ABSTRACT
Colorectal cancer, a major health issue worldwide, exhibits intricate molecular mechanisms that necessitate further exploration, particularly regarding regulated cell death pathways, such as ferroptosis. This study investigated the role of the immunophilin FKBP9 (FK506 Binding Protein 9) in colon cancer, specifically its effects on cell proliferation and ferroptosis resistance. Using molecular biology techniques, including quantitative reverse transcription PCR, Western blotting, and cell proliferation assays, we established that FKBP9 is overexpressed in colon cancer cell lines HCT116 and SW480. Furthermore, we demonstrated that FKBP9 enhances cell proliferation by inhibiting ferroptosis through glutathione peroxidase 4 (GPX4) expression upregulation, thereby reducing reactive oxygen species levels and stabilizing GPX4 by preventing its autophagic degradation. Notably, increased FKBP9 expression is associated with lower overall survival rates in patients with colon cancer, suggesting its potential as a prognostic marker. These findings underscore the therapeutic potential of FKBP9 in colon cancer, offering a new method to sensitize cancer cells to ferroptosis and improve patient outcomes.
Keywords: autophagy, colon cancer, ferroptosis, FKBP9, GPX4
The significance of FKBP9 as a therapeutic target in colon cancer treatment, providing new avenues for strategies aimed at sensitizing cancer cells to ferroptosis and improving patient outcomes.

Abbreviations
- FKBP9
FK506 binding protein 9
- GPX4
glutathione peroxidase 4
1. Introduction
Colorectal cancer (CRC) remains one of the leading causes of cancer‐related morbidity and mortality worldwide [1, 2], highlighting the urgent need for enhanced understanding of its underlying mechanisms to improve therapeutic strategies. Previous investigations into the molecular pathways governing CRC have elucidated various aspects of cancer biology, particularly the role of regulated cell death pathways, such as apoptosis [3] and, more recently, ferroptosis [4, 5]. Ferroptosis, characterized by iron‐dependent lipid peroxidation [6], is a pivotal tumor‐suppression mechanism; however, its role in CRC remains inadequately understood, making it a critical area for further exploration.
Although ferroptosis is a valuable target in cancer therapy, the specific molecular regulators involved remain incompletely characterized, particularly within the context of CRC. Previous studies have demonstrated the significance of glutathione peroxidase 4 (GPX4) in protecting against ferroptotic cell death [7], thereby enhancing cell survival under oxidative stress [8]. However, no comprehensive investigation has been conducted into how other proteins might influence GPX4 activity and resistance to ferroptosis. Notably, FKBP9, an immunophilin involved in protein folding and cellular stress responses [9, 10], is overexpressed in various non‐CRC cancers [10, 11]; however, to date, its role in regulating ferroptosis and its impact on cancer cell proliferation has not been systematically investigated.
This study was conducted to address these gaps, hypothesizing that FKBP9 enhances CRC cell proliferation by inhibiting ferroptosis, primarily by stabilizing GPX4. Understanding FKBP9's functional mechanism could elucidate its role in ferroptotic regulation and contribute significantly to the development of therapeutic strategies that manipulate ferroptotic pathways, thereby improving cancer treatment.
Here, we employed a combination of molecular biology techniques, including quantitative reverse transcription PCR and Western blotting, along with cell proliferation assays, to investigate the effects of FKBP9 on colon cancer cell lines (HCT116 and SW480) under ferroptotic stimuli. The primary objective was to delineate the molecular mechanisms by which FKBP9 upregulates GPX4 expression and ultimately enhances cell proliferation, thereby obtaining insights into potential therapeutic targets for clinical application in CRC treatment.
2. Materials and Methods
2.1. Cell Lines and Culture
The human CRC cell lines HCT116 and SW480 were obtained from ATCC (USA) and cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin. The cultures were maintained at 37°C in a humidified atmosphere containing 5% CO2. Cells in the logarithmic growth phase were used for all experiments [12]. All cell lines were authenticated by short tandem repeat (STR) profiling at GENEWIZ Inc. and were routinely confirmed to be mycoplasma‐free using a PCR‐based detection kit (Beyotime, C0301S).
2.2. Plasmid Construction and Cell Transfection
The FKBP9 overexpression plasmid (pcDNA3.1‐FKBP9) and the control empty vector (pcDNA3.1) were synthesized by Miaoling Company. HCT116 and SW480 cells were transfected with 1 μg of plasmid per well of a 6‐well plate using Lipofectamine 2000 (Invitrogen), as per the manufacturer's instructions. Forty‐eight hours post‐transfection, the medium was replaced with fresh medium containing 2 μg/mL puromycin (Sangon) for the selection of stable clones over 7 days.
2.3. Drug Treatment and Reagents
The ferroptosis inducer Erastin (MCE), the ferroptosis inhibitor Ferrostatin‐1 (Fer‐1, MCE), the lysosome inhibitor Chloroquine (CQ, HY‐17589A), and the proteasome inhibitor MG132 (HY‐13259) were all obtained from MCE. All compounds were dissolved in DMSO (Sigma) and stored as recommended by the manufacturers. Cycloheximide (CHX, C7698) was obtained from Sigma. A DCFH‐DA fluorescence probe (Biyuntian), an EdU detection kit (Sangon), and a GSH detection kit (Sangon) were also utilized in this study.
2.4. Western Blotting
The cells were washed with ice‐cold PBS and lysed on ice for 30 min in RIPA lysis buffer containing 1% protease inhibitor (Beyotime). The lysate was then centrifuged at 12,000 × g for 15 min at 4°C, and the supernatant was collected. Protein concentrations were determined via a BCA assay (Beyotime). Equal concentrations of protein (30 μg per lane) were separated using 10% SDS–PAGE and transferred to PVDF membranes (Millipore). The membranes were then blocked with 5% nonfat milk for 1 h and incubated overnight at 4°C with the following primary antibodies: FKBP9 (Proteintech, 1:1000), GPX4 (Abcam, 1:2000), LC3B (Cell Signaling Technology, 1:1000), ATG5 (CST, 1:1000), ATG7 (CST, 1:1000), and β‐actin (Sigma, 1:5000). After washing with TBST, the membranes were incubated with HRP‐conjugated secondary antibodies (1:5000, CST) for 1 h at room temperature. Immunoreactive bands were visualized using ECL chemiluminescence reagent (Biosharp), and band densities were quantified using ImageJ software.
2.5. Real‐Time Quantitative PCR (qRT–PCR)
Total RNA was extracted using TRIzol reagent (Invitrogen, USA), and reverse transcription was performed using the PrimeScript RT Reagent Kit (TAKARA, Japan). qRT‐PCR was performed using TB Green Premix Ex Taq II (TAKARA, Japan). Specific primers for the target gene (FKBP9) and reference genes (β‐actin/GAPDH) were designed and synthesized by Sangon Biotech (Shanghai) Co. Ltd. Primer sequences were verified using NCBI BLAST. The primer sequences for FKBP9 were as follows: forward 5‐GGAGAGGAAGGAAGAGGGAATA‐3, reverse 5‐GGTTTGTAGTGGGAGGTGATG‐3. Relative gene expression was quantified using the 2−ΔΔCt method, and the data are presented as the mean ± standard deviation. Significance was determined using GraphPad Prism 8.0 (*p < 0.05).
2.6. Immunohistochemical Staining (IHC)
IHC was performed on normal colon and CRC tissues, as per established protocols. The tissues were deparaffinized using a graded ethanol series, followed by a 30 min blocking step with 5% serum at room temperature. Subsequently, the tissues were incubated overnight at 4°C with an FKBP9 primary antibody (1:100 dilution, Wuhan SanYing). A horseradish peroxidase (HRP)‐conjugated secondary antibody (1:100 dilution; Sangon) was then applied for 60 min at room temperature. DAB substrate (Sangon Biotech) was used for visualization, followed by hematoxylin counterstaining, differentiation in 1% hydrochloric acid in ethanol, ammonia rebluing, and dehydration through a graded ethanol series. Coverslips were mounted with neutral resin, and images were captured using an inverted microscope at 20× magnification.
2.7. GPX4 Stability Assessment
HCT116 colon cancer cells were seeded in 6‐well plates and transiently transfected with 1 μg of either the empty pcDNA3.0 plasmid or the pcDNA3.0‐FKBP9 plasmid, following the Lipofectamine 2000 protocol. Forty‐eight hours post‐transfection, the cells were treated with 15 μg/mL CHX for 0, 2, 4, and 6 h. GPX4 protein levels were then assessed by Western blotting and quantified using ImageJ.
2.8. Cell Proliferation (MTT) Assay
Cells were seeded at a density of 3 × 103 cells per well in 96‐well plates. Subsequently, 10 μL of MTT solution (5 mg/mL, Sigma) was added to each well at 0, 24, 48, and 72 h, and the plate was incubated for 4 h at 37°C. The supernatant was then removed, and 150 μL of DMSO (Sigma) was added to dissolve the resulting formazan crystals. Absorbance was measured at 450 nm using an ELISA reader.
2.9. EdU Detection
Cells (5 × 104 per well) were seeded in 24‐well plates and incubated with 10 μM EdU for 2 h. Following fixation, the cells were stained as per the manufacturer's instructions (Sangon, No. E607204). The proportion of EdU‐positive cells was then quantified using fluorescence microscopy.
2.10. Colony Formation Assay
Cells (500 per well) were seeded in 6‐well plates and cultured for 10–14 days. Subsequently, the colonies were fixed and stained with crystal violet; those containing more than 50 cells were counted.
2.11. Detection of Reactive Oxygen Species (ROS) and Glutathione (GSH)
For ROS detection, cells were incubated with 10 μM DCFH‐DA in the dark for 30 min and then washed with PBS. Fluorescence intensity was quantified using a fluorescence spectrophotometer (Ex/Em = 488/525 nm; PerkinElmer). For GSH detection, the cells were lysed and reacted with DTNB, and absorbance was measured at 412 nm using an ELISA reader. The GSH concentration was then calculated using a standard curve.
2.12. Co‐Immunoprecipitation (Co‐IP)
HCT116 and 116‐FKBP9 cells were collected and lysed using an immunoprecipitation lysis buffer (Sangon Biotech). The lysate was incubated overnight at 4°C with 2 μg of GPX4 antibody (Abcam), followed by a 4 h incubation with Protein A/G magnetic beads (Thermo Fisher). Magnetic beads were washed with PBS, and bound proteins were eluted by boiling. Western blotting was performed to detect LC3B in the eluate. Following three washes, immunoprecipitated samples were subjected to SDS–PAGE and analyzed by Western blotting, as previously described [13].
2.13. Tumor Formation Experiment
Animal experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals and approved by the institutional ethics committee. Cells were suspended at a concentration of 4 × 106 cells/100 μL. Mice were inoculated with tumor cells and observed until soybean‐sized nodules appeared (7 days). Subsequently, the tumor volume was measured. After 21 days, the mice were euthanized, and the tumors were excised, weighed, and marked for further analysis.
2.14. Transmission Electron Microscopy (TEM) Observation
Cells were fixed in 2.5% glutaraldehyde, rinsed with buffer for 20 min, dehydrated, and embedded. Ultra‐thin sections were prepared by Zhenjiang Zhuanbo Testing Technology Co. Ltd. Autophagosome structures were then observed via TEM.
2.15. Statistical Analysis
The data are presented as the mean ± SD. Significance was determined using t‐tests or one‐way ANOVA in GraphPad Prism 8.0 (*p < 0.05). All experiments were independently repeated three times.
3. Results
3.1. Screening and Identification of Genes Positively Associated With NKD1 in CRC
We previously demonstrated that NKD1 promotes CRC cell proliferation and migration [12, 13, 14], indicating its potential as a CRC biomarker. To identify genes significantly correlated with NKD1 expression in CRC, we analyzed differential gene expression in CRC and corresponding normal tissues from the TCGA database, using the criteria of |log2FC|> 0.7 and FDR < 0.05 for differential gene selection. The analysis revealed 4172 upregulated genes (in red) and 1559 downregulated genes (in blue) in the cancer tissues (Figure 1A and Table ST1). Subsequently, transcriptome sequencing of SW620 cells and NKD1‐knockout SW620‐nkd1−/− cells identified differentially expressed genes, as shown in the volcano plots. NKD1 knockout significantly increased the expression of 47 genes while markedly decreasing that of 99 genes in SW620 cells (p < 0.05) (Figure 1B and Table ST2). To focus on genes highly expressed in CRC tissues but reduced in NKD1 knockout cells, we screened the top 1800 highly expressed genes in CRC tissues and the top 10 reduced genes in NKD1 knockout cells, and we conducted a Venn analysis of these two gene sets. The results identified two shared genes: ECT2 and FKBP9 (Figure 1C). We then evaluated the correlation between the expression of these genes and overall patient survival, classifying TCGA‐COAD patients according to median FKBP9 and ECT2 expression values. The survival curves showed significantly poorer outcomes in patients with high FKBP9 expression than in those with low FKBP9 expression (Figure 1D), indicating that high FKBP9 levels correlate with poor prognosis.
FIGURE 1.

Screening and Identification of NKD1‐Positive Associated Genes in CRC. (A) Heatmap illustrating the differential expression of genes between CRC tissues and their corresponding normal tissues sourced from the TCGA database (https://www.cancer.gov/ccg/research/genome‐sequencing/tcga). (B) Volcano plot depicting the differentially expressed proteins in CRC SW620 cells compared to their NKD1 knockout counterparts (SW620‐nkd1−/−). (C) Venn diagram analysis of gene sets highly expressed in CRC tissues in the TCGA database and with decreased expression in NKD1 knockout cells. (D) Kaplan–Meier overall survival curve showing the survival outcomes of TCGA‐COAD dataset CRC patients according to the median FKBP9 expression level. (E) Box plot‐scatter plot presenting the expression profile of FKBP9 in various cancer types from the TIMER2.0 database. (F) Box plot‐scatter plot analyzing the transcriptional expression level comparison of FKBP9 in CRC and normal tissues from the TCGA data analysis. (G) Immunohistochemical staining (IHC) images showing FKBP9 expression levels in normal colon and CRC tissues. (H) Western blot images showing FKBP9 expression levels in different CRC and adjacent normal tissues. (I) Western blot images showing FKBP9 protein expression levels in different CRC cell lines (SW620, HCT116, SW480, LOVO, HT‐29, and RKO) and normal colonic mucosal epithelial cells (NCM460).
In our literature search, we found no previous reports on FKBP9's function in CRC, prompting us to investigate its biological role and underlying molecular mechanisms. The TIMER2.0 database analysis revealed high FKBP9 expression across various cancer types, including CHOL, COAD, GBM, and others; in contrast, it showed lower expression in BRCA, KICH, and PRAD (Figure 1E and Table ST3). An analysis of FKBP9 expression in CRC versus normal tissues confirmed these findings, with significantly higher FKBP9 levels observed in cancerous tissues (Figure 1F). IHC and Western blotting corroborated FKBP9's increased expression in CRC tissues (Figure 1G,H). To explore FKBP9's biological function, we conducted Western blotting to assess FKBP9 levels in various CRC cell lines, confirming that these cells express FKBP9 at significantly higher levels than NCM460 cells, with its expression being the highest in SW620 cells, followed by that in HCT116 and SW480 cells (Figure 1I). These results confirm that FKBP9 expression is upregulated in CRC tissues and cell lines; however, its functional role in CRC remains unexamined in the existing literature.
3.2. FKBP9 Enhances CRC Cell Proliferation
To elucidate FKBP9's biological role in CRC proliferation, we transfected HCT116 and SW480 cells with a lentivirus expressing FKBP9, generating stable FKBP9‐overexpressing colon cancer cell lines (HCT116‐FKBP9 and SW480‐FKBP9). We verified FKBP9 overexpression via qRT–PCR and Western blotting, confirming significant upregulation in both HCT116‐FKBP9 and SW480‐FKBP9 cells (Figure 2A–C), validating the successful creation of FKBP9‐overexpressing colon cancer cell lines. Next, we assessed the proliferative capacity of HCT116 and HCT116‐FKBP9 cells using MTT and EdU assays, revealing significantly greater proliferation in HCT116‐FKBP9 cells than in HCT116 cells (Figure 2D,E). The comparison of SW480 and SW480‐FKBP9 cells further highlighted FKBP9's role in promoting colon cancer cell proliferation (Figure 2F,G). Additionally, colony formation assays showed that SW480‐FKBP9 cell proliferation was substantially greater than that of SW480 cells (Figure 2H). To complement these in vitro results, we conducted in vivo tumor‐formation assays by implanting HCT116 and HCT116‐FKBP9 cells into nude mice. HCT116‐FKBP9 cells resulted in larger tumors, with increased size, volume, and weight compared with tumors formed by HCT116 cells (Figure 2I–K). Collectively, these findings indicate that FKBP9 is a positive regulator of CRC cell proliferation.
FIGURE 2.

FKBP9 Promotes CRC Cell Proliferation In Vitro and In Vivo. (A, B) qRT–PCR analysis revealing the mRNA expression levels of FKBP9 in colon cancer HCT116 and SW480 cells, as well as in CRC cell lines stably overexpressing FKBP9 via lentiviral transduction (HCT116‐FKBP9, SW480‐FKBP9). (C) Western blot results showing the protein expression levels of FKBP9 in HCT116 and HCT116‐FKBP9 CRC cell lines stably overexpressing FKBP9 via lentiviral transduction (HCT116‐FKBP9, SW480‐FKBP9). (D) MTT assay curve showing the effect of FKBP9 overexpression on the in vitro proliferation ability of HCT116 cells. (E) EdU assay showing the effect of FKBP9 overexpression on the in vitro proliferation ability of HCT116 cells (left), quantitative result plot (right). (F) MTT assay curve showing the effect of FKBP9 overexpression on the in vitro proliferation ability of SW480 cells. (G) EdU assay showing the effect of FKBP9 overexpression on the in vitro proliferation ability of SW480 cells (left), quantitative result plot (right). (H) Colony formation assay images showing the effect of FKBP9 overexpression on the colony formation ability (or proliferation ability) of colon cancer cells. (I) Nude mouse subcutaneous xenograft model results showing the construction of a nude mouse in vivo tumorigenesis model using HCT116 cells stably overexpressing FKBP9 (n = 10). (J) Tumor growth curve showing the effect of FKBP9 overexpression on the tumor volume of HCT116 cells in nude mice (n = 10). (K) Scatter plot showing the effect of FKBP9 overexpression on the tumor weight of HCT116 cells in nude mice.
3.3. FKBP9 Promotes CRC Proliferation by Inhibiting Ferroptosis
In our previous studies, we demonstrated that NKD1 plays an important role in CRC progression by modulating the Wnt signaling pathway and that it is closely linked to programmed cell death [15]. Given these findings and the identification of FKBP9 as a gene positively correlated with NKD1 expression, we hypothesized that FKBP9 may exert its oncogenic effects in CRC by regulating a specific programmed cell death pathway. To test this hypothesis and identify which pathway is affected by FKBP9, we established FKBP9‐overexpressing CRC cell lines and examined the expression of key marker proteins associated with several well‐characterized programmed cell death pathways by Western blotting. We observed significantly higher GPX4 protein levels in HCT116‐FKBP9 cells than in HCT116 cells. Although alterations were noted in apoptosis‐related proteins (BAX and BCL2) and cell cycle markers (Cyclins), GPX4 showed the most pronounced expression upregulation (Figure 3A), indicating that FKBP9 enhances GPX4 expression and promotes the ferroptosis signaling pathway.
FIGURE 3.

FKBP9 Promotes CRC Proliferation by Inhibiting Ferroptosis. (A) Western blot analysis demonstrating the expression levels of proteins associated with ferroptosis, necroptosis, cuproptosis, and cell cycle regulation in HCT116 and HCT116‐FKBP9 cells. (B) Bar graph showing the level of glutathione (GSH) in HCT116 and HCT116‐FKBP9 cells. (C) Bar graph showing the level of reactive oxygen species (ROS) in HCT116 and HCT116‐FKBP9 cells. (D) Western blot results showing the protein expression levels of FKBP9 and GPX4 in HCT116 and HCT116‐FKBP9 cells treated with DMSO or the ferroptosis inducer Erastin (10 μM, 24 h). (E) Bar graph showing the level of GSH in HCT116 and HCT116‐FKBP9 cells treated with DMSO or Erastin (10 μM, 24 h). (F) Bar graph showing the level of ROS in HCT116 and HCT116‐FKBP9 cells treated with DMSO or Erastin (10 μM, 24 h). (G) MTT assay cell survival curve showing the proliferation ability of HCT116 and HCT116‐FKBP9 cells treated with DMSO or Erastin (10 μM, 24 h). (H) MTT assay cell survival curve showing the proliferation ability of SW480 and SW480‐FKBP9 cells treated with DMSO or Erastin (10 μM, 24 h).
We next measured ROS and GSH levels in HCT116 and HCT116‐FKBP9 cells to validate FKBP9's role in regulating the ferroptosis pathway, revealing a significant reduction in ROS levels in HCT116‐FKBP9 versus HCT116 cells (Figure 3B). This finding indicates that FKBP9 inhibits ROS production in tumor cells. Furthermore, GSH levels were significantly higher in HCT116‐FKBP9 cells than in HCT116 cells (Figure 3C). We next treated HCT116 and HCT116‐FKBP9 cells with the ferroptosis inducer Erastin (10 μM) for 24 h and monitored FKBP9 expression by Western blotting. FKBP9 overexpression persisted in cells treated with either DMSO or Erastin (Figure 3D), indicating that FKBP9 expression is unaffected by ferroptosis induction. Collectively, we assessed GSH and ROS levels in HCT116 and HCT116‐FKBP9 cells post‐treatment. The findings demonstrated that, across both treatments, HCT116‐FKBP9 cells exhibited significantly higher GSH levels and lower ROS levels than HCT116 cells. In addition, GSH levels were reduced in Erastin‐treated cells compared to those in DMSO‐treated cells (Figure 3E). In contrast, ROS levels increased in both treatments (Figure 3F). MTT assays of Erastin‐treated cells showed a significant proliferation advantage for HCT116‐FKBP9 cells over HCT116 cells, underscoring FKBP9's role in promoting CRC cell proliferation.
3.4. FKBP9 Promotes CRC Proliferation via GPX4 Upregulation
To investigate how FKBP9 regulates ferroptosis, we examined the expression of three pivotal ferroptosis regulators: SLC7A11, NOX1, and GPX4. Significantly elevated GPX4 levels were observed in HCT116‐FKBP9 cells compared with HCT116 cells (Figure 4A), confirming FKBP9's role in enhancing GPX4 expression. We then knocked down GPX4 expression in HCT116‐FKBP9 cells, leading to increased FKBP9 and GPX4 expression levels relative to those in HCT116 cells. Notably, GPX4 expression was remarkably diminished in HCT116‐FKBP9‐shGPX4 cells compared to HCT116‐FKBP9 cells (Figure 4B), indicating successful GPX4 knockdown. To further demonstrate FKBP9's influence on ferroptosis, we evaluated GSH and ROS levels in HCT116, HCT116‐FKBP9, and HCT116‐FKBP9‐shGPX4 cells. GSH expression was significantly higher in HCT116‐FKBP9 cells, whereas ROS levels were significantly decreased. Conversely, GSH expression notably dropped in HCT116‐FKBP9‐shGPX4 cells compared to HCT116‐FKBP9 cells (Figure 4C), leading to pronounced ROS increases in HCT116‐FKBP9‐shGPX4 cells compared to controls (Figure 4D).
FIGURE 4.

Effects of FKBP9 Overexpression and GPX4 Knockdown on Ferroptosis‐Related Indicators and Cell Proliferation. (A) Western blot images showing the protein expression levels of key regulatory proteins of ferroptosis (SLC7A11, NOX1, GPX4) in HCT116 and HCT116‐FKBP9 cells. (B) Western blot images showing the protein expression levels of GPX4 and FKBP9 in HCT116‐FKBP9‐shGPX4 cells generated by lentivirus‐mediated GPX4 knockdown and in their HCT116 and HCT116‐FKBP9 counterparts. (C) Bar graph showing the level of glutathione (GSH) in HCT116, HCT116‐FKBP9, and HCT116‐FKBP9‐shGPX4 cells. (D) Bar graph showing the level of reactive oxygen species (ROS) in HCT116, HCT116‐FKBP9, and HCT116‐FKBP9‐shGPX4 cells. (E) MTT assay cell survival curve showing the proliferation ability of HCT116, HCT116‐FKBP9, and HCT116‐FKBP9‐shGPX4 cells. (F) MTT assay cell survival curve showing the proliferation ability of SW480, SW480‐FKBP9, and SW480‐FKBP9‐shGPX4 cells. (G) EdU results showing the proliferation ability of HCT116, HCT116‐FKBP9, and HCT116‐FKBP9‐shGPX4 cells. (H) EdU results showing the proliferation ability of SW480, SW480‐FKBP9, and SW480‐FKBP9‐shGPX4 cells. (I) Colony formation assay results showing the colony‐forming ability of HCT116, HCT116‐FKBP9, and HCT116‐FKBP9‐shGPX4 cells.
We next conducted MTT, EdU, and colon formation assays on HCT116, HCT116‐FKBP9, and HCT116‐FKBP9‐shGPX4 cells. Substantial proliferation increases were observed in HCT116‐FKBP9 cells compared with their HCT116 counterparts, whereas HCT116‐FKBP9‐shGPX4 cells exhibited significantly compromised proliferation capacity compared with HCT116‐FKBP9 cells (Figure 4E–G). Collectively, these findings suggest that FKBP9 enhances CRC cell proliferation by upregulating GPX4 expression.
3.5. FKBP9 Inhibits the Autophagic Degradation of GPX4
To elucidate the mechanism by which FKBP9 upregulates GPX4 protein expression, we first assessed the GPX4 half‐life in HCT116 and HCT116‐FKBP9 cells. We exposed the cells to CHX (100 μg/mL) for varying intervals (2, 4, or 6 h) and performed Western blotting. The GPX4 half‐life was notably longer in HCT116‐FKBP9 cells than in HCT116 cells (Figure 5A), indicating that FKBP9 overexpression inhibits GPX4 degradation. To identify the pathway involved in GPX4 degradation, we treated HCT116 cells with DMSO (control), CQ (an autophagy inhibitor), or MG132 (a proteasome inhibitor) and measured GPX4 expression by Western blotting. CQ treatment significantly elevated GPX4 levels compared with DMSO controls (Figure 5B), suggesting that GPX4 is predominantly degraded via autophagic–lysosomal pathways in CRC cells.
FIGURE 5.

FKBP9 Inhibits Autophagic Degradation of GPX4 Protein. (A) Western blot results showing the degradation of GPX4 protein at different time points (0, 2, 4, and 6 h) after treatment of HCT116 and HCT116‐FKBP9 cells with the protein synthesis inhibitor cycloheximide (CHX, 100 μg/mL), used to analyze its protein half‐life. (B) Western blot results showing GPX4 protein expression levels in HCT116 cells treated with DMSO (control), the autophagy inhibitor chloroquine (CQ), or the proteasome inhibitor MG132. (C) Immunoprecipitation (Co‐IP) results showing the protein binding of LC3B and GPX4 in HCT116 and HCT116‐FKBP9 cells. (D) Western blot results showing the expression levels of autophagy‐related marker proteins (ATG7, ATG5, LC3B) in HCT116 and HCT116‐FKBP9 cells. (E) Transmission electron microscopy (TEM) experiments showing the number of autophagosomes in HCT116 and HCT116‐FKBP9 cells.
Immunoprecipitation assays were conducted to analyze LC3B binding to GPX4, revealing that LC3B levels bound to GPX4 were markedly diminished in HCT116‐FKBP9 cells compared to HCT116 cells (Figure 5C), suggesting that FKBP9 plays a role in inhibiting the GPX4–LC3B interaction. Further analysis of the input data revealed elevated LC3B expression in HCT116‐FKBP9 cells compared with HCT116 cells (Figure 5C), indicating that FKBP9 enhances autophagy marker expression. We probed other autophagy markers in HCT116 and HCT116‐FKBP9 cells by Western blotting, revealing significantly higher protein levels of autophagy markers ATG7, ATG5, and LC3B in HCT116‐FKBP9 cells compared with HCT116 cells, indicating that FKBP9 activates the autophagic lysosomal signaling pathway. Finally, we confirmed that FKBP9 activates the autophagolysosomal pathway via TEM, as evidenced by a significantly greater number of autophagic vesicles in HCT116‐FKBP9 cells compared with HCT116 cells. Collectively, these results suggest that FKBP9 inhibits GPX4 autophagic degradation by preventing LC3B–GPX4 binding while concurrently activating the autophagolysosomal pathway in CRC cells (Figure 6).
FIGURE 6.

Proposed Model for FKBP9‐Mediated Promotion of CRC Cell Proliferation. In CRC cells, FKBP9 overexpression exerts its pro‐proliferative effect through a dual mechanism: [1] FKBP9 interferes with the interaction between GPX4 and the autophagy adaptor protein LC3B, thereby inhibiting the selective degradation of GPX4 via the autophagy–lysosome pathway, leading to GPX4 protein stabilization and accumulation; [2] simultaneously, FKBP9 activates the general autophagy signaling pathway, as evidenced by the upregulated expression of autophagy‐related proteins (e.g., ATG5, ATG7, and LC3B). This stabilized GPX4 effectively scavenges lipid peroxides, suppresses ferroptosis, and consequently promotes CRC cell proliferation.
4. Discussion
The findings of this study shed light on the complex interplay among FKBP9, GPX4, and the ferroptosis mechanism in CRC, providing crucial insights for the development of therapeutic strategies targeting these pathways. CRC is a significant global health concern, and understanding the molecular mechanisms that drive its progression is imperative for formulating effective treatment plans [16, 17]. This study explored how FKBP9 promotes CRC cell proliferation by inhibiting ferroptosis through GPX4 stabilization. We found that FKBP9 is overexpressed in CRC cells (HCT116, SW480) and that it increases GPX4 levels, reducing ROS and protecting against ferroptosis, thereby enhancing proliferation.
This study contributes to the growing body of literature on molecular pathways underlying CRC progression. Prior research has identified various factors that influence ferroptosis [18, 19, 20]; however, a significant gap persists regarding the molecular regulators that modulate GPX4 activity, particularly in the context of CRC. This dual contribution—confirming FKBP9's overexpression and its direct effects on GPX4—highlights the complex interplay between autophagic degradation pathways and cellular responses to oxidative stress. By situating our findings alongside existing literature, we demonstrate that FKBP9's role extends beyond mere overexpression; it actively participates in a feedback loop that enhances GPX4 expression while inhibiting its autophagic degradation. This positions FKBP9 as a pivotal player that may help combat the therapeutic resistance commonly observed in CRC patients, especially when treated with ferroptosis‐promoting agents.
Despite the promising results, several limitations must be considered when interpreting this study's outcomes. First, the focus on only two CRC cell lines limits the generalizability of our findings. Although HCT116 and SW480 provide useful insights, other CRC models should be explored to confirm FKBP9's universality across diverse genetic backgrounds. Additionally, our investigation into the autophagic degradation pathways involved highlights significant but perhaps underappreciated factors. For example, we observed that GPX4 expression was upregulated in cells treated with the proteasome inhibitor MG132, suggesting the involvement of the ubiquitin‐proteasome pathway alongside the autophagic pathway in regulating GPX4 levels in colon cancer [21]. This aspect remains inadequately explored in the current study, leaving room for future research to delineate the intricate molecular interactions mediating GPX4 degradation. Further, the specifics of how FKBP9 interacts with these pathways remain unclear, necessitating a more in‐depth investigation into the molecular mechanisms underlying these interactions. Moreover, the applicability of these findings in vivo remains to be established. Although our results indicate that FKBP9 promotes CRC cell proliferation under controlled conditions, it is necessary to explore how these dynamics translate in more complex biological systems. Animal models are essential for determining whether FKBP9 is a viable therapeutic target and for examining its potential interactions with other cellular pathways involved in tumor proliferation and progression.
Given the identified limitations, several recommendations emerge for future research directions. First, expanding the scope of investigation to include additional CRC cell lines and exploring primary tumor samples could help validate FKBP9's role across different CRC variants. This approach may also facilitate the identification of predictive biomarkers that could guide the development of individualized treatment plans according to FKBP9 and GPX4 expression levels. Moreover, analyzing the relationship between FKBP9 and the ubiquitin–proteasome degradation pathway would provide comprehensive insights into the multifaceted mechanisms regulating GPX4 in colon cancer. Investigating other proteins that may regulate FKBP9 activity or stability could further illuminate the regulatory network modulating ferroptosis in cancer cells. Finally, elucidating the potential for targeting FKBP9 in therapeutic contexts could yield promising results. Developing FKBP9 inhibitors or small molecules that can effectively disrupt its interaction with GPX4 or its regulatory pathways may potentiate new treatment strategies. Such strategies could enhance CRC cell sensitivity to ferroptosis and ultimately improve patient survival outcomes.
In conclusion, this study underscores the significant role of FKBP9 in regulating GPX4‐mediated ferroptosis and promoting CRC cell proliferation. By addressing existing knowledge gaps and highlighting the clinical implications of our findings, we lay the groundwork for future investigations aimed at tailoring treatment approaches targeting these critical molecular pathways.
Author Contributions
Jianzhong Deng: methodology (lead), writing – original draft (lead), writing – review and editing (lead). Anqi Jiang: data curation (lead), methodology (supporting). Xizheng Zhang: investigation (supporting), visualization (lead). Jiayu Wei: software (lead), validation (supporting). Qian Liu: conceptualization (supporting), funding acquisition (lead). Ying Shen: writing – original draft (equal), writing – review and editing (equal). Dong Hua: conceptualization (equal), project administration (lead), resources (lead).
Funding
This work was supported by Open Project of Key Laboratory of Xuzhou Medical University in Jiangsu Province, XZSYSKF2023034 the National Natural Science Foundation of China, 81872275 the Changzhou High Level Medical Talents Training Project, 2022CZBJ110.
Disclosure
Animal Studies: Yes.
Ethics Statement
This study was approved by the Ethics Committee of Wujin Hospital affiliated with Jiangsu University. All participants were notified, and they provided consent prior to the initiation of the research. Approval of the research protocol by an Institutional Review Board: Yes (2024‐SR‐129).
Consent
The authors have nothing to report.
Conflicts of Interest
The authors declare no conflicts of interest.
Supporting information
Table S1: Heatmap of differentially expressed genes (DEGs) in the TCGA dataset.
Table S2: List of genes exhibiting significantly reduced protein expression after knockout of the NKD1 gene.
Table S3: Differential expression between tumor and adjacent normal tissues of all TCGA tumors.
Acknowledgments
We thank LetPub (https://www.letpub.com.cn/) for its linguistic assistance during the preparation of this manuscript.
Contributor Information
Ying Shen, Email: novfif@163.com.
Dong Hua, Email: wx89211@163.com.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
References
- 1. Grancher A., Cuissy S., Girot H., Gillibert A., Di Fiore F., and Guittet L., “Where Do We Stand With Screening for Colorectal Cancer and Advanced Adenoma Based on Serum Protein Biomarkers? A Systematic Review,” Molecular Oncology 18, no. 11 (2024): 2629–2648. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Keshavarzi F., Salari N., Jambarsang S., Mohammad Tabatabaei S., Shahsavari S., and Fournier A. J., “Overall Survival With Non‐Proportional Hazards in First‐Line Treatment for Patients With Metastatic Colorectal Cancer: Systematic Review and Network Meta‐Analysis,” Heliyon 10, no. 16 (2024): e36464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Xiaoxia F., Rui L., Meiru C., Lu Y., and Ying J., “CD147 Regulates the Rap1 Signaling Pathway to Promote Proliferation, Migration, and Invasion, and Inhibit Apoptosis in Colorectal Cancer Cells,” Scientific Reports 15, no. 1 (2025): 13647. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Qu S., Feng B., Xing M., et al., “PRMT5 K240lac Confers Ferroptosis Resistance via ALKBH5/SLC7A11 Axis in Colorectal Cancer,” Oncogene 44 (2025): 2814–2830. [DOI] [PubMed] [Google Scholar]
- 5. Zhao Z., He J., Qiu S., et al., “Targeting PLK1‐CBX8‐GPX4 Axis Overcomes BRAF/EGFR Inhibitor Resistance in BRAFV600E Colorectal Cancer via Ferroptosis,” Nature Communications 16, no. 1 (2025): 3605. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Guo Z., Zhuang H., and Shi X., “Therapeutic Efficacy of Ferroptosis in the Treatment of Colorectal Cancer (Review),” Oncology Letters 28, no. 6 (2024): 563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Liu Y., Wang Y., Liu J., Kang R., and Tang D., “Interplay Between MTOR and GPX4 Signaling Modulates Autophagy‐Dependent Ferroptotic Cancer Cell Death,” Cancer Gene Therapy 28, no. 1–2 (2021): 55–63. [DOI] [PubMed] [Google Scholar]
- 8. Kong D., Liu Y., Li L., Wang H., Li K., and Zheng G., “Astaxanthin Ameliorates Oxidative Stress in Lens Epithelial Cells by Regulating GPX4 and Ferroptosis,” Chemico‐Biological Interactions 383 (2023): 110684. [DOI] [PubMed] [Google Scholar]
- 9. Jo D., Lyu M. S., Cho E. G., Park D., Kozak C. A., and Kim M. G., “Identification and Genetic Mapping of the Mouse Fkbp9 Gene Encoding a New Member of FK506‐Binding Protein Family,” Molecules and Cells 12, no. 2 (2001): 272–275. [PubMed] [Google Scholar]
- 10. Jiang F. N., Dai L. J., Yang S. B., et al., “Increasing of FKBP9 Can Predict Poor Prognosis in Patients With Prostate Cancer,” Pathology, Research and Practice 216, no. 1 (2020): 152732. [DOI] [PubMed] [Google Scholar]
- 11. Li S., Xia W., Sun B., et al., “The Stability of FKBP9 Maintained by BiP Is Crucial for Glioma Progression,” Genes Dis 11, no. 6 (2024): 101123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Dai Y., Liu J., Li X., et al., “Let‐7b‐5p Inhibits Colon Cancer Progression by Prohibiting APC Ubiquitination Degradation and the Wnt Pathway by Targeting NKD1,” Cancer Science 114, no. 5 (2023): 1882–1897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Wang Y., Yang C., Li W., et al., “Identification of Colon Tumor Marker NKD1 via Integrated Bioinformatics Analysis and Experimental Validation,” Cancer Medicine 10, no. 20 (2021): 7383–7394. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Cao J., Tao X., Shi B., et al., “NKD1 Targeting PCM1 Regulates the Therapeutic Effects of Homoharringtonine on Colorectal Cancer,” Molecular Biology Reports 50, no. 8 (2023): 6543–6556. [DOI] [PubMed] [Google Scholar]
- 15. Lu W., Tang J., Wang Y., et al., “NKD1 Enhances Colon Cancer Progression by Inhibiting the Autophagic Degradation of MYC,” Cell Death and Disease 16, no. 1 (2025): 532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Lecumberri A., Arasanz H., Caseda I., et al., “CAR‐T Therapy for the Treatment of Colorectal Cancer,” Discovery Medicine 37, no. 195 (2025): 618–630. [DOI] [PubMed] [Google Scholar]
- 17. Drosdowsky A., Lamb K. E., te Marvelde L., Gibbs P., Dunn C., and Faragher I., “Factors Associated With Diagnostic and Treatment Intervals in Colorectal Cancer: A Linked Data Study,” International Journal of Cancer 157 (2025): 687–697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Yang Q., Zhang H., Luo J., Yu H., Yang X., and Wang C., “FADS2 Inhibits Colorectal Cancer Cell Proliferation by Regulating Ferroptosis Through SLC7A11/GPX4,” Molecular Biology Reports 52, no. 1 (2025): 394. [DOI] [PubMed] [Google Scholar]
- 19. Ding Q., Zhuang Y., Yang H. Y., Zhao X. N., and Sun Y. N., “USP31 Confers Radio‐Resistance in Cervical Cancer Cells via Ferroptosis Pathway by Deubiquitinating and Stabilizing GPX4,” Biochemical and Biophysical Research Communications 770 (2025): 151990. [DOI] [PubMed] [Google Scholar]
- 20. Jin Y., Wen J., Geng Z., et al., “Baicalin Inhibits Lung Cancer Cell Proliferation and Migration via ALOX12‐Mediated Ferroptosis,” Anti‐Cancer Agents in Medicinal Chemistry 25 (2025): 1642–1659. [DOI] [PubMed] [Google Scholar]
- 21. Wang H. J., Dong L. F., Ding L. L., et al., “TFEB Promotes Ginkgetin‐Induced Ferroptosis via TRIM25 Mediated GPX4 Lysosomal Degradation in EGFR Wide‐Type Lung Adenocarcinoma,” Theranostics 15, no. 7 (2025): 2991–3012. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1: Heatmap of differentially expressed genes (DEGs) in the TCGA dataset.
Table S2: List of genes exhibiting significantly reduced protein expression after knockout of the NKD1 gene.
Table S3: Differential expression between tumor and adjacent normal tissues of all TCGA tumors.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
