutathione peroxidase [GSH-Px]) and malondialdehyde (MDA), a marker of lipid peroxidation and oxidative stress, were measured using relevant assay kits. Western blotting was performed to evaluate inflammation-related proteins (nuclear factor erythroid 2-related factor 2 [Nrf2], inhibitor of nuclear factor kappa B alpha [IκBα]), and reverse transcription quantitative polymerase chain reaction (RT-qPCR) was utilized to assess expression of inflammatory cytokines (interleukin [IL]-6, IL-1β, IL-4, IL-10). All experiments were repeated three times, and the data were presented in mean form. Welch t-test was used to compare the treatment group and the control group.

Results

Compared with K562 cells without MSC-conditioned medium treatment, those cultured with MSC-conditioned medium exhibited significantly inhibited proliferation. The K562 cells treated with MSC-conditioned medium showed increased apoptosis compared with untreated cells (11.34% vs. 2.93%, P<0.0001) and cell cycle arrest (17.54% vs. 11.00%, P = 0.0007). Additionally, the K562 cell group with MSC-conditioned medium treatment elevated intracellular ROS levels (9.34% vs. 2.43%, P = 0.0002) in K562 cells. Oxidative stress factor analysis revealed decreased T-SOD (3.82 vs. 6.89, P = 0.0023), CAT (21.43 vs. 34.36, P = 0.0025), and GSH-Px (3.42 vs. 6.88, P = 0.0088) levels alongside increased MDA (6.29 vs. 3.30, P = 0.0009) in K562 cell group with MSC-conditioned medium treatment. Inflammatory protein assessment demonstrated reduced Nrf2 (0.46 vs. 1.00, P = 0.0017) and IκBα (0.71 vs. 1.00, P = 0.0002) levels in the K562 cell group with MSC-conditioned medium treatment. IL-6 (2.14 vs. 1.00, P<0.0001) and IL-1β (2.21 vs. 1.00, P<0.0001) were upregulated, whereas IL-4 (0.52 vs. 1.00, P<0.0001) and IL-10 (0.39 vs. 1.00, P<0.0001) were downregulated.

Conclusion

MSC-conditioned medium inhibited K562 cell growth concomitant with increased oxidative stress and altered inflammatory responses.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12957-026-04348-w.

Background

Chronic myeloid leukemia (CML) originates in the bone marrow, with an incidence of approximately 1–2 cases per 100,000 adults per year, accounting for about 15% of new adult leukemia cases [1, 2]. Its pathological features include the abnormal accumulation of malignant immature myeloid white blood cells in bone marrow, which further infiltrate the peripheral blood and other tissues and organs. CML cells exhibit differentiation dysfunction during tumor progression, leading to damage to multiple biological processes [3]. CML pathogenesis is closely associated with the BCR-ABL fusion protein. This fusion protein results from a specific translocation between chromosomes 9 and 22, forming the Philadelphia chromosome, which generates an abnormal fusion on cokinase in hematopoietic progenitor cells [4, 5]. Moreover, this fusion protein has tyrosine kinase activity and can cause abnormal activation of multiple signaling pathways [6]. In the early stage (chronic phase) of CML, although the number of bone marrow cells increases significantly, cellular differentiation remains intact. However, without timely and effective treatment, the disease eventually progresses to the aggressive blast phase, resulting in a poor prognosis [7].

Mesenchymal stem cells (MSCs) possess robust proliferative and multilineage differentiation potential and are key components of the bone marrow microenvironment, playing a dual role in cancer progression [8]. Extracellular vesicles derived from MSCs inhibit the growth of cancer cells in vitro by increasing their sensitivity to drugs [9]. A study demonstrated that MSCs exert anti-proliferative and pro-apoptotic effects on K562 cells (human cells derived from CML) [10]. However, the vesicles secreted by MSCs can promote the growth and metastasis of a variety of cancer cells (kidney cancer, lung cancer, breast cancer) in the co-culture system [11]. Different functions highlighted the context-dependent nature of MSC-cancer interactions. In CML, the exact mechanisms have not been fully explored. Our study aimed to explore the potential role of MSCs in the pathological progression of leukemia.

Oxidative stress plays a complex and critical role in cellular physiological and pathological processes. In CML, the role of oxidative stress is particularly noteworthy. Oxidative stress is an imbalance between the accumulation of reactive oxygen species (ROS) and the capacity of antioxidant systems to neutralize them, leading to disrupted intracellular redox homeostasis. This imbalance causes damage to lipids, proteins, and DNA, impairing cellular function and survival. In CML, oxidative stress has a dual role: ROS promotes CML development by inducing DNA damage and genomic instability; however, excessive ROS may trigger apoptosis or senescence in CML cells, thereby suppressing disease progression [12]. ROS serves as a redox imbalance marker and signaling molecule that amplifies cellular stress responses by inducing pro-inflammatory factors [13]. Exploiting oxidative stress mechanisms to inhibit CML cells has emerged as a recent research focus. For example, imatinib (IM), the first-line treatment for CML, increases oxidative stress and promotes DNA damage in IM-sensitive CML cells [14]. Therefore, elucidating the regulatory mechanisms of oxidative stress and its specific impact on the CML microenvironment is crucial for optimizing therapeutic strategies.

We treated K562 cells with MSC-conditioned medium to simulate the interaction between MSCs and K562 cells. It is important to elucidate whether MSC-conditioned medium inhibits or promotes K562 cell growth, whether it increases or decreases oxidative stress, and how it alters inflammatory responses. Our study provides a theoretical foundation for developing MSC-targeted CML treatment strategies.

Materials and methods

Experimental repetition

To investigate the effects of MSCs on CML cells and the underlying mechanisms, we employed an in vitro co-culture system using MSC-conditioned medium and K562 CML cells. Our study integrated multiple analytical approaches to assess cell proliferation, apoptosis, cell cycle progression, oxidative stress markers, and inflammatory responses. The experimental workflow consisted of: (1) preparation and application of MSC-conditioned medium to K562 cells; (2) evaluation of K562 cell viability and growth kinetics; (3) analysis of apoptosis and cell cycle distribution by flow cytometry; (4) measurement of intracellular ROS and key antioxidant enzyme activities; and (5) examination of inflammatory protein and cytokine expression levels (Fig. 1). Details of each methodological component are provided below.

Fig. 1.

Illustrative diagram of the materials and methods section. CAT: catalase; CCK-8: Cell Counting Kit-8; GSH-Px: glutathione peroxidase; IκBα: inhibitor of nuclear factor kappa B alpha; IL: interleukin; MDA: malondialdehyde; MSCs: mesenchymal stem cells; Nrf2: nuclear factor erythroid 2-related factor 2; ROS: reactive oxygen species; RT-qPCR: reverse transcription quantitative polymerase chain reaction; T-SOD: total superoxide dismutase

Based on the basic norms of biological research and the practical needs of this study, all experiments were independently repeated three times. The independent replicates of this study adopted the following criteria: cells from different passages or frozen batches were used for each replicate; the complete process from cell culture, conditioned medium preparation, to indicator detection was performed on at least three different dates, rather than just setting multiple technical replicates in the same process.

Cell culture

Human cells derived from CML K562 cells (CL-0130) and bone marrow-derived MSCs (CP-H166) were purchased from Procell (China). K562 cells were maintained in Iscove’s Modified Dulbecco’s Medium complete medium with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, while MSCs were cultured using Procell’s specialized medium (CM-H166Y). All cells were kept in a 37 °C, 5% CO₂ incubator (Thermo Fisher, USA). FBS and antibiotics were purchased from Gibco (USA).

For co-culture experiments, K562 cells were cultivated in MSC-conditioned medium at 37 °C with 5% CO₂. MSCs in passages 3–5 (P3-P5) were used. After the cells grew to 80–90% fusion, the original culture medium was discarded and washed twice with phosphate-buffered saline (PBS) to remove residual serum. 10 mL of fresh MSC-specific serum-free culture medium was added. After 24 h of cultivation, we collected the supernatant, centrifuged it at 400 × g for 10 min to remove cell debris, and then filtered it through a 0.22 μm sterile filter for sterilization. The filtrate was the MSC-conditioned medium and was used immediately. Co-culture durations were set at 24, 48, 72, and 96 h, after which cells were photographed via optical microscope. The control group was treated with an equal volume of unused MSC-specific culture medium.

Cell counting kit (CCK)-8

Cell viability was tested with CCK-8 Cell Viability Assay Kit (Beyotime, C0037, China). After treatment, 10 µL CCK-8 solution was added to each well of the 96-well plate at 24, 48, 72, and 96 h. After 4 h of incubation, absorbance at 450 nm was tested via a microplate reader.

Apoptosis detection

Cells were seeded in 6-well plates (5 × 10⁵ /well) and treated as required. Apoptosis was tested with annexin V- fluorescein isothiocyanate (FITC)/ propidium iodide (PI) Apoptosis Detection Kit (Beyotime, C1062S, China). Collected cells were resuspended in annexin V-FITC binding buffer, followed by the addition of 5 µL annexin V-FITC and 10 µL PI solution. Following gentle mixing and 10 min-incubation in the dark at room temperature, apoptosis was analyzed via flow cytometer (Agilent, USA).

Cell cycle analysis

Cell cycle distribution was tested with Cell Apoptosis/Cell Cycle Detection Kit (Beyotime, C1052, China). Collected cells were fixed in 70% pre-cooled ethanol for 30 min. Following rinsing twice with PBS and centrifugation, cells were resuspended in PI solution containing ribonuclease A and incubated in the dark for 30 min. Cell cycle distribution was assessed via a flow cytometer.

Intracellular ROS detection

We monitored intracellular ROS production using the dichlorofluorescin diacetate (DCFH-DA) probe and analyzed the effects of MSC-conditioned medium treatment on ROS levels in K562 cells. ROS levels were tested with the ROS Assay Kit (Beyotime, S0034S, China). After treatment, the culture medium was discarded, and cells were treated with 10 µM DCFH-DA at 37 °C for 20 min. Following rinsing twice with PBS, ROS levels were detected via flow cytometer at excitation/emission wavelengths of 488 nm/525 nm.

Assessment of total superoxide dismutase (T-SOD) activity

T-SOD is one of the antioxidant enzymes, and its activity was tested with the T-SOD Activity Assay Kit (Beyotime, S0101S, China). Cells were lysed, and the supernatant was collected for analysis. Test samples and assay buffer were added, followed by 160 µL water-soluble tetrazolium salt (WST)-8 /enzyme working solution and 20 µL reaction initiation working solution. After incubation at 37 °C for 30 min, absorbance at 450 nm was assessed via a microplate reader.

Measurement of glutathione peroxidase (GSH-Px) enzyme activity

GSH exists in nearly every cell and functions as an antioxidant. GSH-Px catalyzes the reduction of hydrogen peroxide by GSH. GSH-Px activity was measured with the GSH-Px Assay Kit (Beyotime, S0057, China). Cells were lysed and centrifuged, and the supernatant was collected. Assay buffer, GSH, sample, and peroxide reagent solutions were sequentially added and incubated at 25°C for 15 min. 5,5’-Dithiobis-(2-nitrobenzoic acid) solution was added, mixed, and incubated at 25 °C for 10 min. Absorbance at 412 nm was assessed via a microplate reader.

Assessment of catalase (CAT) enzyme activity

CAT resides in cellular peroxisomes and represents a key member of the antioxidant enzyme system. CAT activity was assessed with Catalase Assay Kit (Beyotime, S0051, China). Cell samples were homogenized and centrifuged, and 20 µL of supernatant was mixed with 10 µL of 250 mM H₂O₂ solution and 20 µL CAT assay buffer. After thorough mixing, the reaction proceeded at 25 °C for 3 min, followed by adding 450 µL CAT reaction stop solution and inversion mixing. In a clean plastic centrifuge tube, 40 µL CAT assay buffer was mixed with 10 µL terminated reaction mixture, followed by adding 200 µL chromogenic working solution. Following incubation at 25 °C for 15 min, absorbance at 520 nm was measured via a microplate reader (Thermo Fisher, USA).

Measurement of malondialdehyde (MDA) content

MDA, an important product of lipid peroxidation, can exert toxic effects on cells when accumulated. MDA content was determined with the MDA Assay Kit (Beyotime, S0131S, China). Cells were lysed on ice and centrifuged at 4 °C for 10 min. Supernatant was carefully collected, and 100 µL sample was mixed with 200 µL MDA detection working solution. After boiling for 15 min and cooling to room temperature, the mixture was centrifuged at 1000 × g for 10 min. 200 µL supernatant was transferred to a 96-well plate, and absorbance at 532 nm was tested via a microplate reader.

Western blotting

Western blotting was used to detect the protein expression of nuclear factor erythroid 2-related factor 2 (Nrf2), nuclear factor kappa B alpha (IκBα), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Among them, Nrf2 and IκBα are inflammation-related proteins. GAPDH was used as an internal reference. Total proteins were isolated with the Total Protein Extraction Kit (Solarbio, BC3710, China). Extracted protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride. After sealing with skim milk, membranes were incubated overnight at 4 °C with primary antibodies, including anti-Nrf2 (Proteintech, 16396-1-AP, USA), anti-IκBα (Proteintech, 10268-1-AP, USA), and anti-GAPDH (Proteintech, 10494-1-AP, USA). Membranes were rinsed and incubated with a secondary IgG antibody (Proteintech, SA00001-2, USA) for 2 h. Protein bands were detected utilizing BeyoECL Plus (Ultra-sensitive ECL Chemiluminescence Kit) (Beyotime, P0018S, China) and chemiluminescence imaging system (Clinx, China).

Extraction of mRNA and reverse transcription quantitative polymerase chain reaction (RT-qPCR)

To evaluate the expression of pro-inflammatory cytokines (interleukin [IL]-6 and IL-1β) and anti-inflammatory cytokines (IL-4 and IL-10), we used the RT-qPCR method for detection. Cells were lysed using Trizol reagent (Solarbio, R1100, China), and the lysate was transferred to a 1.5 mL centrifuge tube. mRNA extraction was performed by sequential addition of chloroform, isopropanol, and 75% ethanol. After centrifugation, the supernatant was discarded, and the pellet was air-dried and dissolved in diethyl pyrocarbonate-treated water. Total mRNA concentration and purity were tested with a Nanodrop spectrophotometer (Thermo Fisher, USA). Reverse transcription was performed with HiScript IV RT kit (Vazyme, R433-01, China), and the synthesized complementary DNA was stored at − 20 °C for further use.

The qPCR reaction system was prepared with Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712-02, China). GAPDH was an internal reference gene. Amplification was conducted on ABI 7500 Real-Time PCR System (Thermo Fisher, USA). Relative expression was computed by 2^-ΔΔCt. Primer sequences are detailed in Table 1.

Table 1.

Primers’ information

Genes	Primers (5’—3’)
IL-6-F	TCCACAAGCGCCTTCGGTC
IL-6-R	GGGGCGGCTACATCTTTGGA
IL-1β-F	AGAAGTACCTGAGCTCGCCA
IL-1β-R	TCCTGGAAGGAGCACTTCATCT
IL-4-F	TTTGCTGCCTCCAAGAACAC
IL-4-R	TGTCGAGCCGTTTCAGGAAT
IL-10-F	GGGCACCCAGTCTGAGAA
IL-10-R	GCAACCCAGGTAACCCTTAAAGT
GAPDH-F	AATGGGCAGCCGTTAGGAAA
GAPDH-R	GCCCAATACGACCAAATCAGAG

F forward, GAPDH glyceraldehyde-3-phosphate dehydrogenase, IL interleukin, R reverse

Statistical analysis

Results are presented as mean (standard deviation). Data were processed and visualized on GraphPad Prism 8.0. Statistical significance was assessed by a two-tailed Welch’s t-test. P < 0.05 meant statistically significant.

Results

MSCs inhibited K562 cell proliferation

K562 cells grew in suspension, appearing round or oval with cell aggregation. Compared with the K562 cell group without MSC-conditioned medium treatment, the number of K562 cells in the K562 cell group with MSC-conditioned medium was significantly decreased (Fig. 2A). CCK-8 assay revealed that MSC-conditioned medium treatment for 48 and 72 h significantly decreased K562 cell viability compared with the K562 cell group without MSC-conditioned medium treatment (Fig. 2B and Table 2). MSCs repressed K562 cell proliferation.

Fig. 2.

Mesenchymal stem cells (MSCs) inhibited K562 cell proliferation. A Observation of the morphological changes of K562 cells under different treatment times (24, 48, 72, 96 h) using an optical microscope. Compared with the K562 cell group without MSC-conditioned medium treatment, the group with MSC-conditioned medium treatment showed a significant decrease in cell density and a reduction in cell aggregation. B Cell viability of K562 cells analyzed by Cell Counting Kit (CCK)-8. After 48 and 72 hours of MSC-conditioned medium treatment, the viability of K562 cells significantly decreased (OD: optical density, h: hour). Statistical analyses were performed to compare mean values between the K562 cell group with MSC-conditioned medium treatment and the group without MSC-conditioned medium treatment. *P < 0.05, the values represent the mean of three experiments, error bars indicate standard deviations

Table 2.

Mean (standard deviation) optical density (absorbance at 450 nm) values for cell viability of K562 cells measured using the Cell Counting Kit-8 (CCK-8) assay

	K562	K562 with MSCs	P valuea
24 hours	0.32 (0.02)	0.34 (0.03)	0.3911
48 hours	0.53 (0.04)	0.41 (0.05)	0.0315
72 hours	0.68 (0.07)	0.52 (0.06)	0.0397
96 hours	0.78 (0.12)	0.66 (0.08)	0.2230

MSC mesenchymal stem cell

Values are presented as means (standard deviations) or P values

^aComputed using Welch’s t-test

MSCs induced K562 apoptosis and inhibited cell cycle progression

As depicted in Fig. 3A and B, the apoptosis rate of K562 cells with MSC-conditioned medium treatment significantly increased from 2.93% (standard deviation, 0.32%) to 11.34% (0.38%) (P<0.0001) (Table 3). Compared with the K562 cell group without treatment, the proportion of G1 phase (pre-DNA synthesis, cell growth, and metabolic activity phase) cells decreased in the group with MSC-conditioned medium treatment, while the proportion of G2/M phase (preparation phase from DNA replication completion to mitosis) cells increased significantly (Fig. 3C-D) (Table 3). MSCs induced cell cycle arrest and apoptosis in K562 cells.

Fig. 3.

Mesenchymal stem cells (MSCs) induced apoptosis and inhibited cell cycle progression in K562 cells. A-B Apoptosis of K562 cells detected by annexin V- fluorescein isothiocyanate (FITC)/propidium iodide (PI) staining. The upper left quadrant (Q1) represents necrotic cells, the upper right quadrant (Q2) represents late apoptotic cells, the lower right quadrant (Q3) represents early apoptotic cells, and the lower left quadrant (Q4) represents live cells. The apoptosis rate was defined as the sum of Q2 and Q3. C-D Cell cycle distribution of K562 cells analyzed by flow cytometry. The K562 cell group with MSC-conditioned medium treatment showed a significant decrease in G1 phase cells, a significant increase in G2/M phase cells, and cell arrest in the G2/M phase. Statistical analyses were performed to compare mean values between the K562 cell group with MSC-conditioned medium treatment and the group without MSC-conditioned medium treatment. *P < 0.05, the values represent the mean of three experiments, error bars indicate standard deviations

Table 3.

Mean (standard deviation) values obtained in the present experiments

	K562	K562 with MSCs	P valuea
Apoptosis rateb (%)	2.93 (0.32)	11.34 (0.38)	<0.0001
Cell cycle distributionc (%)
G0/G1	53.71 (0.46)	47.97 (0.74)	0.0003
S	33.30 (0.33)	32.58 (0.28)	0.0449
G2/M	11.00 (0.92)	17.54 (0.78)	0.0007
ROS levelc (%)	2.43 (0.33)	9.34 (0.81)	0.0002
T-SODd (U/mg)	6.89 (0.57)	3.82 (0.52)	0.0023
GSH-Pxd (U/mg)	6.88 (1.16)	3.42 (0.48)	0.0088
CATd (U/mg)	34.36 (2.58)	21.43 (2.09)	0.0025
MDAd (µM/mg)	3.30 (0.36)	6.29 (0.46)	0.0009
Relative protein expression levele
Nrf2	1.00 (0.11)	0.46 (0.06)	0.0017
IκBα	1.00 (0.09)	0.71 (0.03)	0.0061
Relative mRNA expression levelf
IL-6	1.00 (0.07)	2.14 (0.07)	<0.0001
IL-1β	1.00 (0.03)	2.21 (0.08)	<0.0001
IL-4	1.00 (0.04)	0.52 (0.02)	<0.0001
IL-10	1.00 (0.06)	0.39 (0.01)	<0.0001

CAT catalase, GSH-Px glutathione peroxidase, IL interleukin, IκBα inhibitor of nuclear factor kappa B alpha, MDA malondialdehyde, MSC mesenchymal stem cell, Nrf2 nuclear factor erythroid 2-related factor 2, ROS reactive oxygen species, T-SOD total superoxide dismutase

Values are presented as means (standard deviations) or P values

^aComputed using Welch’s t-test

^bSum of the percentages of Q2 and Q3 in Fig. 1A, determined by Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) staining

^cDetermined by flow cytometry

^dMeasured using each assay kit

^eRatios of the expression of each protein to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), analyzed by Western blotting

^fRatios of the expression of each mRNA to GAPDH, determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR)

MSCs induced oxidative stress in K562 cells

MSC-conditioned medium treatment significantly enhanced ROS levels in K562 cells (Fig. 4A and B) (Table 3). The results for T-SOD showed a significantly reduced level in the K562 cell group with MSC-conditioned medium treatment (Fig. 4C) (Table 3). Detection of GSH-Px activity in K562 cells revealed downregulated activity in the K562 cell group with MSC-conditioned medium treatment (Fig. 4D) (Table 3). K562 cells with MSC-conditioned medium treatment similarly significantly reduced CAT levels (Fig. 4E) (Table 3). Following conditioned medium treatment, MDA content increased significantly (Fig. 4F) (Table 3). MSCs disrupted the redox balance in K562 cells and induced oxidative stress.

Fig. 4.

Mesenchymal stem cells (MSCs) induced oxidative stress in K562 cells. A and B Reactive oxygen species (ROS) levels in K562 cells detected by flow cytometry. A stronger intensity of dichlorofluorescein diacetate (DCFH-DA) indicated a higher ROS content. C Total superoxide dismutase (T-SOD) content measured by assay kit. D Glutathione peroxidase (GSH-Px) enzyme activity analyzed by a detection kit. E Catalase (CAT) enzyme content determined by test kit. F Malondialdehyde (MDA) content assessed by commercial kit. Statistical analyses were performed to compare mean values between K562 cell group with MSC-conditioned medium treatment and the group without MSC-conditioned medium treatment. *P < 0.05, the values represent the mean of three experiments, error bars indicate standard deviations

MSCs induced inflammatory response in K562 cells

Detection of classical inflammatory pathway markers (Nrf2 and IκBα) in K562 cells revealed significant downregulation of Nrf2 and IκBα protein expression in the MSC-conditioned medium treatment group (Fig. 5A and B) (Table 3). RT-qPCR analysis of inflammatory cytokine levels demonstrated significantly increased mRNA IL-6 and IL-1β expression, along with significantly lowered mRNA IL-4 and IL-10 expression in K562 cells with MSC-conditioned medium treatment (Fig. 5C) (Table 3). MSCs induced an inflammatory response in K562 cells.

Fig. 5.

Mesenchymal stem cells (MSCs) induced inflammatory response in K562 cells. A and B Western blotting analysis of nuclear factor erythroid 2-related factor 2 (Nrf2) and inhibitor of nuclear factor kappa B alpha (IκBα) protein expression. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is used as an internal reference, and the quantitative analysis of band density is shown in the figure (B). C Reverse transcription quantitative polymerase chain reaction (RT-qPCR) detection of inflammatory cytokines (interleukin [IL]-6, IL-1β, IL-4, IL-10) mRNA expression levels. The expression of pro-inflammatory factors IL-6 and IL-1 β was significantly upregulated, while the expression of anti-inflammatory factors IL-4 and IL-10 was significantly reduced. Statistical analyses were performed to compare mean values between the K562 cell group with MSC-conditioned medium treatment and the group without MSC-conditioned medium treatment. *P < 0.05, the values represent the mean of three experiments, error bars indicate standard deviations

Discussion

We experimentally demonstrated that MSC-conditioned medium treatment significantly inhibited K562 cell proliferation, and promoted apoptosis and cell cycle arrest. These findings support the potential inhibitory role of MSCs in CML pathogenesis. MSC-conditioned medium treatment suppressed antioxidant indicators (CAT, GSH-Px, and T-SOD) while increasing MDA and ROS levels in K562 cells. Concurrently, inflammation-related proteins (Nrf2 and IκBα) showed significantly reduced expression. Regarding inflammatory cytokines, mRNA expression of pro-inflammatory cytokines IL-6 and IL-1β was significantly upregulated, whereas anti-inflammatory factors IL-4 and IL-10 expression was downregulated.

Current research on MSC function in CML remains highly controversial. MSCs can either support or inhibit tumor progression through paracrine signaling via MSC-derived extracellular vesicles [11]. Some studies suggest tumor-promoting properties of MSCs through microenvironment remodeling that enhances cancer cell survival and drug resistance. For example, in the pancreatic tumor microenvironment, after receiving tumor cell signals, the Fas receptor (CD95) on the surface of MSCs needs to reach a specific activation threshold (Fas threshold) to start downstream signal transduction [15]. This process promotes the secretion of IL-1 (IL-1α and IL-1β) by MSCs, and then continues to produce metastasis-promoting cytokines C-C motif chemokine ligand 2 and IL-6, ultimately promoting the progression and metastasis of pancreatic cancer. However, accumulating evidence favors the anti-tumor effects of MSCs. For example, exosomes derived from human bone marrow MSCs (hBM-MSC-Exo) and human umbilical cord MSCs (hUC-MSC-Exo) contain tumor-suppressive microRNAs (miRNAs; e.g., miR-3940-5p, miR-22-3p, and miR-16-5p), which inhibit colorectal cancer cell progression via the ras-related protein 2B /phosphatidylinositol 3-kinase (PI3K)/Akt pathway and integrin subunit alpha 2/6 (ITGA2/ITGA6) [16]. MSC-secreted IL-6, IL-8, and transforming growth factor-β lower telomerase activity in leukemia cells through Wnt5a/β-catenin and p53 pathways, increasing K562 cell death [17]. Although there have been studies reporting the inhibitory effect of MSCs on K562 cells [17], there are still three key knowledge gaps in existing research: Firstly, the specific mechanism by which MSCs induce apoptosis in K562 cells, especially the systemic changes in oxidative stress-related molecular pathways, have not been fully elucidated; Secondly, there are conflicting phenotypes regarding the immunomodulatory effects of MSCs in the tumor microenvironment, and there is no consensus on whether they play a pro-inflammatory or anti-inflammatory role in CML; Finally, the role of the interaction between oxidative stress and inflammatory response in MSC mediated anti-leukemia effects is still unclear.

Prior research indicates a close association between oxidative stress and CML progression. Excessive ROS accumulation disrupted cellular redox homeostasis, triggering DNA damage, genomic instability, and cell death [18]. Oxidative stress levels correlated with CML malignant phenotypes. A study reports that drug-resistant CML cells exhibited significantly lower ROS levels than sensitive counterparts [19]. Several CML therapeutics, including nilotinib and Nepenthes ethyl acetate extract, exert their effects by inducing oxidative stress [20]^, [21]. Our data showed that MSC-conditioned medium treatment suppressed antioxidant components while increasing ROS in K562 cells, suggesting that MSCs disrupt redox balance to induce oxidative stress. However, precise mechanisms require elucidation.

Intimate crosstalk between oxidative stress and inflammatory responses likely plays important roles in MSC-K562 interactions. As mentioned earlier, ROS serves as a redox imbalance marker and signaling molecule that amplifies cellular stress responses by inducing pro-inflammatory factors [13]. Our study found that the expression of pro-inflammatory cytokines IL-6 and IL-1β was upregulated after MSC-conditioned medium treatment, indicating that MSCs increase inflammation levels by activating inflammatory pathways. It is worth noting that in leukemia biology, similar inflammatory amplification effects have been shown to induce tumor cell death. For example, Nepenthes ethyl acetate extract inhibited cell proliferation and induced apoptosis by triggering oxidative stress in leukemia cells [21]. This pro-inflammatory pattern contrasted with classical anti-inflammatory MSC phenotypes [22]. Although our study demonstrated a temporal correlation between increased ROS, downregulation of Nrf2/IκBα, and apoptosis, a strict causal relationship could not be established. This could be due to several possibilities: (1) MSC-conditioned medium may independently regulate oxidative stress and apoptosis through distinct pathways, rather than a linear cause-and-effect relationship; (2) ROS-mediated feedback inhibition of the Nrf2 pathway may create a bidirectional regulatory loop, complicating the causal inference. Therefore, the core mediating role of oxidative stress needs to be validated through intervention experiments such as ROS clearance and gene editing. The descriptive findings of our study provided a theoretical basis for further mechanism exploration. While our study suggests the existence of an oxidative stress-inflammation axis, its detailed molecular mechanism warrants investigation.

However, limitations exist. (1) In vitro models cannot fully replicate in vivo complexity; (2) molecular pathways connecting ROS accumulation to apoptosis and cell cycle regulation remain unclear; (3) in vitro validation and identification of active components in MSC-conditioned medium are needed.

In summary, our work provides a theoretical foundation for MSC-based CML therapies, particularly regarding oxidative stress and inflammation modulation. Studies can focus on mechanistic elucidation and clinical translation in the future.

Abbreviations

MSCs

Mesenchymal stem cells

CML

Chronic myeloid leukemia

CCK-8

Cell Counting Kit-8

ROS

Reactive oxygen species

DCFH-DA

Dichlorofluorescin diacetate

T-SOD

Total superoxide dismutase

CAT

Catalase

GSH-Px

Glutathione peroxidase

MDA

Malondialdehyde

Nrf2

Nuclear factor erythroid 2-related factor 2

IκBα

Inhibitor of nuclear factor kappa B alpha

qPCR / RT-qPCR

reverse transcription quantitative polymerase chain reaction

IL

Interleukin

FBS

Fetal bovine serum

PBS

Phosphate-buffered saline

ECL

Enhanced chemiluminescence

PI

Propidium iodide

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

IM

Imatinib

FITC

Fluorescein isothiocyanate

Authors' contributions

Yuhan Zheng, Cong Shi and Ying Chen were major contributors in writing the original draft. Binbin Lai, Hao Wu and Lixia Sheng prepared figures and tables. Guifang Ouyang, Xiao Yan and Qunfang Ge revised the manuscript. All authors contributed to the article and approved the submitted version.

Funding

This work was supported by the National Natural Science Foundation of China (Grant No. 82400170), the Zhejiang Provincial Medical Science and Technology Project (Grant No. 2025KY1329), and the Science and Technology Planning Project of Medicine and Public Health in Zhejiang Province (Grant No. 2023KY252).The funders had no role in the study design, data collection, analysis, or manuscript approval.

Data availability

The data supporting our study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

Since the manuscript does not report on or involve the use of any animal or human data or tissue, ethical approval and consent were not required for this study in accordance with local or national guidelines.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.