Abstract
Background:
Breast cancer is considered the leading cause of death in women worldwide. When cancer is detected early, the survival rate increases significantly. Molecular identification of genes alterations and expression of specific proteins has become a key indicator of breast cancer diagnosis and treatment. COX2 is considered as one of biomarkers for different types of cancer.
Objective:
This study aimed to validate the correlation between COX2 mutation and breast cancer.
Methods
Using conventional PCR, COX2 was isolated from 57 patients after lumpectomy and from blood samples. The samples were collected from patients admitted to Al-Basrah Teaching Hospital. Forty-two samples were malignant and fifteen were benign which were used as controls for mutation and for expression. In addition, tissue from inside of tumors and far from tumor were tested to compare COX2 expression by performing of RT-PCR.
Results:
The results showed that 5 out of 12 (30.3%) samples sent to DNA sequence were mutated, three of them had deletions, while the others had substitution. All mutations were in exon2 and no mutation in exon1. Expression of COX2 in malignant was detected by RT-PCR and showed very significant difference between malignant and benign in all areas of samples, inside tumor, far from tumor tissue and blood. Significant differences in expression of COX2 in malignant lesions and blood samples of malignant, and benign tissue can be considered as a good biomarker for detection of breast cancer in suspected patients. Relatively high expression level of COX2 were recorded in patient with aged 57-66 with 39% inside malignant tumor and 13.53% far from tumor and 23.1% in blood compared with only 7.25%, 8.4% and 5.3% in benign samples in the same age group, respectively.
Conclusion:
These results provide insight into the ability to use COX2 as a biomarker for suspected breast cancer patients in Iraq.
Key Words: Breast cancer, COX2, Diagnosis
Introduction
Breast cancer is one of the most common cancers in women worldwide. Over 1.5 million women are diagnosed with breast cancer every year throughout the world; it is considered as the first leading cause of cancer deaths among women. Development of breast cancer is a multi-step process involving multiple cell types, and its prevention remains challenging in the world [1, 2].
Early diagnosis of the disease can lead to a good prognosis and a high survival rate. Breast cancers can be classified into biologically and clinically meaningful subgroups according to histological grade and histological type [3]. It seems logical to consider factors known to play an important role in predicting 5-year survival of breast cancer patients and to question their importance in survival 10 years after diagnosis and even longer. These factors may be categorized as patient factors including age, comorbidity, time of diagnosis and race, tumor related factors such as size, histological type, grade, lymph node involvement, vascular invasion, recurrence and metastasis, tumor markers including hormonal receptors,HER-2 expression, gene expression profile , mitotic activity index, and and molecular factors BRCA 1,2 [4]. Apart from the traditional immunomarkers, (COX2) is being studied extensively in breast cancer tissue [5].
Cyclooxygenase (COX) group of enzymes are important for the conversion of arachidonic acid to prostaglandins. Cyclooxyrgenase-1 (COX-1) is constitutively expressed at a constant level throughout the cell cycle in most of the tissues. The inducible isoform, Cyclooxyrgenase-2 (COX-2), is often over expressed in breast cancer, Various research articles suggest that prostaglandin metabolites may contribute to maintenance of tumor viability, premalignant hyper proliferation, tumor growth, transformation, invasion and metastatic spread. COX-2 is the key involved enzyme, as it triggers prostaglandin synthesis, which has been shown to be over expressed in many human malignant tumors [6].
Studies showed that expressed significant high levels of COX-2 in malignant breast cell, while benign breast tissue at least 1 cm from a malignant lesion did not express COX-2. Elevated COX-2 expression was associated with a large tumor size, a high histological grade, a negative hormone receptor status, a high proliferation rate along with axillary node metastases. In addition to the well-established pathophysiological role of COX2 in inflammation, evidence implies that this enzyme may be involved in multiple biologic events throughout the tumorigenic process. COX2 gene has been characterized as an immediate early gene associated with cellular growth, differentiation and angiogenesis. Emerging data suggest that COX2 is involved at various steps of the process of malignant transformation and tumor progression [7].
Cyclooxygenase-2 promotes carcinogenesis, raises the recurrence rate of cancer, and reduces survival in cancer patients. It also increases the resistance of malignant cell to radiotherapy and chemotherapy [8].
Over-expression of COX2 in epithelial carcinomas has been detected in several types of tissue, such as colon, gastric, esophageal, lung, liver, pancreas, prostate, ovary, and breast. Tumor cells with elevated COX2 levels are highly resistant to apoptosis, have increased proliferation, invasion and migration [9].
In this study we will discuss the effect of COX2 in the diagnosis and prognosis of breast cancer.
Materials and Methods
This study was conducted in Basrah teaching hospital, from April 2021 to February 2023. Samples of tissue and blood were collected from 57 female patients in surgical ward, aged 17-66 years who were admitted with breast mass, whether it’s benign or malignant after informed consent was obtained from them except those who were admitted for mastectomy following excisional biopsy and those who were kept on chemotherapy. In view of the result of Fine needle biopsy (FNA), excisional biopsy or mastectomy was done to the patients with free margin of at least 1 cm from the lesions.
Tissue samples were immersed in formalin solution or normal saline, and blood was collected in EDTA tube, and then transported to the molecular laboratory in AL-Zahraa College of Medicine for extraction of COX2 for molecular identification.
Tissue extraction
A biopsy of about 1gram of the breast specimen was cut from suspected area of each sample and other samples were taken far from suspected cancer tissue by about 1cm away. The tissues were washed by phosphate buffer saline twice, then cut in small pieces and washed again, tissues were mashed up in sterile mortar with 200 ml Nuclease-Free Water to get homogenized liquid.
We added 0.75 ml of TRIzolTM LS Reagent per 0.25 ml of sample volume then homogenize the sample by pipetting up and down several times to lyse samples.
Isolation of COX2 DNA by PCR
Two referenced forward and reverse primers compatible for COX2 were performed to detect COX2 by using conventional polymerase chain reaction (Gradient thermal Cycler, DLAB, USA, TC1000-G). Amplification of COX2 was done by using Master mix GoTag® (Promega Cat No. # M7122) in final volume 50 µl with 1 µl of extracted tissue as a DNA templet and 0.5 µl from each COX2 forward and reverse primers. The thermocycler machine was programmed to meet the PCR protocol as follows: Initial denaturation step for 1 minute at 94˚C, then 30 cycle of second denaturation at 94˚C for 30 sec followed by annealing step at 58˚C, according to the advice of primer supplier company (Promega, Korea, Cat No.#162770), then extended step at 72ºC for twenty second followed by further 10min extension time.
Gel electrophoresis
A concentration of 3% gel electrophoresis was performed to separate COX2 DNA and compare by their base pair size (Table 1). SYPR® Safe (Promega, Korea, Cat. #CS411) was performed to visualize DNA bands under UV trans illuminator cabinet (Wealtec, USA, MD-25/HD-25). Density of gel bands was estimated by using IMAGEJ software which was download from website (https://imagej.nih.gov/ij/download.html) [10].
Table 1.
Oligonucleotide Primers with Their Site of Amplicons and Their Sizes by Base Pairs with Their References
| Amplicon | Purpose | Primer sequence (5’-3’) | ize bp | Reference |
|---|---|---|---|---|
| COX2 EXON1 | PCR | F-TAAGGGGAGAGGAGGGAAAA | 372 | [11] |
| R-AGGAGGTCAGAGCGGAAACT | ||||
| COX2 EXON2 | PCR | F- AAAAATTGTATTTCCATGACTACCTAT | 855 | [11] |
| R- TCTTGCTGATCCAAATCCAA | ||||
|
COX2
conserved regions |
PCR | F-GATCACTTCAAAATGAATTCAGGAT | 135 | [12] |
| R-GCTACGAAGATAGATTACAGTTATG | ||||
| COX2 | RT-PCR | sense- TGA AAC CCA CTC CAA ACA CAG | 232 | [13] |
| Antisense-TCA TCA GGC ACA GGA GGA AG | ||||
| β-actin | RT-PCR | sense-GTT TGA GAC CTT CAA CAC CCC | 320 | [13] |
| Antisense- GTG GCC ATC TCT CTT GCT CGA AGT C |
DNA sequencing
Twelve samples of PCR products, visualized in right size in gel electrophoresis, were sent to DNA sequencer company (Base-Gene company, Netherland). Sequence analysis information was performed by the company through their specific website and confirmed by using online tool(https://www.baseclear.com/genomics/fragment-analysis/).
Detection of COX2 expression by RT-PCR
Relative quantification RT-PCR was used to measure gene expression of COX2.
Blood extraction
1 ml of each blood sample was performed to lysis cells and extract RNA according to (Dongsheng iotech, N1121) RNA blood mini kit protocol. Concentration and purification of RNA was confirmed by nanodrop spectrophotometer (Avans, NAS_99) under absorbance at 260 nm and 280 nm. A ratio of ~2 was used and considered RNA pure sample.
cDNA synthesis
1 µg of the extraction cellular RNA was performed to synthesis cDNA by Oligonucleotide primers that were performed to detect COX2 by RT-PCR product 232 bp length were shown in Table 1.
The procedure of RT-PCR was adopted by 1X SYBR Green PCR Master Mix, and started by step one in 60 min of reverse transcription at 55 °C then inactivate of the transcriptase at 95°C for 8 min, followed by amplification for 40 cycles of denaturation at 95 °C for 20 sec, then annealing step at 55 °C for 20 sec, and extension step at 72 °C for 50 sec.
The total RNA solution was subjected to RT-PCR analysis using the Qiagen one-step RT-PCR kit (#Cat. 210210). The total RNA specimens 1μg were performed for reverse transcription and amplified in 25 μl of reaction mixture, and the reaction conditions for COX2 and human gene and protein abbreviation ACTB (β-actin).
Statistics
The data were analyzed by SPSS version 26, the data were presented as frequencies and percentage, and the association was measured by Chi square and Fisher’s exact test (when the expectation frequencies less than 5). The data value less than 0.05 was considered as significant.
Results
This study covered 57 patients diagnosed with breast mass sent for fine needle aspiration (FNA). Patients age ranged from 17 to 66 years old (mean 48 years old). The patients were grouped into five groups according to the age. Samples were classified as 42 (73.6%) malignant and 15 (26.3%) benign tumors as shown in Table 2. The biopsies of all patients were taken from the suspected tumor area as a cancer tissue and far from that, from tissue looking normal, as a control tissue. 57 samples of tumor and 57 as control samples were used.
Table 2.
Type of Samples According to Age group
| Age group (Yrs) | Type | Total | ||||
|---|---|---|---|---|---|---|
| M | % | B | % | No. | % | |
| 17-26 | 4 | 7.01 | 1 | 1.75 | 5 | 8.76 |
| 27-36 | 6 | 10.52 | 2 | 3.51 | 8 | 14 |
| 37-46 | 10 | 17.54 | 7 | 12.3 | 17 | 29.84 |
| 47-56 | 11 | 19.3 | 2 | 3.51 | 13 | 22.8 |
| 57-66 | 11 | 19.3 | 3 | 5.26 | 14 | 24.6 |
| Total | 42 | 73.67% | 15 | 26.33% | 100 | |
M, malignant; B, benign
Detection of COX2 DNA.
PCR products were subjected to gel electrophoresis and showed bands for COX2-exon1; COX2-Exon 2 and COX2 conserved region in their related base pair size as shown in Figure 1. Samples were compared with 1000 bp DNA ladder.
Figure 1.
Gel Electrophoresis 3% Visualized PCR Products, COX2 of EXON2 (855bp), COX2 EXON1 (372bp) and COX2 Conserved Regions (CR) 135bp.
DNA sequences
Twelve PCR products, 5 of each COX2 of EXON1, COX2 EXON2 and 2 from COX2 conserved regions were cut from gel and purified by Qiaquick®-gel-extraction-kit and sent to DNA sequencing company. The results showed that COX2- EXON1 was compatible with COX2 sequence from Homo sapiens (GenBank access code: NG_028206) (GenBank access code: AGCE_01110177) and showed no mutation as well as bands that got from conserved region showed compatible to COX2 reference (Table 3). On the contrary, 5 samples out of 5 (100%) of COX2 in Exon2 showed mutation, 3 of them were malignant and showed deletion mutation in 9 bp (316-324). This mutation caused removal of three amino acid Leu-Lyc-Leu in area 106, 107 and 108; segment sequence was (5’CTG AAG CTA3’). Another 2 mutations showed one substitution in benign sample in base pair number 217 (CCT>CTT) and this leads to change the amino acid proline to Leucin (ΔP72L), and the other substitution was in malignant sample and mutated a base pair number 153 (CAG>CTG) which change amnio acid Glutamine to Leucin (ΔG51L), (Figure 2). All these mutations were shown in the C-terminal of COX2. Sequence results also showed no mutation in conserved region of COX2 in all the 2 samples that were sent. Benign samples showed non-mutated in 3 out of 4 (75%) and just one of them was mutated, while 4 malignant out of 6 (66.6%) carried mutation either deletion or substitution (Table 4).
Table 3.
Number of Samples that Showed Deletion, Substitution and Non-Mutated.
| Number | type of mutation |
|---|---|
| 3 | Deletion |
| 2 | Substitution |
| 7 | None |
Figure 2.
DNA Sequence Curve Showed Mutation of COX2, (A) mutation deletion of 9 bp (316-324), (B) Mutation of substitution in bp217(CCT>CTT), (C) mutation of substitution in bp153 (CAG>CTG). Black = Guanine; Blue = Cytosine; Green = Adenine and Red is Thymine.
Table 4.
DNA Sequence Results Showed Mutation and Non-Mutation Samples with Their Age
| Year | Type | Results | Site | Mutation |
|---|---|---|---|---|
| 17 | M | Deletion | Exon 2 | Δ316-324 |
| 26 | M | None | Exon 1 | -- |
| 26 | B | None | CR | -- |
| 34 | M | None | CR | -- |
| 35 | B | None | Exon 1 | -- |
| 40 | B | Substitution | Exon 2 | ΔP72 L |
| 42 | B | None | Exon 1 | -- |
| 43 | M | Deletion | Exon 2 | Δ316-324 |
| 52 | B | None | Exon 1 | -- |
| 57 | M | Substitution | Exon 2 | ΔG51L |
| 59 | B | None | Exon 1 | -- |
| 60 | M | Deletion | Exon 2 | Δ316-324 |
Estimating expression of COX2
Expression of COX2 in samples were identified by performing of RT-PCR according to [14] in order to detect mRNA of samples and recorded signal of Cycle Threshold (CT) value of samples and then converted to relative expression by the equation below. The average CT value of the endogenous protein β-actin was 32, which was used as a control to compare its expression with COX2 in each sample.
Relative expression = 2(CTβ-actin)-(CT cox2)
Three samples group were used (Tumor site; far from tumor and blood) from each malignant and benign sample. The results explained that the expression of COX2 was increased as shown in Table 5) and Figure 3.
Table 5.
Relative Expression of COX2 in Malignant and Benign from Tumor Site, Far from Tumor and Blood of Different Age of Patients
| Age group | Expression of COX2 Malignant | Expression of COX2 Benign | ||||||
|---|---|---|---|---|---|---|---|---|
| COX2 in Tumor | COX2 Far site | COX2 in blood | p-value | COX2 in Tumor | COX2 Far site | COX2 in blood | p-value | |
| 17-26 | 33.5 | 6.6 | 19.8 | 9.7 | 7.2 | 5.2 | ||
| 27-36 | 32.9 | 6.5 | 21.7 | <0.05 | 7.3 | 7.2 | 5.6 | |
| 37-46 | 34.2 | 6.2 | 22.6 | 10.5 | 9 | 5.21 | <0.05 | |
| 47-56 | 38.9 | 13.56 | 21.6 | 6.4 | 6.8 | 5.4 | ||
| 57-66 | 39 | 13.55 | 23.1 | 7.25 | 8.4 | 5.3 | ||
Figure 3.
Bar Chat Elucidates the Relative Expression of COX2 in Malignant and Benign Samples According to Age Groups
Expression of COX2 in tumor site of malignant tissue increased in an average of 3.25 times from that fare from the tumor site. Also, it increased in an average of 0.6 times from expression in blood of patient. In addition, COX2 was expressed 1.58 more times in blood compared with tissue far from cancer site. The statistical analysis showed highly significant differences of the expression of COX2 between cancer tissue and far from tissue and from cancer tissue and blood (p-value <0.05) (Table 5). On the other hand, expression of COX2 in benign showed no significant differences between site of tumor, far from tumor as well as blood samples (Table 5).
Expression of cDNA of COX2
Expression of COX2 confirmed by loading of same amount of cDNA samples in gel electrophoresis (Figure 4A). The expression was found to be increased significantly in tumor of malignant tissue compared with its expression in tumor of benign tissue (p-value<0.05). Whereas the expression of COX2 in blood was higher in malignant patients compared with blood taken from patients with benign tumor. The expression in blood showed significantly different (p-value<0.05) (Figure 4B). Bands of COX2 were shown in their estimated size (372bp) compared with marker 1000bp. Endogenous β-actin cDNA were used to estimate equality of PCR product and their bands were showed in about 323bp.
Figure 4.
Expression of COX2 in Gel Electrophoresis in Tumor and Blood in Malignant and Benign Samples. (A) Gel electrophoresis showed bands of COX2 and β-actin. (B) Bar chart explain the arbitrary densitometer of gel electrophoresis bands by using IMAGJ software. * Significant differences p-value <0.05.
Discussion
Breast cancer is considered as one of the common cancers in women worldwide. It is leading incident cancer and cause of death among Iraqi women [14, 15].
In a study revealed a link between breast cancer and the cellular protein COX2 which plays a role in various physiological processes, including inflammation, development, and progression of cancer, including breast cancer [16].
This study adopted 57 breast cancer biopsies which were collected after lumpectomy. Samples showed 42 malignant and 15 benign in percentage of 73.6% and 26.4% respectively. The study showed that the highest malignant patients were 19.3% in two age groups (47-56 and 57-66) years. A new study conducted in India was recorded that malignant concentrated in age 51-61 years in a percentage about 50% [17].
Conventional PCR was used to detect COX2, and the result identified bands of COX2 which isolated in size 855bp which lies in Exon2 and 372 in Exon 1 and 135bp in conserved region. The study conducted that genes in exon1 were conserved, and no mutation has been shown in this area. In contrast, Exon2 appeared carry two types of mutations; deletion of the 9-base pair from 315 to 323 which leads to remove amino acid sequence Leu-lyc-Leu. Correlation of COX2 mutation in different types of cancer was confirmed, four amino acid deletions in EXON 6 and 7 were isolated from Iranian patient with pancreatic cancer in about 21.9% of all cases under study [5]. Point mutation in Thymine number 8473 to Cytosine in sequencing of COX2 was identified in nasopharyngeal, bladder, esophageal and skin cancers [18], The same research group found several mutations in COX2 related to malignant breast cancer; G765C, G1195A and T8473C were detected in breast cancer [19]. A novel mutation was detected in breast cancer and linked with cancer progression was in exon 2 when single mutation occurred (C169G) and repeated in about 15% of samples in study conducted Fawzy MS et al. [20].. These results confirmed that COX2 mutation associated with breast cancer and exon2 is one of the areas affected by mutation and related to progression. These results compatible with what this research found, the exon 2 carry point mutations in two areas G51L and P72L, and deletion of 9 bp (314-324) which contradicts Leu-Lyc-Leu deletion as shown in table [4].
The mutation P27L was detected in benign samples and this result is subject to many speculations, it may be because of false negative fine aspiration cytology (FNA) diagnosis, which its sensitivity around between 86% to 93% [21] in addition to the false negative was found in several mammography results. Another expectation of this mutation (P72L) probably not be associated with any pathological changes, especially since it was not mentioned in literature before.
Expression of COX2 was one of the aims of this study and the results showed that the expression evaluated in malignant compare with benign related to site of tumor, far from tumor tissue and blood as shown in table [5] This result was confirmed by RT-PCR and gel electrophoresis as mentioned in Figures 3, 4. Breast cancer stage, progression and metastasis may be classified according to COX2 expression, [22] used RT-PCR to record expression of COX2 in breast cancer and conclude that high expression level was detected remarkably in metastatic and invasive breast carcinoma. This result was supported by several studies by using different technique, by immunohistochemistry [23]. found 36% of breast cancer samples were recorded as a high expression level of COX2. Similarly another study detected 25% of breast cancer samples were associated with high COX2 expression in immunohistochemistry [24, 25]. A study conducted by RT-PCR confirmed that 84.6% of malignant carcinoma was shown increased in COX2 gene expression [24]. Related to the age, overexpression of COX2 was clearly identified in female over 50 years by 91.2% of breast cancer [9].
Detection of COX2 expression in blood was also aimed in this study in order to study the ability to use it as a biomarker. The result showed significant differences between expression of COX2 in blood of malignant and benign sample in all age groups as explained in Table 5 and Figure 3. The COX2 expression in blood was used and similar results were conducted by several studies> [26-28].
Detection of COX2 expression in blood samples of patient with breast cancer was confirmed and found to vary depending on age, stage and progression [29, 30] and these results compatible with the results of this study (Table 5).
In conclusion, the study identified that expression of COX2 was vary inside breast cancer tissue and far from the area of cancer as well as in blood in each benign and malignant tissues. The results are promising to use expression of COX2 by RT-PCR as a specific biomarker for cancer and for grade of cancer or progression. COX2 expression in blood of malignant samples also showed significant differences with benign and can be used as a primary marker.
RecommendationThese results need to be confirmed by increasing the number of the samples and classified samples with their criteria like; age of patients and stages of cancer.
Author Contribution Statement
All authors contributed equally in this study.
Acknowledgements
None.
References
- 1.McGuire S. Adv Nutr. Vol. 7. 2; 2016 . World health organization, international agency for research on cancer, who press; pp. 418–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.DeSantis CE, Bray F, Ferlay J, Lortet-Tieulent J, Anderson BO, Jemal A. International variation in female breast cancer incidence and mortality rates. Cancer Epidemiol Biomarkers Prev. 2015;24(10):1495–506. doi: 10.1158/1055-9965.EPI-15-0535. [DOI] [PubMed] [Google Scholar]
- 3.DeSantis CE, Fedewa SA, Goding Sauer A, Kramer JL, Smith RA, Jemal A. Breast cancer statistics, 2015: Convergence of incidence rates between black and white women. CA Cancer J Clin. 2016;66(1):31–42. doi: 10.3322/caac.21320. [DOI] [PubMed] [Google Scholar]
- 4.Elston CW, Ellis IO. Pathological prognostic factors in breast cancerThe value of histological grade in breast cancer: Experience from a large study with long-term follow-up. Histopathology. 1991;19(5):403–10. doi: 10.1111/j.1365-2559.1991.tb00229.x. [DOI] [PubMed] [Google Scholar]
- 5.Smith WL, DeWitt DL, Garavito RM. Cyclooxygenases: Structural, cellular, and molecular biology. Annu Rev Biochem. 2000;69:145–82. doi: 10.1146/annurev.biochem.69.1.145. [DOI] [PubMed] [Google Scholar]
- 6.Jana D, Sarkar DK, Ganguly S, Saha S, Sa G, Manna AK, et al. Role of cyclooxygenase 2 (COX-2) in prognosis of breast cancer. Indian J Surg Oncol. 2014;5(1):59–65. doi: 10.1007/s13193-014-0290-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Arun B, Goss P. The role of COX-2 inhibition in breast cancer treatment and prevention. Semin Oncol. 2004;31(2 Suppl 7):22–9. doi: 10.1053/j.seminoncol.2004.03.042. [DOI] [PubMed] [Google Scholar]
- 8.de la Torre J, Sabadell MD, Rojo F, Lirola JL, Salicru S, Reventos J, et al. Cyclo-oxygenase type 2 is dysregulated in breast ductal carcinoma in situ and correlates with poor outcome. Eur J Obstet Gynecol Reprod Biol. 2010;151(1):72–6. doi: 10.1016/j.ejogrb.2010.02.033. [DOI] [PubMed] [Google Scholar]
- 9.Soerjomataram I, Louwman MW, Ribot JG, Roukema JA, Coebergh JW. An overview of prognostic factors for long-term survivors of breast cancer. Breast Cancer Res Treat. 2008;107(3):309–30. doi: 10.1007/s10549-007-9556-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Pilewskie M, Morrow M. Margins in breast cancer: How much is enough? Cancer. 2018;124(7):1335–41. doi: 10.1002/cncr.31221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Mohamadkhani A, Akbari MR, Ghanbari R, Naderi E, Rezanejad-Asl P, Pourshams A. Direct sequencing of cyclooxygenase-2 (COX-2) revealed an intronic variant rs201231411 in iranian patients with pancreatic cancer. Middle East J Dig Dis. 2015;7(1):14–8. [PMC free article] [PubMed] [Google Scholar]
- 12.Rosário Pinheiro DD, Harada ML, Rodriguez Burbano RM, Nascimento Borges BD. COX-2 gene expression and methylation profile in sapajus apella as an experimental model for gastric adenocarcinoma. Genet Mol Biol. 2018;41(2):496–501. doi: 10.1590/1678-4685-GMB-2016-0329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Xue YW, Zhang QF, Zhu ZB, Wang Q, Fu SB. Expression of cyclooxygenase-2 and clinicopathologic features in human gastric adenocarcinoma. World J Gastroenterol. 2003;9(2):250–3. doi: 10.3748/wjg.v9.i2.250. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.O SH, L AH, N AA, Al-Hawaz MH, Al-Faddagh ZA, G NN, et al. Epidemiology of breast cancer among females in basrah. Asian Pac J Cancer Prev. 2016;17(S3):191–5. doi: 10.7314/apjcp.2016.17.s3.191. [DOI] [PubMed] [Google Scholar]
- 15.Fraga D, Meulia T, Fenster S. Real‐time PCR. Current protocols essential laboratory techniques. 2008 ;(1):10–3. [Google Scholar]
- 16.Al-Hashimi MMY. Trends in breast cancer incidence in iraq during the period 2000-2019. Asian Pac J Cancer Prev. 2021;22(12):3889–96. doi: 10.31557/APJCP.2021.22.12.3889. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Esbona K, Yi Y, Saha S, Yu M, Van Doorn RR, Conklin MW, et al. The presence of cyclooxygenase 2, tumor-associated macrophages, and collagen alignment as prognostic markers for invasive breast carcinoma patients. Am J Pathol. 2018;188(3):559–73. doi: 10.1016/j.ajpath.2017.10.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Łukasiewicz S, Czeczelewski M, Forma A, Baj J, Sitarz R, Stanisławek A. Breast cancer-epidemiology, risk factors, classification, prognostic markers, and current treatment strategies-an updated review. Cancers (Basel) 2021;13(17):4287. doi: 10.3390/cancers13174287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Li Q, Ma C, Zhang Z, Chen S, Zhi W, Zhang L, et al. Association between cyclooxygenase-2 (COX-2) 8473 t > c polymorphism and cancer risk: A meta-analysis and trial sequential analysis. BMC Cancer. 2018;18(1):847 . doi: 10.1186/s12885-018-4753-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Fawzy MS, Aly NM, Shalaby SM, El-Sawy WH, Abdul-Maksoud RS. Cyclooxygenase-2 169c>g and 8473t>c gene polymorphisms and prostaglandin e2 level in breast cancer: A case-control study. Gene. 2013;527(2):601–5. doi: 10.1016/j.gene.2013.06.007. [DOI] [PubMed] [Google Scholar]
- 21.Li F, Ren GS, Li HY, Wang XY, Chen L, Li J. A novel single nucleotide polymorphism of the cyclooxygenase-2 gene associated with breast cancer. Clin Oncol (R Coll Radiol) 2009;21(4):302–5. doi: 10.1016/j.clon.2008.12.005. [DOI] [PubMed] [Google Scholar]
- 22.Ishikawa T, Hamaguchi Y, Tanabe M, Momiyama N, Chishima T, Nakatani Y, et al. False-positive and false-negative cases of fine-needle aspiration cytology for palpable breast lesions. Breast Cancer. 2007;14(4):388–92. doi: 10.2325/jbcs.14.388. [DOI] [PubMed] [Google Scholar]
- 23.Harris RE, Casto BC, Harris ZM. Cyclooxygenase-2 and the inflammogenesis of breast cancer. World J Clin Oncol. 2014;5(4):677–92. doi: 10.5306/wjco.v5.i4.677. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Denkert C, Winzer KJ, Müller BM, Weichert W, Pest S, Köbel M, et al. Elevated expression of cyclooxygenase-2 is a negative prognostic factor for disease free survival and overall survival in patients with breast carcinoma. Cancer. 2003;97(12):2978–87. doi: 10.1002/cncr.11437. [DOI] [PubMed] [Google Scholar]
- 25.Tan KB, Yong WP, Putti TC. Cyclooxygenase-2 expression: A potential prognostic and predictive marker for high-grade ductal carcinoma in situ of the breast. Histopathology. 2004;44(1):24–8. doi: 10.1111/j.1365-2559.2004.01774.x. [DOI] [PubMed] [Google Scholar]
- 26.Jabini R, Mirbolouk A, farzanehfar m. Evaluation of cyclooxygenase 2- gene expression in benign and malignant ascites. Rev Clin Med. 2020;7(2):78–82. [Google Scholar]
- 27.Wideł MS, Wideł M. Mechanisms of metastasis and molecular markers of malignant tumor progression I Colorectal cancer. Postepy higieny i medycyny doswiadczalnej (Online). 2006 Jan;60:453–70. [PubMed] [Google Scholar]
- 28.Gregório H, Raposo T, Queiroga FL, Pires I, Pena L, Prada J. High COX-2 expression in canine mast cell tumours is associated with proliferation, angiogenesis and decreased overall survival. Vet Comp Oncol. 2017;15(4):1382–92. doi: 10.1111/vco.12280. [DOI] [PubMed] [Google Scholar]
- 29.Szweda M, Rychlik A, Babińska I, Pomianowski A. Significance of cyclooxygenase-2 in oncogenesis. J Vet Res. 2019;63(2):215–24. doi: 10.2478/jvetres-2019-0030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.de Souza CP, Alves B, Waisberg J, Fonseca F, Carmo AO, Gehrke F. Detection of COX-2 in liquid biopsy in patients with breast cancer. J Clin Pathol. 2020;73(12):826–9. doi: 10.1136/jclinpath-2020-206576. [DOI] [PubMed] [Google Scholar]