Deletion of the N-terminal 400 amino acids of DPV pUL36 attenuated virulence and conferred effective protection against virulent challenge

Abstract

Duck plague virus (DPV) causes a highly contagious disease in ducks, resulting in substantial economic losses to the poultry industry. The large tegument protein pUL36 is conserved among herpesviruses and plays critical roles in viral replication and pathogenesis. However, the function of its unique N-terminal region in DPV remains unclear. In this study, a recombinant DPV mutant (Δ400) lacking the N-terminal 1–400 amino acids of pUL36 was generated using a BAC-based reverse genetics system, and its biological characteristics were evaluated in vitro and in vivo. Deletion of the N-terminal region did not impair viral replication in duck embryo fibroblasts, and viral growth kinetics of the mutant Δ400 were comparable to those of the wild-type virus. However, in vivo infection of 14-day-old ducklings with the Δ400 mutant resulted in no mortality, only mild clinical symptoms, and reduced viral loads (P < 0.01) and pathological lesions in major target organs. These findings indicated that the mutant was markedly attenuated. Importantly, immunization with the mutant Δ400 provided complete protection against lethal challenge with virulent DPV and induced robust neutralizing antibody responses that were higher than those elicited by a commercially available vaccine (P < 0.0001). No adverse clinical reactions or organ damage were observed in vaccinated ducks. Overall, these findings indicate that the N-terminal region of DPV pUL36 contributes to viral virulence in vivo but is dispensable for viral replication in vitro. The mutant Δ400 represents a safe, immunogenic, and promising live-attenuated vaccine candidate for the prevention and control of duck plague.

Introduction

Duck plague (DP), also known as duck viral enteritis (DVE), is a highly contagious infectious disease that poses a major threat to waterfowl (Dhama, et al., 2017). Duck plague virus (DPV), the etiological agent of DP, belongs to the family Herpesviridae, subfamily Alphaherpesvirinae, genus Mardivirus (Cheng, 2015). The DPV virion consists of four structural components: the envelope, tegument, capsid, and genomic DNA (Guo, et al., 2010). Its genome is a linear double-stranded DNA composed of unique long (UL) and unique short (US) regions, flanked by inverted repeat sequences IRS and TRS on both sides of the US region (Li, et al., 2009; Liu, et al., 2011; Wu, et al., 2012). The infection process of herpesviruses includes attachment, entry, uncoating, genome replication, gene transcription, nucleocapsid assembly, and virion maturation and release (Grunewald, et al., 2003; Heldwein and Krummenacher, 2008; Gatherer, et al., 2021).

Herpesvirus proteins can be broadly classified into structural proteins, which form the capsid, tegument, and envelope, and nonstructural proteins, which are involved in viral transcription, replication, assembly, and other regulatory processes (Cheng, 2015). Tegument proteins constitute a major component of the virion and perform diverse essential functions throughout the viral life cycle (Varnum, et al., 2004; Laine, et al., 2015; Sucharita, et al., 2023). pUL36, encoded by the UL36 gene, is the largest tegument protein in herpesviruses (Luxton, et al., 2006) and is critical for viral immune evasion, capsid transport, secondary envelopment, and capsid assembly (Fuchs, et al., 2004; Bottcher, et al., 2006; Lee, et al., 2006). The N-terminal region of pUL36 contains a deubiquitinating (DUB) enzyme domain, whose core catalytic residues are highly conserved (Bolstad, et al., 2011). This DUB activity cleaves K48- and K63-linked polyubiquitin chains (Lin, et al., 2020), thereby maintaining pUL36 stability and contributing to the suppression of innate immune responses (Wang, et al., 2013; Ye, et al., 2017; Zhang, et al., 2022). During viral transport and neuroinvasion, herpesvirus capsids depend on the host cytoskeleton for intracellular movement (Ploubidou and Way, 2001; Döhner, et al., 2024). As a capsid-bound tegument protein, pUL36 recruits motor proteins and mediates microtubule-dependent retrograde transport to the nucleus, which is essential for establishing infection and facilitating viral spread (Lyman and Enquist, 2009; Miranda-Saksena, et al., 2018). In addition, pUL36 is indispensable for capsid docking at nuclear pores and genome release as well as capsid assembly (Abaitua, et al., 2011; Toropova, et al., 2011).

At present, duck plague vaccines mainly include traditional inactivated and attenuated vaccines. With advances in vaccine technology, novel strategies such as gene-deletion vaccines, nucleic acid vaccines, and recombinant vector vaccines have become important research directions. Sequence alignment revealed that the N-terminal 1–400 amino acid region of DPV pUL36, located upstream of the conserved deubiquitinating (DUB) domain, is absent in the homologues of other herpesviruses. To date, this distinctive region has not been fully characterized, and its functional contribution to viral replication and pathogenicity remains largely unknown. It is hypothesized that the unique N-terminal 1–400 amino acids of DPV pUL36 play an important role in viral replication and pathogenicity.

In this study, the N-terminal 1–400 amino acids of DPV pUL36 were deleted to investigate their role in viral replication in vitro and in vivo. In parallel, the pathogenicity of the resulting mutant strain was evaluated in ducklings, and its potential as a live-attenuated vaccine candidate was assessed. These findings aim to elucidate the functional significance of the DPV pUL36 N-terminal region and to provide a novel DPV vaccine candidate that enables differentiation between infected and vaccinated animals through deletion of the 400–amino acid region.

Materials and methods

Ethics statement

All animal experiments in this study were approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University (Protocol Permit Number: SYXK 2019-187).

Cells and viruses culture

Duck embryo fibroblasts (DEFs) were maintained at 37°C in an incubator (Thermo Fisher Scientific, 3111, Marietta, US) with 5% CO₂ in minimal essential medium (MEM; Gibco, Shanghai, China) supplemented with 10% fetal bovine serum (FBS; NEWZERUM, CS500, Shanghai, China). DPV CHv strain (GenBank No. JQ647509.1) and its mutant viruses were grown in DEF cells.

Generation of mutant virus

The recombinant infectious clone DPV-BAC-UL36-Δ400 was constructed using the RED homologous recombination system as previously described (Wu, et al., 2023). Briefly, a DNA fragment containing the flanking sequence of the UL36 N-terminal region (amino acids 1–400) and the kanamycin (Kan) resistance gene from the pEPKan-S plasmid was amplified by PCR using the primers Δ400-F/R (Beijing Qingke Biotechnology Co., Ltd.). The purified PCR product was electroporated into GS1783 Escherichia coli cells (provided by the Poultry Disease Control Research Center of Sichuan Agricultural University) harboring the BAC-CHv-ΔminiF plasmid. Subsequently, the KanR cassette was excised by arabinose-induced recombination. Positive recombinant clones were confirmed by sequencing (Beijing Qingke Biotechnology Co., Ltd.) and designated pDPV-BAC-UL36-Δ400. The revertant plasmid, pDPV-BAC-UL36-R-Δ400, was generated using the same strategy (Table 1). The infectious clone plasmids pDPV-BAC-UL36-Δ400 and pDPV-BAC-UL36-R-Δ400 were transfected into DEF cells to rescue the recombinant viruses. After serial passage, the green fluorescence signal disappeared, and the purified recombinant viruses, Δ400 and Δ400-R, were obtained.

Table 1.

Primer design for recombinant viruses.

Primer names	Sequence (5 '-3′)
△400-F	TCGCTAATTAATCGTATCGGAGAGGTGACTAACTACAATGAGGGATCATAGGGATAACAGG GTAATCGATTT
△400-R	CTGACACGGATTTGCTTACTATTACAATTGGTTGATCCCTCATTGTAGTTAGTCACCTCTCCGATACGATTAGCCAGTGTTACAACCAAT
R-△400-F	CTCGCTAATTAATCGTATCGGAGAGGTGACTAACTACAATGGCCGAACAGACGTCTACT
R-△400-R	CTGACACGGATTTGCTTACTATTACAATTGGTTGATCCCTGTTAGTTTGCGCTACTGTGTCGGCTGCGGAGCCAGTGTTACAACCAAT
△400-KanR-F	GCCGACACAGTAGCGCAAACTAACAGGGATCAACTAGGGATAACAGGGTAATCGATTT
△400-KanR-R	AAATCGATTACCCTGTTATCCCTAGTTGATCCCTGTTAGTTTGCGCTACTGTGTCGGC
△400-JD-F	CGTATATGCACGTTCAACTGCC
△400-JD-R	GATTCTATGCGGCCCGGAAG

Growth curve

DEFs were seeded into 24-well plates and infected with DPV Δ400, Δ400-R, or the wild-type strain at a multiplicity of infection (MOI) of 1 or 0.01. Whole-cell samples were harvested at designated time points post-infection, and viral titers were determined using the Reed-Muench method. Viral growth curves were subsequently generated.

qRT-PCR analysis

DEFs were seeded into 24-well plates and infected with DPV Δ400, Δ400-R, or the wild-type strain at an MOI of 1 or 0.01. Whole-cell samples were harvested at the indicated time points, and total viral genomic DNA was extracted using a Blood/Cell/Tissue Genomic DNA Extraction Kit (Tiangen Biotech Co., Ltd., DP304-03, Beijing, China). Viral DNA levels were quantified by TaqMan quantitative real-time PCR (qRT-PCR; Bio-Rad Laboratories, CFX Connect, Singapore) targeting the UL30 gene, as listed in Table 2.

Table 2.

qRT-PCR related primers and probes.

Primer names	Sequence (5 '-3′)
UL30-F	TTTTCCTCCTCCTCGCTGAGT
UL30-R	GGCCGGGTTTGCAGAAGT
UL30-FAM	FAM-CCCTGGGTACAAGCG-MGB

Animal experiment on the pathogenicity of mutant Δ400

To evaluate body temperature, body weight, and survival, a total of 100 ducklings at 14 days of age were randomly divided into 10 groups, with 10 ducklings per group. Ducklings were intramuscularly inoculated with DPV Δ400 (10⁵, 10⁶, or 10⁷ TCID₅₀/0.5 mL), Δ400-R (10⁵, 10⁶, or 10⁷ TCID₅₀/0.5 mL), the wild-type strain (10⁵, 10⁶, or 10⁷ TCID₅₀/0.5 mL), or MEM as a mock control. Body temperature, body weight, and survival were recorded at the indicated time points post-infection. To assess viral replication and histopathological changes, 60 additional 14-day-old ducklings were divided into 10 groups corresponding to those described above, with six ducklings per group. On days 3 and 5 post-infection (DPI), tissue samples from the brain, spleen, and duodenum were collected for viral load determination and histopathological examination.

Animal experiments on the protective efficacy of Δ400

To evaluate the protective efficacy of the Δ400 mutant, a total of 30 ducklings at 14 days of age were randomly divided into three groups (n = 10 per group). Ducklings were intramuscularly immunized with Δ400 (10⁵ TCID₅₀/0.5 mL), a commercially available vaccine, or MEM. On day 14 post-immunization, ducklings were challenged with 100 LD₅₀ of the virulent DPV strain. Body temperature, body weight, and survival were monitored for 10 days post-challenge at the indicated time points. For histopathological analysis, nine additional 14-day-old ducklings were divided into three groups corresponding to those described above (n = 3 per group). At 5 dpi, tissue samples from the brain, spleen, and duodenum were collected for histopathological examination.

Quantification of viral loads in vivo

Total DNA was extracted from homogenized tissue samples using a Blood/Cell/Tissue Genomic DNA Extraction Kit (Tiangen Biotech Co., Ltd., DP304-03, Beijing, China). Viral genome copy numbers were quantified by TaqMan quantitative PCR using UL30 gene-specific primers and probes (Table 2).

Histopathology

Brain, spleen, and duodenum samples were fixed in 10% formalin, followed by graded ethanol dehydration, xylene clearing, and paraffin embedding. Tissue sections were cut, stained with hematoxylin and eosin (H&E), and examined under a light microscope (Yijing Tong Optical Technology Co., Ltd, BX53F2C, Guangzhou, China).

Neutralizing a ntibody titer

To determine whether different immunization doses affected neutralizing antibody responses induced by the Δ400 mutant, a total of 15 ducklings at 14 days of age were divided into three groups (n = 5 per group). Ducklings were intramuscularly inoculated with Δ400 at doses of 10⁵, 10⁶, or 10⁷ TCID₅₀/0.5 mL. Blood samples were collected at 7 and 14 DPI and incubated at 4°C overnight to obtain serum. Neutralizing antibody titers were measured using the fixed-virus–diluted-serum method. Briefly, 0.1 mL of two-fold serially diluted serum (heat-inactivated at 56°C for 30 min) was mixed with an equal volume of DPV containing 100 TCID₅₀/0.1 mL. Neutralizing activity was determined using standard procedures as previously described (Ning, et al., 2022). Based on these results, a dose of 10⁵ TCID₅₀/0.5 mL of Δ400 was selected for subsequent challenge and antibody kinetics experiments. Accordingly, 14-day-old ducklings were immunized with Δ400, the commercially available vaccine, or MEM (n = 5 per group). Blood samples were collected at 3, 5, 7, 14, 21, and 28 DPI, and neutralizing antibody titers were determined as described above.

Statistical analysis

Data are presented as the mean ± standard error of the mean (SEM), and all figures were generated using GraphPad Prism version 8. Statistical significance is indicated by asterisks: * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Results

Proliferation characteristics of the mutant Δ400 in vitro

pUL36 and its homologues are the largest proteins encoded by herpesviruses, and notably, DPV pUL36 is the largest among its homologues (Fig. 1A). To investigate the role of the N-terminal 400 amino acids of the DPV pUL36 protein in viral proliferation, a recombinant mutant virus (Δ400), lacking the N-terminal 400 amino acids of pUL36, and its corresponding repair strain were constructed (Fig. 1B).

Fig. 1.

Construction of recombinant viruses and assessment of the replication characteristics of the in vitro mutant strain Δ400. (A) Amino acid sequence alignment of DPV pUL36 and its homologous proteins. (B) Schematic diagram of the construction of recombinant viruses Δ400 and Δ400-R. (C, E) TCID₅₀ measurements of different strains. (D, F) Genomic copy number measurements of different strains. (* P < 0.05, ** P < 0.01, **** P < 0.0001, ns: not significant).

As shown in Fig. 1, Fig. 1, the growth kinetics of the Δ400 mutant in duck embryo fibroblasts (DEFs) were comparable to those of the wild-type virus under both high and low multiplicity of infection (MOI) conditions at all-time points, except at 24 hours post-infection at an MOI of 0.01 (P > 0.1). To further assess viral proliferation, viral genomic copy numbers were quantified by qPCR. Fig. 1, Fig. 1 showed that at an MOI of 1, no differences in genomic copy numbers were observed between the Δ400 mutant and wild-type virus at 24 and 36 hours post-infection. Similarly, no difference was detected at 48 hours' post-infection when cells were infected at an MOI of 0.01 (P > 0.05). These results indicate that the N-terminal 400 amino acids of DPV pUL36 are not essential for viral proliferation in vitro.

Mutant Δ400 was attenuated in vivo

Ducklings inoculated with wild-type DPV, which served as the positive control, manifested fever and weight loss compared with the mock-infected group. Similarly, ducklings inoculated with the repair strain Δ400-R displayed dose-dependent weight loss comparable to that observed in the wild-type group (P > 0.1). In contrast, ducklings infected with the Δ400 mutant did not exhibit obvious adverse clinical signs, such as elevated body temperature or weight loss, even at the highest inoculation dose. Consistent with these observations, infection with wild-type DPV resulted in approximately 50% mortality in the high-dose group within 4-6 days' post-infection. Notably, no mortality was observed in ducklings infected with the Δ400 mutant, even at the highest dose (Fig. 2).

Fig. 2.

In vivo challenge experiment of the Δ400 mutant strain. Ducklings were inoculated with Δ400, Δ400-R, and the wild-type strain at doses of 10⁵ TCID₅₀, 10⁶ TCID₅₀, and 10⁷ TCID₅₀, respectively; their body temperature, body weight, and survival rate were monitored for 10 days post-inoculation.

Reduced viral loads and pathological damage induced by the mutant Δ400

To further evaluate the in vivo replication capacity and virulence of the Δ400 mutant, viral loads and histopathological changes in different tissues were analyzed. Viral genome copy numbers were quantified by qPCR targeting the DPV UL30 gene. The results showed that the Δ400 mutant was capable of colonizing multiple tissues, similar to the parental strain; however, viral loads in the brain, spleen, and duodenum were lower than those of the wild-type virus in high-dose groups (3d: brain, P < 0.01; spleen, P < 0.0001; duodenum, P < 0.0001; 5d: brain, P < 0.0001; spleen, P < 0.0001; duodenum, P < 0.0001; Fig. 3).

Fig. 3.

Detection of viral load of the Δ400 mutant strain. On the 3rd and 5th days post-infection, the copy numbers of the DPV UL30 gene in the brain, spleen, and duodenum of ducklings inoculated with a viral dose of 10⁷ TCID₅₀ were determined. (** P < 0.01, **** P < 0.0001).

Histopathological examination of H&E-stained duodenum, spleen, and brain tissues further revealed the extent of tissue damage induced by the different viruses. Infection with the wild-type DPV resulted in severe pathological lesions, including intestinal villus rupture, goblet cell atrophy, and mucosal epithelial shedding in the duodenum. In the spleen, wild-type DPV infection caused extensive cellular degeneration, necrosis, and disintegration, leading to the formation of vacuolar or reticular structures. In the brain, infection with wild-type DPV induced marked loosening of the reticular matrix, formation of numerous vacuole-like regions indicative of edema, neuronal degeneration and necrosis, and proliferation of microglia and astrocytes, consistent with viral encephalitis. In contrast, ducklings infected with the Δ400 mutant exhibited markedly reduced histopathological lesions in all examined tissues. These findings indicated that the mutant Δ400 retained the ability to replicate in vivo but attenuated pathological damage compared with the parental DPV strain (Fig. 4).

Fig. 4.

Histopathological characteristics of tissues infected with the Δ400 mutant. Duodenum, spleen, and brain of a duck inoculated with a viral dose of 10⁷ TCID₅₀ were collected on the 5th day post-infection for histopathological observation.

Protective efficacy of Δ400

These results confirmed that the Δ400 mutant exhibited attenuated virulence in vivo. We further evaluated its protective efficacy against lethal challenge. To assess dose-dependent antibody responses, serum samples were collected from ducklings immunized with 10⁵, 10⁶, or 10⁷ TCID₅₀ of the Δ400 mutant. The results showed that similar neutralizing antibody titers were induced by all three doses (10⁵ TCID₅₀ vs. 10⁶ TCID₅₀, P > 0.1; 10⁵ TCID₅₀ vs. 10⁷ TCID₅₀, P > 0.1; 10⁶ TCID₅₀ vs. 10⁷ TCID₅₀, P > 0.1). Therefore, the more economical low-dose vaccination regimen (10⁵ TCID₅₀) was selected for subsequent experiments (Fig. 5A).

Fig. 5.

Immunological evaluation of mutant strain Δ400. (A) Ducklings were immunized with the deletion strain at varying TCID₅₀ doses, and neutralizing antibody titers were determined on the 7th and 14th days post-immunization. (B) Experimental flow chart for investigating the immune protection efficacy of mutant strain Δ400: 14-day-old ducklings were immunized with Δ400 at a dose of 10⁵ TCID₅₀, followed by a challenge infection with 100 LD₅₀ of a virulent DPV strain 14 days post-immunization. Subsequently, the body temperature, body weight, and survival rate of the ducklings, as well as the pathological changes in tissues and organs, were monitored. (C) Body temperature monitoring of ducklings after challenge. All ducklings in the mock group died on day 6, precluding statistical analysis at subsequent time points. Therefore, statistical significance analysis was only performed between the Δ400 mutant and mock groups for the initial five days. (D) Body weight monitoring of ducklings after challenge. Similarly, only data from the initial five days were used for statistical comparison between the Δ400 mutant and mock groups. (E) Survival rate monitoring of ducklings after challenge. (F) Observation of pathological changes in the duodenum and spleen via HE staining after challenge. (** P < 0.01, **** P < 0.0001, ns: not significant).

Fourteen-day-old ducklings were immunized with the Δ400 mutant, a commercially available vaccine, or MEM as a mock control. Fourteen days after immunization, the ducks were challenged intramuscularly with 100 LD₅₀ of virulent DPV. Changes in body temperature and body weight, as well as survival rates, were monitored for 10 days post-challenge (Fig. 5B).

Following the challenge, ducks in the MEM control group exhibited typical clinical signs of DPV infection, including loss of appetite, lethargy, reluctance to move, ruffled feathers, and ocular secretions. In contrast, ducks immunized with either the Δ400 mutant or the commercial vaccine remained clinically normal. Immunization with Δ400 or the commercial vaccine did not result in obvious changes in body temperature and was associated with greater body weight gain compared with the control group. Conversely, ducks in the MEM group exhibited a sharp increase in body temperature without weight gain. Moreover, the MEM group experienced severe mortality following virulent DPV challenge, whereas all ducks immunized with Δ400 or the commercial vaccine survived and were fully protected against lethal challenge (Figs. 5C-E).

Further examination revealed no obvious gross lesions in the organs of ducks immunized with Δ400 or the commercial vaccine. In contrast, ducks in the MEM group showed severe hemorrhagic lesions in the duodenum and spleen. Histopathological analysis of the duodenum and spleen tissues at 5 days' post-challenge revealed no obvious pathological changes in ducks immunized with Δ400 or the commercial vaccine. These findings indicate that the Δ400 mutant is not only safe but also confers effective protection against virulent DPV challenge without inducing adverse reactions or organ pathology (Fig. 5F).

Δ400 induced high levels of neutralizing antibodies

Neutralizing antibodies are key effectors of humoral immunity against viral infections. To investigate whether the protective efficacy observed in Δ400-immunized ducks was associated with neutralizing antibody responses, neutralizing antibody titers induced by the Δ400 mutant were monitored and compared with those induced by the commercial vaccine (Fig. 6A). Neutralizing antibodies were detectable as early as 5 days' post-immunization. Antibody titers continued to increase thereafter, and throughout the observation period, the neutralizing antibody levels induced by the Δ400 mutant were higher than those induced by the commercial vaccine (p < 0.0001). These results suggest that Δ400 elicits a robust and effective humoral immune response. Taken together, these findings demonstrate that the Δ400 mutant is safe, immunogenic, and capable of providing effective protection against virulent DPV challenge, highlighting its potential as a promising vaccine candidate (Fig. 6B).

Fig. 6.

Determination of neutralizing antibody titers induced by the Δ400 mutant strain. (A) Experimental flow chart for the determination of neutralizing antibody levels induced by the Δ400 mutant strain. (B) 14-day-old ducklings were immunized with 10⁵ TCID₅₀ of the Δ400 mutant strain. Blood samples were collected on days 3 and 5, and in weeks 1, 2, 3, and 4 post-immunization. Sera were separated for the neutralizing antibody assay. (**** P < 0.0001, ns: not significant).

Discussion

pUL36 is a high-molecular-weight protein conserved among all herpesviruses (Fan, et al., 2015). This protein plays a pivotal role in multiple stages of the viral life cycle (Roberts, et al., 2009; Schipke, et al., 2012; Kelly, et al., 2014). Although pUL36 and its homologs are highly conserved among herpesviruses—particularly within the deubiquitinase (DUB) domain—functional defects in pUL36 have been reported to exert divergent effects on viral replication in vitro (Lee, et al., 2009; Huffmaster, et al., 2015; Mohnke, et al., 2022; Qi, et al., 2024). Notably, DPV pUL36 is larger than its homologs in other herpesviruses due to the presence of an additional 400 amino acids at the N-terminus, a region with an as-yet-unknown function. In this study, the Δ400 mutant strain was constructed by deleting the N-terminal 1–400 amino acid fragment of DPV pUL36. We demonstrated that deletion of this region exerted no obvious effect on viral proliferation in DEF cells. These findings suggested that this N-terminal region of pUL36 was dispensable for viral replication in DEF cells.

In herpesvirus research, in vivo studies of pUL36 have primarily focused on its role in neuroinvasion and central nervous system infection (Böttcher, et al., 2007; Buch, et al., 2017; Bodda, et al., 2020). However, the overall impact of pUL36 on viral replication across different host organs and its contribution to host-pathogen interactions remain incompletely understood. To investigate the effects of deleting the N-terminal 1–400 amino acids of pUL36 on host responses, ducklings were inoculated with the Δ400 mutant at three different doses in this study. The results showed that all ducklings inoculated with the Δ400 mutant survived. Additionally, the ducklings infected with the Δ400 mutant exhibited a reduction in body temperature and a marked increase in body weight. These findings revealed that this amino acid region is an essential functional domain for DPV to maintain its virulence, and the deletion of this region only induced a mild inflammatory response without exerting adverse effects on host growth. Although deletion of the N-terminal 1–400 amino acids did not significantly affect viral proliferation or DNA replication in DEF cells, we further investigated whether viral replication dynamics were altered in vivo. In this experiment, tissues were collected at designated time points following the euthanasia of the ducklings. Therefore, additional groups of ducklings were included for the analysis of viral loads and histopathological lesions. To minimize the number of experimental animals used, three ducklings per group were allocated for these analyses. DPV is known to exhibit broad tissue tropism, with the intestine, spleen, and brain representing major target organs during infection (Proctor, 1976; Li et al., 2016). These tissues were therefore selected for analysis of viral replication and pathological changes. Quantification of viral genome copy numbers revealed that, at both 3 and 5 days' post-infection, the Δ400 mutant exhibited reduced viral loads in all examined tissues compared with the wild-type virus, although viral DNA levels remained relatively high. Histopathological examination by hematoxylin and eosin (H&E) staining demonstrated that infection with the Δ400 mutant did not induce discernible pathological lesions in these organs. Collectively, these findings indicate that the Δ400 mutant retains the capacity for in vivo replication while exhibiting markedly attenuated pathogenicity. In other herpesviruses, UL36 has been shown to contribute to immune evasion by modulating the host ubiquitination–deubiquitination balance, thereby suppressing the expression of antiviral effector molecules (Mohnke, et al., 2022; Ren, et al., 2023). In the in vivo context, the host immune system mounts coordinated innate and adaptive immune responses to control viral infection. Deletion of the N-terminal 1–400 amino acids of DPV pUL36 may impair the immune evasion capability of the virus, leading to reduced viral replication in host tissues and the establishment of a balanced state between viral propagation and host survival.

Duck plague (DP) remains a significant threat to the global duck industry, and vaccination continues to be the most effective strategy for disease prevention. Previous studies have demonstrated that inactivated vaccines generally elicit weaker protective immunity than live-attenuated vaccines (Butterfield and Dardiri, 1969). Since the introduction of the commercial attenuated duck plague vaccine in the 1960s, no new live-attenuated vaccines have been approved for use (Yang, et al., 2025). In recent years, advances in reverse genetics have enabled the rational design of recombinant DPV vaccine candidates. Several studies have reported that deletion of specific viral genes can attenuate DPV virulence while preserving immunogenicity (Ning, et al., 2022; Wu, et al., 2022; Cao, et al., 2025). However, these approaches have also encountered challenges, such as transient fever in vaccinated hosts or reduced viral yields during in vitro propagation (Ruan, et al., 2022; Wu, et al., 2023). In the present study, we generated the Δ400 mutant, which was shown to be safe in ducklings and did not induce any observable clinical symptoms. Importantly, the Δ400 mutant replicated efficiently in vitro, exhibiting growth kinetics comparable to those of the wild-type virus. These characteristics highlight the potential of Δ400 as a promising live-attenuated vaccine candidate. Moreover, its robust replication in cell culture suggests that large-scale vaccine production could be achieved at relatively low cost, enhancing its practical applicability and economic feasibility. Based on these advantages, we further evaluated the protective efficacy of Δ400 against virulent DPV challenge.

Following a challenge with a virulent DPV strain, ducklings immunized with Δ400 were fully protected, exhibiting neither mortality nor detectable organ pathology. The level of protection conferred by Δ400 was comparable to that of the commercially available vaccine. Notably, immunization with Δ400 induced significantly higher levels of neutralizing antibodies than the commercial vaccine. It might be because the commercialized vaccine was derived from chicken embryo passages, meaning that its adaptation in ducklings was not as effective as that of the mutant strain Δ400. Therefore, the level of neutralizing antibodies produced by the mutant strain was higher than that produced by the commercialized vaccine. These findings further support the potential of Δ400 as a safe, effective, and immunogenic vaccine candidate.

Conclusion

In summary, the N-terminal 1–400 amino acid region of DPV pUL36 is a key determinant of viral virulence in vivo but is not required for replication in vitro. The Δ400 mutant provides effective protection against lethal challenge and induces robust neutralizing antibody responses. These findings provide new insights into the functional role of the N-terminal region of DPV pUL36 in pathogenesis and support the Δ400 mutant as a promising attenuated live vaccine candidate for the prevention and control of duck plague.

Disclosures

The authors declare no competing financial or commercial interests that could be construed as a potential conflict of interest.

CRediT authorship contribution statement

Qiao Yang: Data curation, Methodology, Writing – original draft, Validation, Writing – review & editing. Hongxin Yu: Methodology, Validation, Writing – original draft, Investigation. Lin Ai: Methodology, Validation, Data curation, Writing – review & editing, Investigation. Mingshu Wang: Writing – review & editing, Conceptualization, Project administration. Ying Wu: Writing – original draft, Formal analysis. Bin Tian: Software, Methodology, Investigation. Yitong Yang: Methodology, Investigation, Data curation. Renyong Jia: Validation. Dekang Zhu: Validation. Shun Chen: Validation. Mafeng Liu: Validation. Xinxin Zhao: Validation. Shaqiu Zhang: Validation. Juan Huang: Writing – original draft, Resources, Validation. Xumin Ou: Validation. Di Sun: Writing – original draft, Investigation. Yu He: Visualization. Zhen Wu: Investigation, Visualization, Data curation. Ling Zhang: Resources. Yanling Yu: Resources. Anchun Cheng: Writing – review & editing, Conceptualization, Project administration, Funding acquisition.