Skip to main content
Ecology and Evolution logoLink to Ecology and Evolution
. 2026 Jun 1;16(6):e73746. doi: 10.1002/ece3.73746

Under Surveyed and Under Pressure: Additional Biodiversity Uncovered in the Freshwater Mussels (Unionida: Velesunioninae) of North‐Western Australia

Angus D' Arcy Lawrie 1,, Jake Ryan Daviot 2, Adam Harman 3, Christopher Hofmeester 4, Joel Huey 4
PMCID: PMC13239821  PMID: 42256163

ABSTRACT

Accurate species delimitation underpins freshwater biodiversity assessment and conservation, yet taxonomic uncertainty remains a major impediment for many invertebrate groups. Velesunioninae (Unionida; Hyriidae) constitutes the most diverse group of Australian freshwater mussels but is poorly documented in the Kimberley and Pilbara regions of north‐western Australia, where only three species have been reported across an area spanning ~930,000 km2. These distributions have historically been inferred from shell morphology, despite evidence that shell characters can overlap among species and that genetic data have identified species complexes elsewhere in Australia. Here we integrate genetic and morphological data to test for the presence of undescribed species within Velesunioninae collected from five drainages across north‐western Australia. Phylogenetic analyses of multi‐locus molecular data (COI, 16S, 28S and 18S) identified five discrete lineages, including one described species ( Lortiella froggatti ), one previously recognised undescribed lineage (Velesunio ‘sp. Lineage A’) and three previously unknown lineages. Except for L. froggatti which displayed a distinct shell morphology, morphological characters were unreliable in distinguishing Velesunio lineages. Velesunio ‘sp. Lineage A’ and L. froggatti were identified across large geographic distances (1320 km and 550 km, respectively), while the three novel Velesunio lineages showed more restricted distributions. Overall, our results suggest that the apparently widespread morpho‐species previously reported from north‐western Australia may instead comprise complexes of both broadly distributed and geographically restricted undescribed taxa. Further targeted genetic surveys will be necessary to clarify species distributions and support conservation management of freshwater mussels in a region increasingly affected by water extraction and mineral development.

Keywords: freshwater mussels, Hyriidae, Microdontia, rivers, species delimitation, taxonomy Alathyria , Westralunio


Here, we tested for cryptic diversity within freshwater mussels in north‐western Australia and identified multiple undescribed lineages. Distributional patterns were complex with some taxa displaying evidence of potentially recent long‐distance dispersal whereas others were more restricted in their distributions. Overall, these findings suggest that the current reported distributions of freshwater mussels in north‐western Australia are likely misleading.

graphic file with name ECE3-16-e73746-g004.jpg

1. Introduction

Effective ecosystem management is contingent on the ability to classify organisms (McNeely 2002) yet only a fraction of global biodiversity is believed to be accounted for (Mora et al. 2011). This is especially the case in hyper‐diverse invertebrate groups that have received a comparatively lower proportion of research effort than vertebrates (Troudet et al. 2017). Freshwater aquatic invertebrates are at disproportionate risk of extirpation given inland freshwater environments are some of the most threatened ecosystems globally (Dudgeon et al. 2006; Reid et al. 2019). The lack of basic taxonomic information is a significant impediment to our understanding of the conservation status of many invertebrates, despite some groups displaying concerning levels of decline and, in some cases, extinctions (Strayer 2006).

Freshwater mussels (Unionida) are important ecosystem engineers of freshwater environments (Vaughn 2018). They improve water quality by filtering out algae, bacteria and suspended solids, contribute to the recycling and storage of nutrients and provide crucial habitat for co‐inhabiting aquatic species (Daviot et al. 2025; Vaughn 2018). However, freshwater mussels are particularly susceptible to environmental disturbances due to biological traits including delayed sexual maturity, sedentary adults and environmentally sensitive juvenile/larval stages (Benson et al. 2021; Böhm et al. 2021). These characteristics, combined with global declines in freshwater ecosystems, have made mussels one of the most threatened animal groups (Lopes‐Lima et al. 2018). A higher proportion of described mussel species are listed on the IUCN Red List than mammals, birds or reptiles, and current estimates suggest that 44% of all described species are of conservation concern (Lopes‐Lima et al. 2018).

Although relatively well taxonomically characterised in the northern hemisphere, comparably less is known about the freshwater mussels from the southern hemisphere (Graf and Cummings 2021). The majority of Australian Unionida belong to the Velesunioninae (Hyriidae) which currently contains the five genera: Velesunio, Alathyria, Westralunio, Microdontia and Lortiella (Klunzinger et al. 2023). A total of 13 described species occur in Australia with Velesunio sentaniensis (Haas, 1924), Microdontia anodontaeformis (Tapparone Canefri, 1883), Westralunio flyensis (Tapparone Canefri, 1883) and Westralunio albertisi Clench, 1957 reported from Papua New Guinea (Graf and Cummings 2021). Historically, differences in external morphological characters including beak and shell sculpture have been used to distinguish genera and species (Walker et al. 2014). However, these characters have been observed to vary within and between different species depending on local environmental factors, complicating the identification of some species from morphology alone (Baker et al. 2003, 2004; Sheldon 2017). Further, genetic data have suggested that Velesunio and Alathyria are paraphyletic and require taxonomic revision (Baker et al. 2004).

The diversity and distribution of Velesunioninae in the Kimberley and Pilbara regions (hereafter north‐western Australia) have been particularly poorly characterised, with currently only three Velesunioninae species reported from this ~930,000 km2 area: Velesunio wilsonii (Lea, 1859), Velesunio angasi (Sowerby, 1867) and Lortiella froggatti (Iredale 1934) (Kirkendale et al. 2022; Klunzinger et al. 2013; Ponder and Bayer 2004). Available distributional data suggest that V. wilsonii , V. angasi and L. froggatti have broad distributions, occurring across multiple drainage basins within north‐western Australia (Ponder et al. 2024). Such broad, multi‐drainage distributions are unusual when compared with several other freshwater taxa in the region, including fishes (Pepper and Keogh 2014) and caridean shrimps (Cook et al. 2011), where discrete drainage basins or river catchments are frequently associated with genetically isolated populations or distinct species (Huey et al. 2014).

Molecular data have been central to identifying these speciation patterns in other freshwater groups and have repeatedly revealed undescribed biodiversity within morphologically conserved, geographically widespread species (Pepper and Keogh 2014). Whether this pattern applies to Velesunioninae in north‐western Australia remains unclear because, with the exception of L. froggatti (Graf et al. 2015), there are no publicly available genetic data for specimens collected from this region. Elsewhere in Australia, molecular studies have demonstrated that identifying species via only external shell morphology can underestimate diversity within the Velesunioninae, with genetically distinct lineages exhibiting subtle (Klunzinger et al. 2021, 2022) or inconclusive (Baker et al. 2003, 2004) morphological differences. This includes the morphotype currently recognised as V. wilsonii that is apparently common in north‐western Australia but has been shown to comprise at least three distinct genetic lineages in eastern Australia (Baker et al. 2003). Therefore, it is unclear whether current biodiversity estimates accurately reflect the true diversity of Velesunioninae in north‐western Australia. This is concerning given the significant mineral resource developments in the region and associated pressures on its water resources, including mine dewatering (abstraction) operations (Environmental Protection Authority 2018).

To address these uncertainties, we applied an integrative taxonomic framework combining multi‐locus molecular data and shell morphology to specimens of Velesunioninae collected across five drainage systems in north‐western Australia. Specifically, we aimed to (1) test whether the currently reported species from the region ( V. wilsonii , V. angasi and L. froggatti ) are supported by genetic evidence or instead comprise multiple lineages, and (2) evaluate the geographic distributions of the recovered lineages across drainage systems. We hypothesised that, consistent with patterns observed in other freshwater taxa from north‐western Australia, the apparently widespread Velesunioninae morpho‐species would comprise distinct genetic lineages with restricted drainage‐level distributions.

2. Methods

2.1. Sampling

Live Velesunioninae specimens (n = 43) were obtained between April 2021 and October 2025 from nine waterbodies from five drainages across north‐western Australia (Table 1). Specimens were collected via systematic and targeted hand foraging among soft (sand and silt) sediments and littoral bank margins, up to maximum wadable depths. Hand foraging was also undertaken in the hyporheic zone at Stony Creek, where saturated subsurface sediments were present under recessional wet season flows. Specimens were frozen whole for 24 h and preserved in 100% ethanol until analysis. All specimens were deposited with the Western Australian Museum (see Table A1 for registration numbers).

TABLE 1.

Collection details for the Velesunioninae collected in this study.

Species Site Drainage Date Latitude Longitude COI 16S 28S 18S
Lortiella froggatti Long Pool, Coongan River De Grey River 15/05/2025 −20.9019 119.7886 12 5 5 4
Lower Myroodah, Fitzroy River Fitzroy River 5/10/2025 −18.0817 124.2198 2 2 1
Velesunio ‘sp. Lineage A’ Rocky Waterhole, Sturt Creek Sandy Desert 21/05/2025 −18.6659 128.5530 1 1 1 1
Velesunio ‘sp. Lineage E’ Stony Creek, Ord River Ord‐Pentecost Rivers 25/05/2021 −17.3387 128.0497 9 9 8 4
Dunham River Tributary Ord‐Pentecost Rivers 15/06/2021 −16.4482 127.9584 1 1
Blina Creek, Fitzroy River Fitzroy River 5/10/2025 −17.9624 124.2879 5 5 5
Velesunio ‘sp. Lineage F’ Yule River Port Hedland Coast 1/11/2021 −20.7015 118.2985 6 6 6 4
Velesunio ‘sp. Lineage G’ Anjammie Pool, Sturt Creek Sandy Desert 23/05/2025 −18.7863 128.3233 1 1 1
Rocky Waterhole, Sturt Creek Sandy Desert 21/05/2025 −18.6659 128.5530 3 5 5
Stretch Lagoon, Sturt Creek Sandy Desert 25/05/2025 −19.6791 127.5874 1 1 1
Total 40 36 33 14

Note: Numbers in COI, 16S, 28S and 18S columns refer to the number of individuals sequenced for that gene from each site. See Table A1 for GenBank accession and Western Australian Museum registration numbers for the material in this study. Drainage information was collected from Commonwealth of Australia (Bureau of Meteorology): https://www.bom.gov.au/water/about/riverBasinAuxNav.shtml.

2.2. DNA Extraction, Amplification and Sequencing

For each specimen, genomic DNA was extracted from approximately 2.5 mg of foot tissue, using the Qiagen DNeasy Blood and Tissue kit, following the manufacturer's instructions for tissue samples.

Polymerase chain reaction (PCR) was used to amplify four gene regions using published primer pairs (Table 2). Reaction mixtures consisted of 12.5 μL Bioline MyTaq RedMix, 1 μL (0.2 μM) of each primer, 9.5 μL of PCR grade water and 2 μL DNA.

TABLE 2.

Primers used to amplify and sequence portions of COI, 16S, 28S and 18S in the Velesunioninae in this study.

Gene Name Direction Sequence Length (bp) References
COI LCO1490 F 5′‐GGTCAACAAATCATAAAGATATTGG‐3′ 658 Folmer et al. (1994)
HCO2198 R 5′‐TAAACTTCAGGGTGACCAAAAAATCA‐3′
16S 16sar‐L F 5′‐CGCCTGTTTATCAAAAACAT‐3′ ~482 Palumbi et al. (2002)
16sbr‐H R 5′‐CCGGTCTGAACTCAGATCACGT‐3′
28S 28sD1f F 5′‐ACCCSCTGAAYTTAAGCAT‐3′ ~1323 Colgan et al. (2003)
28ffr R 5′‐GGTGAGTTGTTACACACTCCTTAGCGGAT‐3′ Hillis and Dixon (1991)
18S 1F F 5′‐TACCTGGTTGATCCTGCCAGTAG‐3′ ~1668 Giribet et al. (1996)
9R R 5′‐GATCCTTCCGCAGGTTCACCTAC‐3′

The PCR amplification conditions for the COI region were: (i) an initial denaturation phase of 5 min at 95°C; (ii) 7 cycles of 30 s denaturation at 95°C, 30 s of annealing at 45°C and 1 min of extension at 72°C then 35 cycles of 30 s denaturation at 95°C, 30 s of annealing at 50°C and 1 min of extension at 72°C; and (iii) a final 7 min extension at 72°C. The conditions for the 16S region were: (i) an initial denaturation phase of 5 min at 95°C; (ii) 40 cycles of 30 s denaturation at 95°C, 30 s of annealing at 50°C and 1 min of extension at 72°C; and (iii) a final 7 min extension at 72°C. The 28S and 18S genes were amplified using: (i) an initial denaturation phase of 5 min at 95°C; (ii) 35 cycles of 45 s denaturation at 95°C, 1 min of annealing at 52°C and 1.5 min extension at 72°C; and (iii) a final 7 min extension at 72°C.

The outcomes of PCR assays were assessed using a 2% agarose gel stained with SYBR Safe (Invitrogen). Negative controls that contained no DNA were run in all PCR reactions to test for the presence of contaminants. PCR products were purified using Exo‐SAP (Dugan et al. 2002) and sequenced bidirectionally in an automatic ABI 3700 sequencer (Applied Biosystems) at Macrogen Inc. (Korea). The forward and reverse sequences were assembled into consensus sequences in Geneious Prime 2023 (Kearse et al. 2012). All 43 individuals were successfully sequenced for at least one genetic marker, although amplification success varied among loci (Table 1; Table A1).

2.3. Phylogenetic Analyses

The analysis comprised single locus COI, 16S and 28S datasets as well as a concatenated dataset of all genes. Although 18S sequences were generated for 14 individuals including representatives of all lineages generated as part of this study, the data contained insufficient variation to be phylogenetically informative and were subsequently excluded from the analyses. The single gene analyses contained COI = 40, 16S = 36 and 28S = 33 individuals while the concatenated analysis comprised a total of 32 individuals successfully sequenced for all three genes. Additional COI, 16S and 28S sequences from the Velesunioninae, Hyriinae and Unionidae were downloaded from GenBank (Table A2).

All analysed genes were aligned using MAFFT plugin (Katoh et al. 2002) with the E‐INS‐I method and uncorrected genetic distances between haplotypes calculated for all markers. Unio pictorum (Unionidae) was used as the outgroup in all analyses following Graf et al. (2015). All generated sequences were uploaded to GenBank (see Table A1).

Phylogenetic relationships were inferred using maximum likelihood (ML) and Bayesian inference (BI) with the model of evolution selected using the corrected Akaike's information criterion in jModelTest v.2.1.10 (Darriba et al. 2012). ML analyses were conducted in Geneious Prime 2023 (Kearse et al. 2012) using the RAxML plugin under a GTR + G model with 1000 bootstrap replicates with nodes above 75% considered well supported (Lemey et al. 2009). Bayesian analyses were performed in MrBayes v.3.2.7 (Ronquist and Huelsenbeck 2003) using a GTR + G substitution model in a Markov chain Monte Carlo framework. Analyses were run for 10,000,000 generations with four concurrent chains (one cold and three heated; temperature = 0.2), sampling every 1000 generations. The first 25% of samples were discarded as burn‐in, and the remaining trees were used to estimate the majority‐rule consensus topology and Bayesian posterior probabilities (BPP). Only nodes with BPP > 0.90 were regarded as strongly supported (Drummond and Rambaut 2007). COI was partitioned by codon position, and concatenated analyses were partitioned into five subsets (COI codon positions 1–3, 16S, 28S).

2.4. Morphology

Notwithstanding the known uncertainties around identifying Velesunioninae taxa using the current morpho‐taxonomy, identification of specimens was done using McMichael and Hiscock (1958). Five shell measurements were recorded: total shell length (TL), beak height (BH), maximum shell height (MH), long beak length (LBL) and shell width (W) were measured as per McMichael and Hiscock (1958). A morphometric analysis was conducted on five shell ratios to test whether genetic lineages had characteristically different shell dimensions. These were the maximum height index (MHI = MH/TL), beak height index (BHI = BH/MH), beak length index (BLI = LBL/TL), width length index (WLI = W/TL), width height index (WHI = W/MH). Shell ratios were then analysed via Linear Discriminant Analysis (LDA) performed in R version 4.0.4. LDA was chosen because it models the difference between defined groups, here genetic lineages. All raw shell measurements and ratios are provided in Table A3.

3. Results

3.1. Phylogenetic Analysis

For clarity, the genetic lineages below have already been identified and assigned a name. Although larger fragments of COI, 16S and 28S were generated in this study, the analysed fragments (COI = 473 bp, 16S = 415 bp and 28S = 413 bp) were trimmed to match the lengths of the available comparable sequence data.

The concatenated dataset comprised a total of 1301 bp with 19 haplotypes generated in this study and 23 haplotypes downloaded from GenBank. The topologies of the phylogenetic trees inferred by ML and BI analyses of this dataset were essentially congruent although the degree of support for some branching patterns did differ (Figure 1; see Appendix A for single gene trees).

FIGURE 1.

FIGURE 1

Phylogenetic tree depicting the relationship among Hyriidae lineages in the partitioned concatenated COI, 16S and 28S dataset (total of 1301 bp) estimated using Bayesian inference using the GTR + G model of evolution. Node support is indicated by Bayesian posterior probabilities (BPP; above) and bootstrap values (below) with * reflecting nodes with bootstrap support > 98% and BPP > 0.98. Lineages sequenced as part of this study have been coloured. Images of adjacent species are not to the same scale but are of sequenced specimens.

Phylogenetic analyses of the concatenated dataset resolved the Hyriinae and Velesunioninae as distinct clades, although the support separating the clades received strong support in the BI analysis (BPP = 1) but not in the ML analysis. The position of the Westralunio lineages within the Velesunioninae was not recorded with statistically significant support in the concatenated (Figure 1), COI (Figure 2), 16S or 28S trees (Figures A1, A2, A3, A4). However, within the Velesunioninae, Velesunio, Alathyria, Microdontia and Lortiella formed a universally well‐supported clade (Figure 1). As expected, neither Velesunio nor Alathyria lineages formed reciprocally monophyletic clades in any of the analyses (e.g., Figure 1). The two Lortiella lineages ( L. froggatti and L. rugata ) did form a well‐supported clade (BPP = 1, BS = 100%).

FIGURE 2.

FIGURE 2

COI phylogenetic tree depicting the relationships among the Velesunioninae (excluding Westralunio) estimated using Bayesian inference and the GTR + G model of evolution. Node support is indicated by Bayesian posterior probabilities (BPP; above) and bootstrap values (below) with * reflecting nodes with bootstrap support > 98% and BPP > 0.98.

3.2. Species Delimitation

The specimens sequenced in this study formed five monophyletic lineages in the ML and BI analysis of all genes. Across the three loci, maximum intraspecific divergences within these lineages were consistently lower than the minimum interspecific divergences between lineages (Table 3). COI maximum intraspecific distances for these five lineages were 2.3%, whereas minimum interspecific distances were 2.5%. Similarly, 16S exhibited low intraspecific variation (maximum = 0.8%) relative to interspecific divergence (minimum = 4.5%), while 28S showed very limited intraspecific divergences but these were still lower than the minimum interspecific distances between each lineage (Table 3).

TABLE 3.

Summary of intraspecific (Intra) and interspecific (Inter) uncorrected pairwise distances for COI, 16S and 28S generated during this study.

Species COI 16S 28S
Intra Inter Intra Inter Intra Inter
Lortiella froggatti 0.21–0.42 2.54–17.12 NA 5.54–22.42 0.26 1.03–19.33
Velesunio ‘sp. Lineage A’ 0.21–2.33 7.82–18.60 0.25–0.76 7.56–23.99 NA 1.03–18.39
Velesunio ‘sp. Lineage E’ 0.21–2.11 7.19–18.18 0.25–0.50 4.52–22.11 0.25–0.51 1.53–19.74
Velesunio ‘sp. Lineage F’ NA 7.19–18.05 0.13 4.52–21.97 1.02 1.53–21.13
Velesunio ‘sp. Lineage G’ 0.21–1.06 9.51–18.60 0.25–0.50 5.28–23.17 NA 0.77–18.39

Note: Pairwise distances are presented as percentages in the format minimum–maximum. NA values indicate the taxon was represented by a single haplotype.

The COI and 16S sequences of ‘ Alathyria jacksoni ’ reported by Graf et al. (2015) and Baker et al. (2004) differ by 10.7% and 9.8% respectively, and were resolved as distinct lineages in the phylogenetic analysis (e.g., Figures 1 and 2). In addition, one of the two ‘ Alathyria pertexta ’ specimens reported in Graf et al. (2015) from Queensland, Australia had COI and 16S pairwise differences of 0.21% and 0.25% from the ‘ Alathyria jacksoni ’ sequences reported by Baker et al. (2004). The second ‘ Alathyria pertexta ’ specimen from New South Wales, Australia formed a distinct branch which was at least 5.7% (COI) and 1.6% (16S) divergent from the next most similar sequence in the analysis (see Table A4).

3.3. Drainage Patterns

Two of the five lineages (V. ‘sp. Lineage F’ and V. ‘sp. Lineage G’) were collected from one drainage while the remaining three lineages were found across two (V. ‘sp. Lineage E’ and L. froggatti ) or three (V. ‘sp. Lineage A’) drainages, respectively. Velesunio ‘sp. Lineage A’ displayed genetic structuring corresponding with two drainages (Diamantina‐Georgina and Cooper Creek‐Bulloo) in central‐eastern Australia with the specimen collected from the Sandy Desert nested within haplotypes from Diamantina‐Georgina (Figure 2). Despite a geographic distance of 1320 km, the minimum pairwise COI divergence between these drainages was 0.42%. Similarly, L. froggatti collected from the Fitzroy and De Grey drainage areas, which are separated by 550 km, had minimum pairwise COI divergences of 0.21% while the two V. ‘sp. Lineage E’ populations collected from the Ord‐Pentecost differed more from each other (1.69%) than to the Fitzroy population (1.26%).

3.4. Morphology

The shells of four lineages: V. ‘sp. Lineage A’, V. ‘sp. Lineage E’, V. ‘sp. Lineage F’ and V. ‘sp. Lineage G’ were identified as Velesunio while one lineage ( L. froggatti ) was identified as Lortiella. Velesunio ‘sp. Lineage E’ and V. ‘sp. Lineage F’ resembled the morphological description of V. angasi , while V. ‘sp. Lineage A’ and V. ‘sp. Lineage G’ displayed shell morphologies consistent with V. wilsonii . The morphologies of the Lortiella specimens were consistent with those of L. froggatti (Table A3).

All 43 sequenced specimens were included in the morphometric analysis. Lineage separation was dominated by the first discriminant axis (LD1 = 84.9%), with only minor additional separation along the second axis (LD2 = 9.5%; Figure 3). Leave‐one‐out cross‐validated LDA correctly classified all individuals of L. froggatti , 83.3% of V. ‘sp. Lineage F’, 80% of V. ‘sp. Lineage E’ and 71.4% of V. ‘sp. Lineage G’. Misclassification occurred primarily between V. ‘sp. Lineage E’ and V. ‘sp. Lineage G’. V. ‘sp. Lineage A’ clustered within the morphospace of V. ‘sp. Lineage E’ and V. ‘sp. Lineage G’, but the single specimen was excluded from the leave‐one‐out cross‐validation analysis.

FIGURE 3.

FIGURE 3

Linear discriminant analysis (LDA) of shell morphometric ratios for the Velesunioninae species included in this study. Points represent individual specimens, coloured and shaped by lineage with shaded polygons indicating convex hulls encompassing each group.

Separation along LD1 was driven primarily by the maximum height index which separated the narrowly elongated shells of L. froggatti from the broader shelled Velesunio lineages. Velesunio ‘sp. Lineage F’ exhibited the most distinct shell shapes of the four Velesunio lineages, separated primarily by relatively wider, more laterally inflated shells and lower shell height relative to length.

4. Discussion

Analyses of multiple molecular loci revealed five distinct Velesunioninae lineages, indicating that the biodiversity of this group in north‐western Australia has been underestimated and that the distributions of some species are likely more restricted than previously assumed. Except for L. froggatti which displayed a distinct shell morphology, morphological characters were generally insufficient to reliably distinguish among the lineages, highlighting the importance of molecular data for resolving species boundaries in this group. Our phylogenetic analyses also indicate that the position of Westralunio within the Hyriidae requires further clarification. Together, these findings have important implications for understanding the diversity, taxonomy and management of freshwater mussels in north‐western Australia.

4.1. Velesunioninae in North‐Western Australia

The specimens collected in this study were morphologically consistent with the three Velesunioninae species currently reported from north‐western Australia ( L. froggatti , V. wilsonii and V. angasi ). However, L. froggatti was the only species that could be confidently identified from its shell morphology. In contrast, both V. wilsonii and V. angasi morphotypes contained multiple highly divergent genetic lineages. Specimens assigned morphologically to V. wilsonii comprised V. ‘sp. Lineage A’ and V. ‘sp. Lineage G’, with the former lineage previously identified by Baker et al. (2003) as one of three genetically distinct eastern Australian lineages exhibiting this morphotype. Similarly, specimens resembling V. angasi comprised two deeply divergent lineages (V. ‘sp. Lineage E’ and V. ‘sp. Lineage F’), both of which differed from the published COI sequence for V. angasi generated by Bogan and Hoeh (2000), assuming the identity of this sequence has been correctly assigned. These findings suggest that the apparent broad distributions previously attributed to V. wilsonii and V. angasi may instead reflect complexes of morphologically similar species with more restricted geographic ranges (although see V. ‘sp. Lineage A’ below). It is also possible that V. wilsonii and V. angasi sensu stricto do occur in north‐western Australia, however, until the taxonomy of these species is clarified, their currently reported distributions should be treated with caution.

This pattern of previously unrecognised diversity is consistent with broader phylogeographic patterns observed in freshwater taxa across north‐western Australia, where molecular studies have revealed strong genetic structuring and limited connectivity among populations that were previously assumed to be widely distributed (Huey et al. 2014). Because freshwater mussels disperse to new habitats primarily via parasitic attachment of their glochidia to host fishes (Daviot et al. 2026; Klunzinger et al. 2010, 2012), patterns of distribution and genetic structure are ultimately shaped by the movement and connectivity of their hosts. In eastern Australia, population genetic studies of Velesunio including V. ‘sp. Lineage A’ have suggested that contemporary gene flow is often strongly restricted both between drainages and even among waterholes within the same drainage, implying limited effective dispersal via host fishes (Hughes et al. 2004). Interestingly, we observed very little differentiation at COI between the population of Velesunio ‘sp. Lineage A’ collected here from its previously known distribution in central‐eastern Australia approximately 1320 km away. Similarly, the two L. froggatti populations examined here showed low levels of COI divergence despite occurring in different drainage systems currently separated by the Great Sandy Desert. These patterns suggest that rare long‐distance dispersal events may occasionally occur, potentially facilitated by highly mobile and widely distributed host fishes (e.g., spangled perch Leiopotherapon unicolor ; Bostock et al. 2006) during major flood events, or that connectivity among drainage systems was greater under past climatic regimes and sea‐level conditions than is observed today. However, disentangling the relative contributions of these factors to the distributional patterns observed among lineages remains difficult from the current sampling. Resolving this will require broader population‐level sampling across drainages and an assessment of host associations and habitat conditions.

4.2. Velesunioninae

Our phylogenetic analyses recovered Westralunio as a sister lineage to a well‐supported clade comprising the remaining Velesunioninae genera (Velesunio, Alathyria, Lortiella and Microdontia), although this relationship was not significantly supported in either the concatenated or single‐gene analyses. Similar results have been reported in previous molecular phylogenies of the Hyriidae, where Westralunio was recovered outside a well‐supported clade containing Velesunio, Alathyria, Lortiella and Microdontia, with no alternative placement receiving strong statistical support (da Cruz Santos‐Neto et al. 2016; Graf et al. 2015). The Velesunioninae was originally erected for Australian genera characterised by smooth umbos (Iredale 1934), although this diagnostic character has subsequently been shown to be inconsistent across the group (Zieritz et al. 2013). The unstable placement of Westralunio in phylogenetic analyses is unclear but may reflect incomplete taxon sampling within the Velesunioninae, particularly given the discovery of multiple novel lineages in this study and in earlier work by Baker et al. (2003). Future studies incorporating broader taxon sampling and genome‐scale phylogenomic data will likely be necessary to fully resolve the evolutionary relationships and composition of the Velesunioninae.

4.3. Conservation Implications

These results highlight the need for further targeted sampling of freshwater mussels in north‐western Australia. It should be a conservation priority to better document Velesunioninae diversity, formally describe undescribed lineages, and assess species distributions, given that some waterbodies in the region are affected by resource extraction that may be highly detrimental to the fauna of affected ecosystems (Environmental Protection Authority 2018). Genetic data are especially critical to this end given (1) the possibility of species co‐occurrence which is not uncommon in eastern Australia (Baker et al. 2003, 2004) and also was documented for V. ‘sp. Lineage A’ and V. ‘sp. Lineage G’ at one site in this study (Rocky Waterhole), and (2) the unreliability of morphological data for species identification. Given effective conservation management is contingent on identifying species (Tsang et al. 2016), the unresolved taxonomy of the Velesunioninae remains a major barrier in assessing their conservation status (Walker et al. 2014).

Developing targeted non‐invasive genetic methods that can reliably distinguish Australian freshwater mussels would be beneficial for establishing a basic understanding of the presence and distribution of different species without destructive sampling. This could include targeted environmental DNA (eDNA) surveys or minimally invasive swabbing methods used for other bivalves of conservation concern (Harrison et al. 2023). eDNA may also assist in surveying for freshwater mussels where conventional survey methods (e.g., hand foraging on littoral banks) are complicated by poor water clarity and the presence of fresh and/or estuarine crocodile populations.

5. Conclusions

Using a multi‐locus phylogenetic analysis, we identified five lineages from five drainages across north‐western Australia, including L. froggatti , previously recognised V. ‘sp. Lineage A’ and three undescribed Velesunio lineages. Morphometric data reinforced that shell morphology can be used to separate L. froggatti from Velesunio species but is less effective at discriminating among Velesunio lineages. Collectively, our findings indicate that the Velesunioninae diversity in north‐western Australia has been underestimated and targeted surveys that utilise genetic data are required to better resolve species distributions and to test for additional, regionally endemic diversity. Further work is crucial to develop robust conservation assessments in a region where freshwater ecosystems are increasingly at risk from resource development.

Author Contributions

Angus D' Arcy Lawrie: data curation (equal), formal analysis (equal), investigation (equal), project administration (equal), writing – original draft (equal), writing – review and editing (equal). Jake Ryan Daviot: data curation (equal), methodology (equal), resources (equal), writing – original draft (equal), writing – review and editing (equal). Christopher Hofmeester: data curation (equal), investigation (equal), resources (equal), writing – original draft (equal), writing – review and editing (equal). Adam Harman: conceptualization (equal), data curation (equal), investigation (equal), project administration (equal), resources (equal), writing – original draft (equal), writing – review and editing (equal). Joel Huey: formal analysis (equal), supervision (equal), writing – original draft (equal), writing – review and editing (equal).

Funding

This work was supported by Fortescue, Northern Minerals and Panoramic Resources.

Conflicts of Interest

The authors declare no conflicts of interest.

Acknowledgements

This work was funded as part of environmental impact assessment studies by several resource companies including Panoramic Resources, Northern Minerals and Fortescue Ltd. A licence to take fauna for scientific purposes was obtained from the Department of Biodiversity, Conservation and Attractions, Western Australia for all environmental impact assessment studies. We thank Nyamal Rangers for leading the survey of Inland Waters on Nyamal Country and acknowledge all Traditional Owners on whose Country freshwater mussel specimens were collected. Open access publishing facilitated by Curtin University, as part of the Wiley ‐ Curtin University agreement via the Council of Australasian University Librarians.

Appendix A.

FIGURE A1.

FIGURE A1

Phylogenetic tree inferred using Bayesian approaches for the 16S dataset. Node support values are Bayesian posterior probabilities converted to percentages. Only nodes with BPP values > 0.95 (95) have been annotated. Lineages sequenced as part of this study are coloured.

FIGURE A2.

FIGURE A2

Phylogenetic tree inferred using maximum likelihood for the 16S dataset. Node support values are bootstrap values. Only nodes with > 75% bootstrap support have been annotated. Lineages sequenced as part of this study are coloured.

FIGURE A3.

FIGURE A3

Phylogenetic tree inferred using Bayesian inference for the 28S dataset. Node support values are Bayesian posterior probabilities (BPP) converted to percentages. Only nodes with BPP values > 0.95 (95) have been annotated. Lineages sequenced as part of this study are coloured.

FIGURE A4.

FIGURE A4

Phylogenetic tree inferred using maximum likelihood for the 28S dataset. Node support values are bootstrap values. Only nodes with > 75% bootstrap support have been annotated. Lineages sequenced as part of this study are coloured.

TABLE A1.

List of all specimens sequenced in this study and their associated Western Australian Museum (WAM) registration and GenBank accession numbers.

Individual code WAM reg Site Sampling date Latitude Longitude Species 16S 28S COI 18S
864 WAM97279 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX737783 PX737819 PX734090
865 WAM97280 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX737784 PX737820 PX734091 PX737852
866 WAM97281 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX737785 PX737821 PX734092 PX737853
867 WAM97282 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX737786 PX737822 PX734093 PX737854
868 WAM97283 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX737787 PX737823 PX734094 PX737855
869 WAM97284 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX734095
871 WAM97286 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX734096
872 WAM97287 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX734097
873 WAM97288 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX734098
874 WAM97289 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX734099
875 WAM97290 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX734100
889 WAM97291 Coongan River 15/05/2025 −20.9019 119.7886 Lortiella froggatti PX734101
975 WAM97297 Lower Myroodah 5/10/2025 −18.0817 124.2198 Lortiella froggatti PX737793 PX734102
976 WAM97298 Lower Myroodah 5/10/2025 −18.0817 124.2198 Lortiella froggatti PX737794 PX737829 PX734103
1204 WAM97303 Rocky Waterhole 21/05/2025 −18.6659 128.5531 Velesunio ‘sp. Lineage A’ PX737799 PX737834 PX734131 PX737857
964 WAM97292 Blina Creek Flood Plain 5/10/2025 −17.9624 124.288 Velesunio ‘sp. Lineage E’ PX737788 PX737824 PX734110
965 WAM97293 Blina Creek Flood Plain 5/10/2025 −17.9624 124.288 Velesunio ‘sp. Lineage E’ PX737789 PX737825 PX734111
966 WAM97294 Blina Creek Flood Plain 5/10/2025 −17.9624 124.288 Velesunio ‘sp. Lineage E’ PX737790 PX737826 PX734112
967 WAM97295 Blina Creek Flood Plain 5/10/2025 −17.9624 124.288 Velesunio ‘sp. Lineage E’ PX737791 PX737827 PX734113
968 WAM97296 Blina Creek Flood Plain 5/10/2025 −17.9624 124.288 Velesunio ‘sp. Lineage E’ PX737792 PX737828 PX734114
1210 WAM97307 DRTS1 15/06/2021 −16.4482 127.9584 Velesunio ‘sp. Lineage E’ PX737803 PX734115
SC_1 WAM97308 Stony Creek 25/05/2021 −17.3387 128.0497 Velesunio ‘sp. Lineage E’ PX737804 PX737838 PX734116
SC_2 WAM97309 Stony Creek 25/05/2021 −17.3387 128.0497 Velesunio ‘sp. Lineage E’ PX737805 PX737839 PX734119 PX737858
SC_3 WAM97310 Stony Creek 25/05/2021 −17.3387 128.0497 Velesunio ‘sp. Lineage E’ PX737806 PX734120
SC_4 WAM97311 Stony Creek 25/05/2021 −17.3387 128.0497 Velesunio ‘sp. Lineage E’ PX737807 PX737840 PX734121 PX737859
SC_5 WAM97312 Stony Creek 25/05/2021 −17.3387 128.0497 Velesunio ‘sp. Lineage E’ PX737808 PX737841 PX734122
SC_6 WAM97313 Stony Creek 25/05/2021 −17.3387 128.0497 Velesunio ‘sp. Lineage E’ PX737809 PX737842 PX734117 PX737860
SC_7 WAM97314 Stony Creek 25/05/2021 −17.3387 128.0497 Velesunio ‘sp. Lineage E’ PX737810 PX737843 PX734118
SC_8 WAM97315 Stony Creek 25/05/2021 −17.3387 128.0497 Velesunio ‘sp. Lineage E’ PX737811 PX737844 PX734123 PX737861
SC_9 WAM97316 Stony Creek 25/05/2021 −17.3387 128.0497 Velesunio ‘sp. Lineage E’ PX737812 PX737845 PX734124
YR2_1 WAM97317 Yule River 1/11/2021 −20.7016 118.2986 Velesunio ‘sp. Lineage F’ PX737813 PX737846 PX734125 PX737862
YR2_2 WAM97318 Yule River 1/11/2021 −20.7016 118.2986 Velesunio ‘sp. Lineage F’ PX737814 PX737847 PX734126
YR2_3 WAM97319 Yule River 1/11/2021 −20.7016 118.2986 Velesunio ‘sp. Lineage F’ PX737815 PX737848 PX734127 PX737863
YR2_4 WAM97320 Yule River 1/11/2021 −20.7016 118.2986 Velesunio ‘sp. Lineage F’ PX737816 PX737849 PX734129 PX737864
YR2_5 WAM97321 Yule River 1/11/2021 −20.7016 118.2986 Velesunio ‘sp. Lineage F’ PX737817 PX737850 PX734130
YR2_6 WAM97322 Yule River 1/11/2021 −20.7016 118.2986 Velesunio ‘sp. Lineage F’ PX737818 PX737851 PX734128 PX737865
1200 WAM97299 Anjammie Pool 23/05/2025 −18.7864 128.3233 Velesunio ‘sp. Lineage G’ PX737795 PX737830 PX734104 PX737856
1201 WAM97300 Stretch Lagoon 25/05/2025 −19.6791 127.5875 Velesunio ‘sp. Lineage G’ PX737796 PX737831 PX734107
1202 WAM97301 Rocky Waterhole 21/05/2025 −18.6659 128.5531 Velesunio ‘sp. Lineage G’ PX737797 PX737832
1203 WAM97302 Rocky Waterhole 21/05/2025 −18.6659 128.5531 Velesunio ‘sp. Lineage G’ PX737798 PX737833 PX734105
1205 WAM97304 Rocky Waterhole 21/05/2025 −18.6659 128.5531 Velesunio ‘sp. Lineage G’ PX737800 PX737835 PX734109
1206 WAM97305 Rocky Waterhole 21/05/2025 −18.6659 128.5531 Velesunio ‘sp. Lineage G’ PX737801 PX737836 PX734106
1207 WAM97306 Rocky Waterhole 21/05/2025 −18.6659 128.5531 Velesunio ‘sp. Lineage G’ PX737802 PX737837 PX734108

TABLE A2.

List of taxa downloaded from GenBank with associated accession numbers.

Species Family Subfamily COI 16S 28S
Castalia ambigua Hyriidae Hyriinae JN243889.1 KP184848.1 JN243867.1
Cucumerunio novaehollandiae Hyriidae Hyriinae KP184901.1 KP184853.1 KP184877.1
Hyridella australis Hyriidae Hyriinae AF305367.1 KP184859.1 KX713389.1
Hyridella depressa Hyriidae Hyriinae KP184903.1 KP184855.1 KP184879.1
Hyridella drapeta Hyriidae Hyriinae KP184905.1 KP184857.1 KP184881.1
Triplodon corrugatus Hyriidae Hyriinae JN243890.1 KP184851.1 JN243868.1
Alathyria jacksoni Baker Hyriidae Velesunioninae AY386975.1; AY386976.1; AY386977.1; AY386981.1 AY387021.1; AY387023.1
Alathyria jacksoni Graf Hyriidae Velesunioninae KP184912.1 KP184864.1
Alathyria pertexta NSW Hyriidae Velesunioninae KP184911.1 KP184863.1 KP184887.1
Alathyria pertexta QLD Hyriidae Velesunioninae KP184910.1 KP184862.1 KP184886.1
Alathyria profuga Hyriidae Velesunioninae KP184913.1; KP184914.1 KP184865.1; KP184866.1
Lortiella froggatti Hyriidae Velesunioninae KP184867.1 KP184891.1
Lortiella rugata Hyriidae Velesunioninae AF231746.1
Microdontia anodontaeformis Hyriidae Velesunioninae KP184909.1 KP184861.1 KP184885.1
Velesunio ‘sp. Lineage A’ Hyriidae Velesunioninae AY211550.1; AY211551.1; AY211552.1; AY211553.1; AY211554.1; AY211555.1; AY211556.1; AY386982.1; AY386983.1; AY386984.1; AY386985.1; AY386986.1; AY386987.1; AY386988.1 AY387032.1; AY387033.1; AY387034.1
Velesunio ‘sp. Lineage B’ Hyriidae Velesunioninae AY211557.1; AY211558.1; AY211559.1; AY211560.1; AY211561.1 AY387024.1; AY387025.1; AY387026.1
Velesunio ‘sp. Lineage D’ Hyriidae Velesunioninae AY211587.1; AY211588.1; AY211589.1; AY211590.1 AY387030.1; AY387031.1
Velesunio ambiguus Hyriidae Velesunioninae AY211570.1; AY211571.1; AY211572.1; AY211573.1; AY211574.1 AY387027.1; AY387029.1; KC429263.1; KP184868.1 KC429444.1
Velesunio angasi Hyriidae Velesunioninae AF231743.1
Westralunio carteri Hyriidae Velesunioninae KP184917.1; MT040629.1; MT040650.1; MT040651.1 KP184870.1; KP184871.1; MZ668849.1; MZ668855.1 MZ669121.1
Westralunio inbisi Hyriidae Velesunioninae MT040633.1; MT040636.1; MT040659.1; MT040661.1; MT040662.1 MT040059.1; MZ668893.1; MZ668917.1; MZ668930.1; MZ668950.1
Westralunio inbisi meridiemus Hyriidae Velesunioninae MT040641.1; MZ668761.1; MZ668811.1; MZ668835.1 MT040061.1; MZ668955.1
Unio pictorum Unionidae AF156499.1 DQ060163.1 AF305383.1

Note: Species names with additional identifiers correspond to sequences from: Baker = Baker et al. (2004), Graf = Graf et al. (2015), NSW/QLD = Graf et al. (2015).

TABLE A3.

Shell measurements for individuals analysed in this study.

Individual code WAM reg Site Species TL BH MH LBL W MHI BHI BLI WLI WHI
864 WAM97279 Coongan River Lortiella froggatti 56.5 24.9 25.8 32.7 22.2 0.46 0.97 0.58 0.39 0.86
865 WAM97280 Coongan River Lortiella froggatti 67.2 31 32.9 44.3 26 0.49 0.94 0.66 0.39 0.79
866 WAM97281 Coongan River Lortiella froggatti 59.5 24.4 25.4 39.5 21 0.43 0.96 0.66 0.35 0.83
867 WAM97282 Coongan River Lortiella froggatti 52.2 23 24.3 33.4 19.7 0.47 0.95 0.64 0.38 0.81
868 WAM97283 Coongan River Lortiella froggatti 54.9 21.6 23.4 33.9 20.6 0.43 0.92 0.62 0.38 0.88
869 WAM97284 Coongan River Lortiella froggatti 69.3 31.8 33.9 45.4 24.6 0.49 0.94 0.66 0.35 0.73
871 WAM97286 Coongan River Lortiella froggatti 56.9 25.2 27.2 38.8 19.5 0.48 0.93 0.68 0.34 0.72
872 WAM97287 Coongan River Lortiella froggatti 72.2 30.3 32.6 48.1 26 0.45 0.93 0.67 0.36 0.8
873 WAM97288 Coongan River Lortiella froggatti 81.9 35.2 35.5 51.2 29.1 0.43 0.98 0.63 0.36 0.82
874 WAM97289 Coongan River Lortiella froggatti 71.4 30.2 31.5 45.7 26.1 0.44 0.96 0.64 0.37 0.83
875 WAM97290 Coongan River Lortiella froggatti 84.5 34.6 35.8 51.3 31.7 0.42 0.97 0.61 0.38 0.89
889 WAM97291 Coongan River Lortiella froggatti 80.6 34 36.3 47.8 28 0.45 0.94 0.59 0.35 0.77
975 WAM97297 Lower Myroodah Lortiella froggatti 75.4 27.8 34.2 50 21.3 0.45 0.81 0.66 0.28 0.62
976 WAM97298 Lower Myroodah Lortiella froggatti 81.2 30 35.4 54.9 24.2 0.44 0.85 0.68 0.30 0.68
1204 WAM97303 Rocky Waterhole Velesunio ‘sp. Lineage A’ 82.5 41.5 43.6 54.6 27.4 0.53 0.95 0.66 0.33 0.63
964 WAM97292 Blina Creek Flood Plain Velesunio ‘sp. Lineage E’ 68.8 36.4 37.4 44 27 0.54 0.97 0.64 0.39 0.72
965 WAM97293 Blina Creek Flood Plain Velesunio ‘sp. Lineage E’ 27.8 16.4 16.4 15.6 11.65 0.59 1.00 0.56 0.42 0.71
966 WAM97294 Blina Creek Flood Plain Velesunio ‘sp. Lineage E’ 43.6 23.8 25.7 28.1 16.6 0.59 0.93 0.64 0.38 0.65
967 WAM97295 Blina Creek Flood Plain Velesunio ‘sp. Lineage E’ 43.7 24.1 26.2 26.8 17.4 0.60 0.92 0.61 0.40 0.66
968 WAM97296 Blina Creek Flood Plain Velesunio ‘sp. Lineage E’ 49 27.5 28.3 28.8 17.3 0.58 0.97 0.59 0.35 0.61
1210 WAM97307 DRTS1 Velesunio ‘sp. Lineage E’ 43 22 23 28 15 0.53 0.96 0.65 0.35 0.65
SC_1 WAM97308 Stony Creek Velesunio ‘sp. Lineage E’ 59.5 30 31.6 38.5 21 0.53 0.95 0.65 0.35 0.66
SC_2 WAM97309 Stony Creek Velesunio ‘sp. Lineage E’ 59 28.1 31.8 42.4 20.7 0.54 0.88 0.72 0.35 0.65
SC_3 WAM97310 Stony Creek Velesunio ‘sp. Lineage E’ 53.3 25.5 29.9 40 17.5 0.56 0.85 0.75 0.33 0.59
SC_4 WAM97311 Stony Creek Velesunio ‘sp. Lineage E’ 57.3 28.7 30.3 39.6 20 0.53 0.95 0.69 0.35 0.66
SC_5 WAM97312 Stony Creek Velesunio ‘sp. Lineage E’ 47 23.1 23.6 29.9 15.4 0.50 0.98 0.64 0.33 0.65
SC_6 WAM97313 Stony Creek Velesunio ‘sp. Lineage E’ 54.3 27.1 28.4 35.6 17.3 0.52 0.95 0.66 0.32 0.61
SC_7 WAM97314 Stony Creek Velesunio ‘sp. Lineage E’ 58.5 29.5 30.7 37.3 19.2 0.52 0.96 0.64 0.33 0.63
SC_8 WAM97315 Stony Creek Velesunio ‘sp. Lineage E’ 59.1 29.3 31 39.8 19.4 0.52 0.95 0.67 0.33 0.63
SC_9 WAM97316 Stony Creek Velesunio ‘sp. Lineage E’ 50 25.2 26.6 32.9 16.3 0.53 0.95 0.66 0.33 0.61
YR2_1 WAM97317 Yule River Velesunio ‘sp. Lineage F’ 36.3 18.5 19.6 23.5 10.6 0.54 0.94 0.65 0.29 0.54
YR2_2 WAM97318 Yule River Velesunio ‘sp. Lineage F’ 37.5 20.7 22.2 25.3 10.5 0.59 0.93 0.67 0.28 0.47
YR2_3 WAM97319 Yule River Velesunio ‘sp. Lineage F’ 39 21.1 21.7 26.2 11.5 0.56 0.97 0.67 0.29 0.53
YR2_4 WAM97320 Yule River Velesunio ‘sp. Lineage F’ 59.6 33.5 35 38.5 19.2 0.59 0.96 0.65 0.32 0.55
YR2_5 WAM97321 Yule River Velesunio ‘sp. Lineage F’ 53.9 28.8 30.6 36.6 16.4 0.57 0.94 0.68 0.30 0.54
YR2_6 WAM97322 Yule River Velesunio ‘sp. Lineage F’ 50.4 25.5 27.9 36.1 16.4 0.55 0.91 0.72 0.33 0.59
1200 WAM97299 Anjammie Pool Velesunio ‘sp. Lineage G’ 76.2 35.7 38 46 23.8 0.50 0.94 0.60 0.31 0.63
1201 WAM97300 Stretch Lagoon Velesunio ‘sp. Lineage G’ 33.4 16 16.8 20.3 9.6 0.50 0.95 0.61 0.29 0.57
1202 WAM97301 Rocky Waterhole Velesunio ‘sp. Lineage G’ 81.5 41.8 44.1 57 26.3 0.54 0.95 0.70 0.32 0.6
1203 WAM97302 Rocky Waterhole Velesunio ‘sp. Lineage G’ 87 41 42.1 58.7 28.3 0.48 0.97 0.67 0.33 0.67
1205 WAM97304 Rocky Waterhole Velesunio ‘sp. Lineage G’ 79.7 39 39.6 54.7 22.5 0.50 0.98 0.69 0.28 0.57
1206 WAM97305 Rocky Waterhole Velesunio ‘sp. Lineage G’ 73 36.2 37.3 45.8 24.9 0.51 0.97 0.63 0.34 0.67
1207 WAM97306 Rocky Waterhole Velesunio ‘sp. Lineage G’ 78.2 37.4 39.6 53.4 23.8 0.51 0.94 0.68 0.30 0.6

Note: Five shell measurements were recorded: total shell length (TL), beak height (BH), maximum shell height (MH), long beak length (LBL) and shell width (W). Morphometric indices were maximum height index (MHI = MH/TL), beak height index (BHI = BH/MH), beak length index (BLI = LBL/TL), width–length index (WLI = W/TL) and width–height index (WHI = W/MH).

TABLE A4.

Uncorrected pairwise distances for 16S, COI and 28S for the Velesunioninae sequences analysed in this study.

Species COI 16S 28S
N Intra Inter N Intra Inter N Intra Inter
Alathyria jacksoni Baker 4 0.21–1.06 0.21–17.34 2 0.25–0.25 0.25–21.91
Alathyria jacksoni Graf 1 NA 6.13–19.24 1 NA 3.54–21.86
Alathyria pertexta NSW 1 NA 5.71–17.34 1 NA 1.26–21.91 1 NA 1.54–19.43
Alathyria pertexta QLD 1 NA 0.21–17.55 1 NA 0.25–21.91 1 NA 0.77–18.14
Alathyria profuga 2 0.63–0.63 6.13–19.66 2 0.25–0.25 2.78–22.22
Lortiella froggatti 3 0.21–0.42 2.54–17.12 1 NA 5.54–22.42 2 0.26–0.26 1.03–19.33
Lortiella rugata 1 NA 2.54–17.34
Microdontia anodontaeformis 1 NA 7.82–18.60 1 NA 4.53–20.35 1 NA 1.78–20.26
Velesunio ‘sp. Lineage A’ 15 0.21–2.33 7.82–18.60 4 0.25–0.76 7.56–23.99 1 NA 1.03–18.39
Velesunio ‘sp. Lineage B’ 5 0.42–3.81 4.23–19.66 3 0.25–0.50 0.76–21.91
Velesunio ‘sp. Lineage D’ 4 0.21–1.48 8.88–17.12 2 0.25–0.25 3.28–23.37
Velesunio ‘sp. Lineage E’ 6 0.21–2.11 7.19–18.18 4 0.25–0.50 4.52–22.11 3 0.25–0.51 1.53–19.74
Velesunio ‘sp. Lineage F’ 1 NA 7.19–18.05 2 0.13–0.13 4.52–21.97 2 1.02–1.02 1.53–21.13
Velesunio ‘sp. Lineage G’ 3 0.21–1.06 9.51–18.60 3 0.25–0.50 5.28–23.17 1 NA 0.77–18.39
Velesunio ambiguus 5 0.21–2.33 7.19–19.03 4 0.25–1.51 2.78–22.92 1 NA 3.35–17.62
Velesunio angasi 1 NA 7.61–17.55
Westralunio carteri 4 0.21–0.63 5.07–19.03 4 0.25–0.50 3.01–22.42 1 NA 3.35–17.05
Westralunio inbisi 5 0.21–1.27 2.33–19.03 5 0.25–0.50 0.25–23.12 a a a
Westralunio inbisi meridiemus 4 0.21–1.48 2.33–19.66 2 0.50–0.50 0.25–23.12 a a a

Note: Values are presented as minimum–maximum. Blank rows indicate a lack of available sequence for that species.

Abbreviations: Inter, interspecific distance; Intra, intraspecific distance; N, number of haplotypes analysed.

a

All three Westralunio taxa shared the same haplotype for the 28S fragment analysed.

Data Availability Statement

Data generated in this study can be found in the Appendix A and also on GenBank (see text for accession numbers). All specimens have been submitted to the Western Australian Museum.

References

  1. Baker, A. M. , Bartlett C., Bunn S. E., Goudkamp K., Sheldon F., and Hughes J. M.. 2003. “Cryptic Species and Morphological Plasticity in Long‐Lived Bivalves (Unionoida: Hyriidae) From Inland Australia.” Molecular Ecology 12: 2707–2717. [DOI] [PubMed] [Google Scholar]
  2. Baker, A. M. , Sheldon F., Somerville J., Walker K. F., and Hughes J. M.. 2004. “Mitochondrial DNA Phylogenetic Structuring Suggests Similarity Between Two Morphologically Plastic Genera of Australian Freshwater Mussels (Unionoida: Hyriidae).” Molecular Phylogenetics and Evolution 32: 902–912. [DOI] [PubMed] [Google Scholar]
  3. Benson, J. A. , Stewart B. A., Close P. G., and Lymbery A. J.. 2021. “Freshwater Mussels in Mediterranean‐Climate Regions: Species Richness, Conservation Status, Threats, and Conservation Actions Needed.” Aquatic Conservation: Marine and Freshwater Ecosystems 31: 708–728. [Google Scholar]
  4. Bogan, A. E. , and Hoeh W. R.. 2000. “On Becoming Cemented: Evolutionary Relationships Among the Genera in the Freshwater Bivalve Family Etheriidae (Bivalvia: Unionoida).” In The Evolutionary Biology of the Bivalvia, edited by Harper E., Taylor J., and Crame J., vol. 177, 159–168. Geological Society. [Google Scholar]
  5. Böhm, M. , Dewhurst‐Richman N. I., Seddon M., et al. 2021. “The Conservation Status of the World's Freshwater Molluscs.” Hydrobiologia 848: 3231–3254. 10.1007/s10750-020-04385-w. [DOI] [Google Scholar]
  6. Bostock, B. , Adams M., Laurenson L., and Austin C., 2006. “The Molecular Systematics of Leiopotherapon Unicolor (Günther, 1859): Testing for Cryptic Speciation in Australia's most Widespread Freshwater Fish.” Biological Journal of the Linnean Society 87: 537–552. [Google Scholar]
  7. Colgan, D. , Ponder W., Beacham E., and Macaranas J.. 2003. “Gastropod Phylogeny Based on Six Segments From Four Genes Representing Coding or Non‐Coding and Mitochondrial or Nuclear DNA.” Molluscan Research 23: 123–148. [Google Scholar]
  8. Cook, B. D. , Page T. J., and Hughes J. M.. 2011. Molecular and Conservation Biogeography of Freshwater Caridean Shrimps in North‐Western Australia. CRC Press. [Google Scholar]
  9. da Cruz Santos‐Neto, G. , Beasley C. R., Schneider H., et al. 2016. “Genetic Relationships Among Freshwater Mussel Species From Fifteen Amazonian Rivers and Inferences on the Evolution of the Hyriidae (Mollusca: Bivalvia: Unionida).” Molecular Phylogenetics and Evolution 100: 148–159. [DOI] [PubMed] [Google Scholar]
  10. Darriba, D. , Taboada G. L., Doallo R., and Posada D.. 2012. “jModelTest 2: More Models, New Heuristics and Parallel Computing.” Nature Methods 9: 772. 10.1038/nmeth.2109. [DOI] [Google Scholar]
  11. Daviot, J. R. , Lymbery A. J., and Beatty S. J.. 2025. “Biofiltration by an Imperilled Freshwater Mussel: Implications for Water Quality in a Drying Climate.” Hydrobiologia 852: 1–15. [Google Scholar]
  12. Daviot, J. R. , Lymbery A. J., Lawrie A. D. A., Cottingham A., and Beatty S. J.. 2026. “Artificial Habitats Provide Refuge for a Threatened Freshwater Mussel in South‐Western Australia.” Pacific Conservation Biology 32: PC25073. [Google Scholar]
  13. Drummond, A. J. , and Rambaut A.. 2007. “BEAST: Bayesian Evolutionary Analysis by Sampling Trees.” BMC Evolutionary Biology 7: 1–8. 10.1186/1471-2148-7-214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dudgeon, D. , Arthington A. H., Gessner M. O., et al. 2006. “Freshwater Biodiversity: Importance, Threats, Status and Conservation Challenges.” Biological Reviews 81: 163–182. 10.1017/S1464793105006950. [DOI] [PubMed] [Google Scholar]
  15. Dugan, K. A. , Lawrence H. S., Hares D. R., Fisher C. L., and Budowle B.. 2002. “An Improved Method for Post‐PCR Purification for mtDNA Sequence Analysis.” Journal of Forensic Science 47: 1–8. [Google Scholar]
  16. Environmental Protection Authority . 2018. “Environmental Factor Guideline: Inland Waters.” Western Australia.
  17. Folmer, O. , Black M., Hoeh W., Lutz R., and Vrijenhoek R.. 1994. “DNA Primers for Amplification of Mitochondrial Cytochrome c Oxidase Subunit I From Diverse Metazoan Invertebrates.” Molecular Marine Biology and Biotechnology 3: 294–299. [PubMed] [Google Scholar]
  18. Giribet, G. , Carranza S., Baguñà J., Riutort M., and Ribera C.. 1996. “First Molecular Evidence for the Existence of a Tardigrada + Arthropoda Clade.” Molecular Biology and Evolution 13: 76–84. 10.1093/oxfordjournals.molbev.a025573. [DOI] [PubMed] [Google Scholar]
  19. Graf, D. L. , and Cummings K. S.. 2021. “A ‘Big Data’ Approach to Global Freshwater Mussel Diversity (Bivalvia: Unionoida), With an Updated Checklist of Genera and Species.” Journal of Molluscan Studies 87: eyaa034. [Google Scholar]
  20. Graf, D. L. , Jones H., Geneva A. J., Pfeiffer J. M. III, and Klunzinger M. W.. 2015. “Molecular Phylogenetic Analysis Supports a Gondwanan Origin of the Hyriidae (Mollusca: Bivalvia: Unionida) and the Paraphyly of Australasian Taxa.” Molecular Phylogenetics and Evolution 85: 1–9. [DOI] [PubMed] [Google Scholar]
  21. Harrison, M. , Sotola V. A., Zalmat A., et al. 2023. “A Comparison of Non‐Destructive Visceral Swab and Tissue Biopsy Sampling Methods for Genotyping‐by‐Sequencing in the Freshwater Mussel Fusconaia askewi .” Genes 14: 1197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hillis, D. M. , and Dixon M. T.. 1991. “Ribosomal DNA: Molecular Evolution and Phylogenetic Inference.” Quarterly Review of Biology 66: 411–453. 10.1086/417338. [DOI] [PubMed] [Google Scholar]
  23. Huey, J. A. , Cook B. D., Unmack P. J., and Hughes J. M.. 2014. “Broadscale Phylogeographic Structure of Five Freshwater Fishes Across the Australian Monsoonal Tropics.” Freshwater Science 33: 273–287. [Google Scholar]
  24. Hughes, J. , Baker A. M., Bartlett C., Bunn S., Goudkamp K., and Somerville J.. 2004. “Past and Present Patterns of Connectivity Among Populations of Four Cryptic Species of Freshwater Mussels Velesunio spp. (Hyriidae) in Central Australia.” Molecular Ecology 13: 3197–3212. [DOI] [PubMed] [Google Scholar]
  25. Iredale, T. 1934. “The Freshwater Mussels of Australia.” Australian Zoologist 8: 57–78. [Google Scholar]
  26. Katoh, K. , Misawa K., Kuma K. I., and Miyata T.. 2002. “MAFFT: A Novel Method for Rapid Multiple Sequence Alignment Based on Fast Fourier Transform.” Nucleic Acids Research 30: 3059–3066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kearse, M. , Moir R., Wilson A., et al. 2012. “Geneious Basic: An Integrated and Extendable Desktop Software Platform for the Organization and Analysis of Sequence Data.” Bioinformatics 28: 1647–1649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kirkendale, L. , Whisson C., Ponder W., and Klunzinger M.. 2022. Wilinggin‐Charnley River Bush Blitz Molluscs. Australian Government Department of Climate Change, Energy, the Environment and Water. [Google Scholar]
  29. Klunzinger, M. W. , Beatty S. J., Morgan D. L., Thomson G. J., and Lymbery A. J.. 2012. “Glochidia Ecology in Wild Fish Populations and Laboratory Determination of Competent Host Fishes for an Endemic Freshwater Mussel of South‐Western Australia.” Australian Journal of Zoology 60: 26–36. [Google Scholar]
  30. Klunzinger, M. W. , Jones H. A., Humphrey C. L., et al. 2023. “Comparative Diversity in Glochidia of Australasian Freshwater Mussels.” Frontiers in Environmental Science 11: 1305077. [Google Scholar]
  31. Klunzinger, M. , Jones H., Keleher J., and Morgan D.. 2013. “A New Record of Lortiella froggatti Iredale, 1934 (Bivalvia: Unionoida: Hyriidae) From the Pilbara Region, Western Australia, With Notes on Anatomy and Geographic Range.” Records of the Western Australian Museum 28: 1–6. [Google Scholar]
  32. Klunzinger, M. , Lopes‐Lima M., Gomes‐dos‐Santos A., Froufe E., Lymbery A., and Kirkendale L.. 2021. “Phylogeographic Study of the West Australian Freshwater Mussel, Westralunio carteri , Uncovers Evolutionarily Significant Units That Raise New Conservation Concerns.” Hydrobiologia 848: 2951–2964. [Google Scholar]
  33. Klunzinger, M. W. , Morgan D. L., Lymbery A. J., Ebner B. C., Beatty S. J., and Thomson G. L.. 2010. “Discovery of a Host Fish for Glochidia of Velesunio angasi (Sowerby, 1867) (Bivalvia: Unionoida: Hyriidae) From the Fortescue River, Pilbara, Western Australia.” Australian Journal of Zoology 58: 263–266. [Google Scholar]
  34. Klunzinger, M. W. , Whisson C., Zieritz A., Benson J. A., Stewart B. A., and Kirkendale L.. 2022. “Integrated Taxonomy Reveals New Threatened Freshwater Mussels (Bivalvia: Hyriidae: Westralunio) From Southwestern Australia.” Scientific Reports 12: 20385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lemey, P. , Salemi M., and Vandamme A.‐M.. 2009. The Phylogenetic Handbook: A Practical Approach to Phylogenetic Analysis and Hypothesis Testing. 2nd ed. Cambridge University Press. [Google Scholar]
  36. Lopes‐Lima, M. , Burlakova L. E., Karatayev A. Y., Mehler K., Seddon M., and Sousa R.. 2018. “Conservation of Freshwater Bivalves at the Global Scale: Diversity, Threats and Research Needs.” Hydrobiologia 810: 1–14. [Google Scholar]
  37. McMichael, D. F. , and Hiscock I. D.. 1958. “A Monograph of the Freshwater Mussels (Mollusca: Pelecypoda) of the Australian Region.” Australian Journal of Marine and Freshwater Research 9: 372–508. [Google Scholar]
  38. McNeely, J. A. 2002. “The Role of Taxonomy in Conserving Biodiversity.” Journal for Nature Conservation 10: 145–153. [Google Scholar]
  39. Mora, C. , Tittensor D. P., Adl S., Simpson A. G., and Worm B.. 2011. “How Many Species Are There on Earth and in the Ocean?” PLoS Biology 9: e1001127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Palumbi, S. , Martin A., Romano S., McMillan W., Stice L., and Grabowski G.. 2002. The Simple Fool's Guide to PCR, Version 2.0. University of Hawaii. [Google Scholar]
  41. Pepper, M. , and Keogh S.. 2014. “Biogeography of the Kimberley, Western Australia: A Review of Landscape Evolution and Biotic Response in an Ancient Refugium.” Journal of Biogeography 41: 1443–1455. [Google Scholar]
  42. Ponder, W. , and Bayer M.. 2004. “A New Species of Lortiella (Mollusca: Bivalvia: Unionoidea: Hyriidae) From Northern Australia.” Molluscan Research 24: 89–102. [Google Scholar]
  43. Ponder, W. F. , Hallan A., Shea M. E., et al. 2024. “Australian Freshwater Molluscs. In: Revision 2B.” https://keys.lucidcentral.org/keys/v3/freshwater_molluscs/.
  44. Reid, A. J. , Carlson A. K., Creed I. F., et al. 2019. “Emerging Threats and Persistent Conservation Challenges for Freshwater Biodiversity.” Biological Reviews 94: 849–873. 10.1111/brv.12480. [DOI] [PubMed] [Google Scholar]
  45. Ronquist, F. , and Huelsenbeck J. P.. 2003. “MrBayes 3: Bayesian Phylogenetic Inference Under Mixed Models.” Bioinformatics 19: 1572–1574. [DOI] [PubMed] [Google Scholar]
  46. Sheldon, F. 2017. “Variable Plasticity in Shell Morphology of Some Australian Freshwater Mussels (Unionoida, Hyriidae).” Transactions of the Royal Society of South Australia 141: 193–208. [Google Scholar]
  47. Strayer, D. L. 2006. “Challenges for Freshwater Invertebrate Conservation.” Journal of the North American Benthological Society 25: 271–287. [Google Scholar]
  48. Troudet, J. , Grandcolas P., Blin A., Vignes‐Lebbe R., and Legendre F.. 2017. “Taxonomic Bias in Biodiversity Data and Societal Preferences.” Scientific Reports 7: 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Tsang, S. M. , Cirranello A. L., Bates P. J., and Simmons N. B.. 2016. “The Roles of Taxonomy and Systematics in Bat Conservation.” In Bats in the Anthropocene: Conservation of Bats in a Changing World, 503–538. Springer. [Google Scholar]
  50. Vaughn, C. C. 2018. “Ecosystem Services Provided by Freshwater Mussels.” Hydrobiologia 810: 15–27. [Google Scholar]
  51. Walker, K. F. , Jones H. A., and Klunzinger M. W.. 2014. “Bivalves in a Bottleneck: Taxonomy, Phylogeography and Conservation of Freshwater Mussels (Bivalvia: Unionoida) in Australasia.” Hydrobiologia 735: 61–79. [Google Scholar]
  52. Zieritz, A. , Sartori A. F., and Klunzinger M. W.. 2013. “Morphological Evidence Shows That Not All Velesunioninae Have Smooth Umbos.” Journal of Molluscan Studies 79: 277–282. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data generated in this study can be found in the Appendix A and also on GenBank (see text for accession numbers). All specimens have been submitted to the Western Australian Museum.


Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES