ABSTRACT
Background
Gonadotropins are glycoprotein hormones that are often secreted from the gonadotrope cells of the pituitary gland. These hormones play an essential role in growth, reproduction and sexual function.
Aims
Therefore, this research was conducted to identify genetic polymorphisms of the Gonadotropin‐Releasing Hormone Receptor (GnRHR) gene on Isfahan native hen traits and their relationship with production traits.
Materials & methods
For this purpose, blood was taken from 100 Isfahan native hens that were randomly selected from the Isfahan native hen centre. DNA was extracted by the phenol‐chloroform method. Then, using the designed primers, the target fragment was amplified and directly sequenced. The sequences were blasted with the reference gene in NCBI. After analysing the sequences, the relationship between genotypes and traits was investigated.
Results
The results showed that five single‐nucleotide polymorphisms in gene GNRHR were observed. These polymorphisms were located in nucleotides numbers 117, 123, 157, 453 and 550 of the amplified fragments and caused the change of nucleotide T to C, C to T, C to T, C to T and A to G, respectively. According to the results, the GnRHR gene has an acceptable effect on the productive traits of Isfahan native hens. Of course, its effect cannot be considered important for the entire production traits, but in the sexual maturity sections, the number of eggs plays an important role and has a significant effect on the mentioned production traits.
Conclusion
These results show that the observed nucleotide changes if confirmed in other relevant studies can be used in the trait selection programme with the help of markers.
This research was conducted to identify genetic polymorphisms of the GNRHR gene on Isfahan native hen traits and their relationship with production traits. For this purpose, blood was taken, DNA was extracted, the target fragment was amplified and directly sequenced, and finally it was blasted with the reference gene in NCBI. Five single‐nucleotide polymorphisms in gene GNRHR were observed. According to the results, the gonadotropin‐releasing hormone receptor gene has an acceptable effect on the productive traits of Isfahan native hens.
1. Introduction
Reproduction is an important aspect of poultry breeding and is closely related to economic benefits. However, egg‐laying performance is the most important aspect of poultry production in hens; additionally, it determines the reproductive performance of breeding hens (Zhang et al. 2005). In poultry production, the age at first egg (AFE), body weight at first egg (BWF), first egg weight (FEW), egg weight (EW), numbers (EN) and production (EP), laying rate (LR), egg quality (EQ), such as eggshell weight (ESW), eggshell thickness (EST), eggshell colour (ESC), eggshell strength (ESS), egg shape index (ESI), yolk weight (YW), Haugh unit (HU) are important parameters. Broody traits (BT), such as broody frequency (BF) and duration of broodiness (DB), and ovarian follicles (OF), are included in breeding programmes for hens (Khajeali et al. 2012). All these parameters are mainly regulated by genetic and endocrine factors and are valuable indices of egg‐laying performance (Azmal et al. 2019). EP is an important economic trait in poultry (Gharagozloo et al. 2023), and it is of great significance to study the key genes and functional SNPs that affect egg‐laying performance (Li et al. 2019). The avian egg‐production process is strictly controlled by the hypothalamic‐pituitary‐gonadal axis (Kataki and Khanikar 2022). The gonadotropin‐releasing hormone (GnRH), a neuro‐endocrine decapeptide, plays an essential role in regulating the gonadal development and sexual maturation in vertebrate species (Gharaei et al. 2011). The hypothalamus regulates gonadotropin secretion via pulsatile secretion of the GnRH into the pituitary's portal circulation which is essential for proper gonadal function. GnRH, binding with its receptor GnRH (GnRHR), stimulates gonadotropin secretion from the pituitary gland and evokes steroidogenesis in the gonads, resulting in EP in hens. The majority of evidence suggests that in hens, GnRH‐I is the primary regulator of gonadotropin release and GnRH‐II might be independent of GnRH‐I (Pal et al. 2023). In genomic DNA, a base position with sequence alternatives is considered an SNP only when the least frequent allele has at least 1% frequency. Previously, haplotype combinations were used to associate biological traits to their causal genes but with the advent of next‐generation sequencing (NGS) technology, it is now possible to effectively classify SNPs linked to the genes involved in the traits of interest. Amplicon sequencing is an approach of targeted resequencing that involves amplification and purification of regions of interest using primer‐mediated highly multiplexed oligonucleotide probes (Patel et al. 2022). Although some research works and association studies have been done on these genes using conventional techniques like polymerase chain reaction PCR‐RFLP, we have performed amplicon sequencing of these genes’ exon regions to enable deep sequencing at much higher coverage levels, allowing greater confidence for calling variants of low‐frequency alleles and their association with production traits in native hens of Isfahan.
2. Materials and Methods
2.1. Experimental Birds
The samples were collected from the 13th generation of the native hen population of the breeding station native hen population of Isfahan province breeding, maintenance and breeding station. This station is located 25 km southeast of Isfahan city (5 km from Baharestan city) and near Kabutarabad village. The goals of this station are to preserve the genetic resources of native hens and increase the performance of this breed and to expand and revive the tradition of breeding native hens in rural and urban areas. In all past generations, parents of the next generation have been selected using quantitative genetic methods from among the recorded and pedigreed population of the station. All birds were housed in a stacked cage rearing system, with one cage for each bird. Chickens were maintained and fed a standard diet and had free access to food and water. The house was automatically ventilated to maintain an ambient temperature of between 20°C and 28°C, with a 16‐h light/day photoperiod at 15 lux. A few parameters were documented for both breeds, including the AFE, total EP at 300 days of age (EN 300), body weight at first egg (BW) and EW at first egg.
2.2. Sample Collection and DNA Isolation
Blood samples of 2 mL were collected from the wing vein of 100 native hens under an aseptic condition in a sterile 4 mL EDTA vacutainer. DNA was extracted from 200 µL by YTA Kit (Yekta Tajhis Azma, Iran) blood, and the isolated DNA samples were stored at −20°C until further use. The concentration of genomic DNA was evaluated on NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific Inc, USA). The quality of genomic DNA was checked by 1% agarose gel electrophoresis. For library preparation, DNA concentration was measured using Qubit 3.0 fluorometer (Invitrogen, Thermo Fisher Scientific, MA) using DNA HS (high sensitivity) kit as per protocol provided by the manufacturer.
2.3. PCR Amplification
One pair of primers was designed to amplify the fragments, including the four mutations, according to the genomic sequence of the GNRHR gene in the NCBI GenBank database (accession no. AJ506779). The primer sequences and PCR product information are presented in Table 1.
TABLE 1.
Sequences and polymerase chain reaction (PCR) conditions of primer.
| Primers | Sequence of the primer | Tm (°C) | Length of the product (bp) |
|---|---|---|---|
| GNRHR F | 5′‐GACGGGCAGCATTACTCTTC‐3′ | 57 | 975 |
| GNRHR R | 5′‐TGAGTGGCCGAGGTGTTG‐3′ | 57 | 975 |
Abbreviation: GNRHR, Gonadotropin‐Releasing Hormone Receptor.
PCR was carried out in 20 µL of 50 ng genomic DNA, 5 pM primer mixture, 20 mM of each dNTP, 100 mM Mg2+, 5X Q‐Solution and 5 U/µL Taq DNA polymerase. The amplification protocol had an initial denaturation and enzyme activation phase at 95°C for 5 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 57°C for 1 min, extension at 72°C for 1 min and then a final extension at 72°C for 5 min. PCR products were checked on 1% agarose gel that had been stained with ethidium bromide.
2.4. DNA Sequencing and Identification of SNP Markers
After gene amplification by PCR, the samples were sent to South Korea Macrogen for sequencing. Sequencing was done by 3730XL device. The sequences obtained in each sample were compared with the registered gene sequence taken from the NCBI database, and SNP markers were identified. For this purpose, BLAST programme on NCBI website was used. After identifying the SNPs in each sample, we recorded them in Excel 2019 software.
2.5. Statistical Analyses
After identifying the mutations or SNPs, the breeding value was used to check their relationship with the traits under study. It should be noted that in various generations of this population, breeding values are routinely calculated to facilitate the selection of superior parents for the subsequent generation. This calculation employs a genetic animal model to estimate the genetic parameters of traits. The model is represented as y = Xb + Zu + e, with the following assumptions: E(y,u,e)′ = (Xb,0,0)′, Var(u,e)′ = (G,R)′ Var(y) = V = ZGZ′ + R; in this model, y denotes the vector of observations, X represents the incidence matrix for fixed effects, and b is the corresponding vector of fixed effects. Similarly, Z is the incidence matrix for random effects, u is the vector of random effects, and e is the residuals vector (Ghaderi et al. 2024; Yousefi Zonuz et al. 2013). Independent sample t‐test was used in SPSS software version 25 to check the relationship between the breeding value of traits and mutations.
3. Results
3.1. Confirmation of DNA Extraction
The results of DNA extracted from poultry blood by electrophoresis on 1% agarose gel can be seen in Figure 1. Because the bands were not removed from the wells and no smear was seen in the bands, it is clear that the extracted DNA concentration is high and appropriate.
FIGURE 1.
DNA extraction on 1% agarose gel.
3.2. Polymerase Chain Reaction
They were amplified from nucleotides 26 to 1001 which were in exon 2. The DNA fragments are amplified by one pair of primers, which are consistent with that expected product, Figure 2. The results suggested that the products of PCR are suitable to detecting polymorphism by sequencing.
FIGURE 2.
Gonadotropin gene electrophoresis on 1% agarose gel. M: 100 bp marker (Sinaclon, Iran), 1: 975 bp of GNRHR gene. NC, negative control.
3.3. Examining the Results of Sequencing and BLAST
Five single‐nucleotide polymorphisms (SNPs) in gene GNRHR were observed in the studied samples (Figure 3A). These polymorphisms were in nucleotides numbers 117, 123, 157, 453 and 550 of the amplified fragments and caused the change of nucleotide T to A, G to C, T to G, T to C and T to C, respectively. The results of the analysis of SNPs at the BLAST locus are shown in Figure 4.
FIGURE 3.
Checking the sequence of PCR products. A: Single‐nucleotide polymorphism (only heterozygous samples have shown) in nucleotide numbers 117, 123, 157, 453 and 550 in GNRHR.
FIGURE 4.
Single‐nucleotide polymorphisms at BLAST.
3.4. Markers Frequency
Among the markers, the highest mutation rate is in the S15 > T/G marker with a frequency of 61.5, and it should be said that the lowest mutation rate is visible in the S453T/C marker with a frequency of 40.
The results of data frequency are given in Table 2. The significance of the difference in the number of eggs, EW and BW at 12 weeks and average breeding value at the age of sexual maturity for markers S550T/C, S453T/C, S157T/S, S123G/C and S117T/A was tested, the results of which are presented in Tables 2, 3, 4, 5.
TABLE 2.
Identified markers and frequency in exon one and exon two in Gonadotropin‐Releasing Hormone Receptor (GNRHR) gene.
| Marker | Allele | Frequency |
|---|---|---|
| S117T/A |
A T✓ |
39.5 60.5 |
| S123G/C |
G C✓ |
59 41 |
| S157T/G |
G T✓ |
38.5 61.5 |
| S453T/C |
C T✓ |
60 40 |
| S550T/C |
C T✓ |
56.5 43.5 |
TABLE 3.
The average breeding value in the body weight trait at 12 weeks for the mutations identified in the poultry Gonadotropin‐Releasing Hormone Receptor (GNRHR) hormone gene.
| Marker | Allele | Mean (g) ± standard error | p value |
|---|---|---|---|
| S117T/A |
A T |
241.438 ± 3.552 238.995 ± 5.499 |
0.746ns |
| S123G/C |
G C |
230.222 ± 1.956 254.596 ± 2.33 |
0.01 ** |
| S157T/G |
G T |
230.222 ± 1.956 254.596 ± 2.333 |
0.01 ** |
| S453T/C |
C T |
246.654 ± 5.884 235.517 ± 3.895 |
0.123ns |
| S550T/C |
C T |
246.654 ± 5.884 235.517 ± 3.895 |
0.123ns |
Note: Data represent the mean ± standard deviation.
Abbreviation: ns, non‐significant
p < 0.01.
TABLE 4.
Average breeding value in the age of sexual maturity trait for the identified mutation in the hormone gene (Gonadotropin‐Releasing Hormone Receptor [GNRHR]).
| Marker | Allele | Mean (g) ± standard error | p value |
|---|---|---|---|
| S117T/A |
A T |
−13.002 ± 1.351 −9.08 ± 0.464 |
0.007 ** |
| S123G/C |
G C |
−11.187 ± 1.285 −9.843 ± 0.0619 |
0.415ns |
| S157T/G |
G T |
−11.187 ± 1.085 −9.843 ± 0.061 |
0.415ns |
| S453T/C |
C T |
−12.46 ± 1.512 −9.174 ± 0.485 |
0.015 * |
| S550T/C |
C T |
−12.845 ± 1.412 −9.173 ± 0.481 |
0.013 * |
Note: Data represent the mean ± standard deviation.
Abbreviation: ns, non‐significant.
p < 0.05.
p < 0.01.
TABLE 5.
The average breeding value in the egg number trait for the identified mutation in the hormone gene (Gonadotropin‐Releasing Hormone Receptor [GNRHR]).
| Marker | Allele | Mean (g) ± standard error | p value |
|---|---|---|---|
| S117T/A |
A T |
5.011 ± 0.133 4.461 ± 0.124 |
0.012 * |
| S123G/C |
G C |
4.582 ± 0.125 4.830 ± 0.214 |
0.303ns |
| S157T/G |
G T |
4.582 ± 0.125 4.834 ± 0.214 |
0.303ns |
| S453T/C |
C T |
4.642 ± 0.0907 4.6807 ± 0.279 |
0.305ns |
| S550T/C |
C T |
4.532 ± 0.0807 4.7807 ± 0.179 |
0.303ns |
Note: Data represent the mean ± standard deviation.
Abbreviation: ns, non‐significant.
p < 0.05.
3.5. Investigating the Relationship Between GNRHR Gene Markers and BW at 12 Weeks
The difference in the average breeding value of BW at 12 weeks was investigated for five markers shown in Table 3. A significant difference was observed in S123C/G and S157T/G markers with 99% probability (p ˂ 0.01). In this marker, the mutation was in the form of G to C and T to G, respectively. The difference between breeding value of BW at 12 weeks has non‐significant effect for markers of S117T/A, S453T/C and S550T/C.
3.6. Investigating the Average Breeding Value at the Age of Sexual Maturity
According to Table 4, S117T/A marker has a significant difference with 99% probability (p ˂ 0.01), and markers S550T/C and S453T/C have a significant difference with 95% probability (p ˂ 0.05) in the age of sexual maturity. The markers of S123G/C and S157T/G have a non‐significant difference in the age of sexual maturity.
3.7. Investigating the Relationship Between Hormone Gene Markers (GNRHR) and the Number of Eggs
A significant difference was observed in the average breeding value of the EN trait in S117T/A marker with significant level of 0.012, which has a 95% probability that the mutation is replacing thymine instead of adenine. The difference of breeding value of the EN for another markers has non‐significant. The results of GNRHR hormone gene marker examination with the breeding value of EN are presented in Table 5.
3.8. Investigating the Relationship Between GNRHR Hormone Gene Markers and EW
The average breeding value in the EW trait was observed as a non‐significant effect. The results of examining the relationship between GNRHR female hormone markers and the breeding value of EW are presented in Table 6.
TABLE 6.
Mean breeding value in egg weight trait for mutation detected in hormone gene (Gonadotropin‐Releasing Hormone Receptor GNRHR).
| Marker | Allele | Mean (g) ± standard error | p value |
|---|---|---|---|
| S117T/A |
A T |
1.429 ± 0.211 1.860 ± 0.258 |
0.256ns |
| S123G/C |
G C |
1.8006 ± 0.253 1.519 ± 0.251 |
0.465ns |
| S157T/G |
G T |
1.8006 ± 0.253 1.519 ± 0.251 |
0.465ns |
| S453T/C |
C T |
1.974 ± 0.4605 1.586 ± 0.275 |
0.179ns |
| S550T/C |
C T |
1.991 ± 0.4007 1.485 ± 0.284 |
0.177ns |
Note: Data represent the mean ± standard deviation.
Abbreviation: ns, non‐significant.
4. Discussion
Egg‐laying performance reflects the overall reproductive performance of breeding hens. The genetic traits for egg‐laying performance have low or medium heritability and, depending on the period involved, usually range from 0.16 to 0.64. Egg‐laying in hens is regulated by a combination of environmental, endocrine and genetic factors. The main endocrine factors that regulate egg‐laying are GnRH, prolactin (PRL), follicle‐stimulating hormone (FSH) and luteinizing hormone (LH). In the last three decades, many studies have explored this aspect at a molecular genetic level. Recent studies identified 31 reproductive hormone‐based candidate genes that were significantly associated with egg‐laying performance. With the development of genome‐sequencing technology, 64 new candidate genes and 108 SNPs related to egg‐laying performance have been found using genome‐wide association studies (GWAS), providing novel insights into the molecular genetic mechanisms governing EP. At the same time, microRNAs that regulate genes responsible for egg‐laying in hens were reviewed (Du et al. 2020).
The sequence variations for the GH1, GH2 and insulin‐like growth factor‐binding protein 2 (IGFBPII) genes in three chicken genotypes were assayed. The findings of the average comparison investigation revealed significant changes among GH genotypes in BW (on 1 day and puberty), EW (at puberty and 13 weeks of age), ASM, EN and AEW at 345–375 days of the era, and PF, as well as IGFBPII populations in the LI trait (Assi et al. 2023). Due to the fact that the chicken growth hormone gene (cGH) is critical for controlling development and metabolism, there could be a link between GH polymorphisms and economic features in chickens. The objective of this study was to detect the SNPs in the GH and IGFBPII genes and to investigate their associations with BW. Three hundred individuals (100 birds for each commercial strains, Sasso and Ross, and one local breed, Baladi) were assayed. In addition, the three primers were amplified with a total of 54 samples from three genotypes (Ross = 18, Sasso = 18 and Baladi = 18). The total of SNPs sequenced was 138,106 bp consisting of 13,265 bp coding regions and 124,841 bp non‐coding regions. A total of 197 SNPs were identified, with 34 in coding SNP regions and 163 in non‐coding SNP regions. The values of variation in coding regions accounted for 53% (18), 26% (9) and 21% (7), whereas the values of variation in non‐coding regions were 27% (111), 33% (132) and 40% (163) in Ross, Sasso and Baladi for three genes. This result is most likely due to the high, medium and low BWs of Ross, Sasso and Baladi breeds. The higher frequency of A→G and A→C and lower frequency of G→T may be related to higher BW in the Ross strain. However, the higher frequency of A→C, C→T and lower G→T may be related to lower BW with Baladi breed. Our study confirms the analysed three genes affecting meat production in poultry (El‐Sayed et al. 2022).
From the present study, it can be concluded that the severe decrease in ovarian activity during the laying and broiler hens’ calving is the result of the decrease in gonadotropin secretion, which is itself the result of the decrease in the secretion of GnRH. By reducing the release of gonadotropin, the expression of the GNRH gene in the hypothalamus decreases. GNRH through its receptor (GNRH) stimulates the secretion of gonadotropin in the pituitary gland. Therefore, the GNRH gene and its receptor (GNRH) are the beginning of a cascade, the result of which is the growth, maturation and proper maintenance of the gonads. For this reason, both GNRHI and GNRHII are selected as candidate genes to control reproductive activity (Morgan and Millar 2004). GNRH gene has an increasing effect on the number of two‐yolk eggs, and it must be said that it plays a significant role in controlling the characteristics of two‐yolk eggs (Goddard et al. 1988).
Therefore, it should be said that according to the results obtained in this research and the physiological role of the GNRH gene and compared with other research, GNRH has a significant effect on the number of eggs, EW, BW at 12 weeks and average breeding value at the age of sexual maturity, which is due to its physiological role and the mutations that were investigated. As GNRH is also present in gonads such as the pituitary gland, its effects may occur at the ovarian level, possibly by affecting the proliferation of genetic limits to cell lifespan, as in mammals (Chandrashekar et al. 2004).
According to Table 3, two markers that have two alleles and BW had a significant effect, which may be said to influence this chicken's BW, but it cannot be stated with certainty because the number of cases in all markers is low, but it must be said that this gene plays an important role in BW. In a study on native hens of Mazandaran, markers that were identified by RFLP method had a significant effect on BW (Moazeni et al. 2016). Of course, in a study on the native breed of Mazandaran, the only marker that was identified by RFLP method did not have a significant effect on BW (Gorji et al. 2016).
According to Table 4, two markers showed a significant effect, which strengthens the theory that due to the physiological nature of the gene in the gonads and the effect it has on it, this relationship is significant, and the mutation in this gene causes a positive effect on the trait of sexual maturity. According to another study that was conducted, the GNRGR hormone identified by RFLP method was reported to be significant (Bass et al. 2016). In any case, due to the effect of the GNRHR hormone and its presence in the gonads, it can cause the growth of genital organs and affect sexual maturity.
According to Table 5, the marker showed a significant relationship, which will be effective in the number of eggs with a probability of 95%, but a significant difference was not observed in the other markers.
However, other research has shown that the GNRHR gene plays an important role in having two yolks and the number of eggs, which can be investigated further. According to the information obtained from this study, the GnRHR gene has an acceptable effect on the productive traits of Isfahan native hens. Of course, its effect cannot be considered important for the entire production traits, but in the sexual maturity sections, the number of eggs and even two‐yolk eggs plays an important role and has a significant effect on the mentioned production traits.
Association studies cannot determine whether the gene allele marker is responsible for the variation in a trait or whether it is due to a closely linked locus. However, there is a good reason to believe that these genes would influence the traits in hens. Therefore, molecular marker‐assisted selection is needed. The results from the current study indicate that GNRHR may be important in reproductive traits and are potential markers for use in molecular marker‐assisted selection programmes. More sophisticated experimental designs with large numbers of animals, including measurement of physiological parameters together with other putative candidate genes, are needed to establish the precise role of the genes in practical breeding by means of marker‐assisted selection.
Author Contributions
Somayeh Tirbakhsh Gouran researched and edited the manuscript. Mostafa Faghani was the idea designer and research leader. Mohammad Mohammadi Berenjegani designed the research and performed the data analysis. Farshid Kheiri provided financial support. Laboratory analysis was done by Matin Rahimi Domakani. All authors read and approved the final manuscript.
Funding
The authors have nothing to report.
Conflicts of Interest
The authors declare no conflicts of interest.
Acknowledgements
The authors would like to thank the staff members of Islamic Azad University, Shahrekord branch, for their help and support.
Data Availability Statement
The Native Poultry Research Center upholds strict policies regarding the non‐disclosure of research information and limited access to data. Our commitment to confidentiality ensures the protection of proprietary knowledge and intellectual property. Researchers are bound by agreements to safeguard sensitive findings, fostering an environment of trust and integrity. Access to data is restricted to authorized personnel only, promoting data security and preventing unauthorized disclosure. These measures safeguard against potential misuse or exploitation of research outcomes, maintaining the centre's reputation for ethical research practices.
References
- Assi, H. A. , Al‐Soudy A., El‐Hamamsy S., and El‐sayed D. M.. 2023. “Genetic Diversity of Heat Shock Proteins and Growth Hormone Receptor Genes in Two Egyptian Chicken Breeds.” Egyptian Poultry Science Journal 43, no. 2: 349–369. [Google Scholar]
- Azmal, S. A. , Bhuiyan A. A., Omar A. I., et al. 2019. “Novel Polymorphisms in RAPGEF6 Gene Associated With Egg‐Laying Rate in Chinese Jing Hong Chicken Using Genome‐Wide SNP Scan.” Genes 10, no. 5: 384. https://mdpi‐res.com/d_attachment/genes/genes‐10‐00384/article_deploy/genes‐10‐00384‐v2.pdf?version=1559030562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bass, C. , Redmer D., and Grazul A.. 2016. “325 The Effects of the Nitric Oxide (NO) System and Nutritional Plane on Ovarian Function in Sheep.” Journal of Animal Science 94: 152–153. [Google Scholar]
- Chandrashekar, V. , Zaczek D., and Bartke A.. 2004. “The Consequences of the Altered Somatotropic System on Reproduction.” Biology of Reproduction 71, no. 1: 17–27. 10.1095/biolreprod.103.027060. [DOI] [PubMed] [Google Scholar]
- Du, Y. , Liu L., He Y., Dou T., Jia J., and Ge C.. 2020. “Endocrine and Genetic Factors Affecting Egg Laying Performance in Chickens: A Review.” British Poultry Science 61, no. 5: 538–549. [DOI] [PubMed] [Google Scholar]
- El‐Sayed, M. A. , Assi H. A., Mekky S. S., and Soliman H. A.. 2022. “Molecular Detection of Some Growth‐Hormone Genes in Chickens.” Egyptian Journal of Agricultural Research 100, no. 2: 193–203. [Google Scholar]
- Ghaderi‐Zefrehei, M. , Rafeie F., Zakizadeh S., Torshizi M. E., Peters S. O., and Smith J.. 2024. “Genetic Variance Components of the Growth Curve for Isfahan Indigenous Chicken.” Veterinary Medicine and Science 10, no. 2: e1388. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gharaei, A. , Rahdari A., and Ghaffari M.. 2011. “Induced Spawning of Schizothorax zarudnyi (Cyprinidae) by Using Synthetic Hormones (Ovaprim and HCG).” World Journal of Fish and Marine Sciences 3, no. 6: 518–522. [Google Scholar]
- Gharagozloo, A. , Kheiri F., Nasr J., and Faghani M.. 2023. “Effect of Pomegranate Seed Oil on Egg Production, Egg Quality and Yolk Fatty Acid Deposition in Laying Hen.” Veterinary Medicine and Science 9, no. 6: 2755–2762. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goddard, C. , Wilkie R., and Dunn I.. 1988. “The Relationship Between Insulin‐Like Growth Factor‐1, Growth Hormone, Thyroid Hormones and Insulin in Chickens Selected for Growth.” Domestic Animal Endocrinology 5, no. 2: 165–176. [DOI] [PubMed] [Google Scholar]
- Gorji, A. , Rahmani H., and Miyanji G.. 2016. “Growth Parameters Evaluation and Identification of Growth Hormone Receptor Gene Polymorphisms in Various Strains of Rainbow Trout Oncorhynchus mykiss .” Journal of Aquaculture Research & Development 7: 7. [Google Scholar]
- Kataki, B. , and Khanikar D.. 2022. “Hypothalamic‐Pituitary‐Go Nad al (HPG) Axis and Its Functional Regulation in Birds.” BIOINFOLET‐A Quarterly Journal of Life Sciences 19, no. 4: 408–417. [Google Scholar]
- Khajeali, Y. , Kheiri F., Rahimian Y., Faghani M., and Namjo A.. 2012. “Effect of Use Different Levels of Caraway (Carum carvi L.) Powder On Performance, Some Blood Parameters and Intestinal Morphology On Broiler Chickens.” World Applied Sciences Journal 19, no. 8: 1202–1207. [Google Scholar]
- Li, X. , Lu Y., Liu X., Xie X., Wang K., and Yu D.. 2019. “Identification of Chicken FSHR Gene Promoter and the Correlations Between Polymorphisms and Egg Production in Chinese Native Hens.” Reproduction in Domestic Animals 54, no. 4: 702–711. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6850157/pdf/RDA‐54‐702.pdf. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moazeni, S. M. , Mohammadabadi M., Sadeghi M., Shahrbabak H. M., Koshkoieh A. E., and Bordbar F.. 2016. “Association Between UCP Gene Polymorphisms and Growth, Breeding Value of Growth and Reproductive Traits in Mazandaran Indigenous Chicken.” Open Journal of Animal Sciences 6, no. 1: 1–8. [Google Scholar]
- Morgan, K. , and Millar R. P.. 2004. “Evolution of GnRH Ligand Precursors and GnRH Receptors in Protochordate and Vertebrate Species.” General and Comparative Endocrinology 139, no. 3: 191–197. [DOI] [PubMed] [Google Scholar]
- Pal, S. , Patel A. C., Hinsu A. T., Panchal K. J., Koringa P. G., and Rank D. N.. 2023. “The Identification of Single Nucleotide Polymorphisms in GnRH‐I, GnRH‐II/MRPS26, GnRHR Exons and Their Association With Egg Production in Anand Synthetic White Leghorn and Anand Bantamised White Leghorn Chicken.” Indian Journal of Veterinary Sciences & Biotechnology 19, no. 2: 94–98. [Google Scholar]
- Patel, A. R. , Patel M. R., Golaviya A. G., Jhakesara S. J., Patel A. C., and Koringa P. G.. 2022. “Validation of SNPs Identified by Amplicon Sequencing and Their Association With Egg Production and Egg Weight in Anand Synthetic White Leghorn and Anand Bantamised White Leghorn Chicken.” Indian Journal of Veterinary Sciences & Biotechnology 18, no. 5: 104–110. [Google Scholar]
- Yousefi Zonuz, A. , Alijani S., Mohammadi H., Rafat A., and Daghigh Kia H.. 2013. “Estimation of Genetic Parameters for Productive and Reproductive Traits in Esfahan Native Chickens.” Journal of Livestock Science and Technologies 1, no. 2: 34–38. [Google Scholar]
- Zhang, L.‐C. , Ning Z.‐H., Xu G.‐Y., Hou Z.‐C., and Yang N.. 2005. “Heritabilities and Genetic and Phenotypic Correlations of Egg Quality Traits in Brown‐Egg Dwarf Layers.” Poultry Science 84, no. 8: 1209–1213. https://www.sciencedirect.com/science/article/pii/S0032579119446555?via%3Dihub. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The Native Poultry Research Center upholds strict policies regarding the non‐disclosure of research information and limited access to data. Our commitment to confidentiality ensures the protection of proprietary knowledge and intellectual property. Researchers are bound by agreements to safeguard sensitive findings, fostering an environment of trust and integrity. Access to data is restricted to authorized personnel only, promoting data security and preventing unauthorized disclosure. These measures safeguard against potential misuse or exploitation of research outcomes, maintaining the centre's reputation for ethical research practices.