Skip to main content
NCBI home page
Asian Pacific Journal of Cancer Prevention : APJCP logoLink to Asian Pacific Journal of Cancer Prevention : APJCP
. 2025 Dec 26;26(12):4493–4502. doi: 10.31557/APJCP.2025.26.12.4493

Curcumin Enhanced the Chemosensitivity of Breast Cancer Cells through the Intrinsic Pathway of Apoptosis

Zahra Sadat Miri 1, Hossein Bagheri 2, Alireza Amani 3, Hadi Karami 4,*
PMCID: PMC13242557  PMID: 41459864

Abstract

Introduction:

Over-expression of the anti-apoptotic proteins like Mcl-1 is linked to the development of resistance in tumor cells against the Bcl-2 inhibitor ABT- 737. Combination therapy involving Bcl-2 inhibitors and Mcl-1 inhibitors has been suggested as a promising approach to address the issue of drug resistance. In this study, we examined the impact of curcumin on the expression of Mcl-1 and the sensitivity MDA-MB-231 and MCF-7 breast cancer cells to ABT-737.

Methods:

In this experimental study, cell toxicity was evaluated using MTT assay. The cell growth assay and colony formation assay were used to evaluate the effect of treatments on cell proliferation. The mRNA levels of Mcl-1 and MMP-2 were determined by qRT-PCR. Cell migration was assessed by wound healing assay. Apoptosis was detected by Hoechst 33342 staining, ELISA cell death assay and caspase-3 activity assay.

Results

Our data demonstrated that combination treatment with curcumin and ABT-737 synergistically lowered the IC50 values and reduced colony formation, cell migration, and cell survival compared with curcumin or ABT-737 alone. ABT-737 increased the expression level of Mcl-1 mRNA, while curcumin suppressed the expression of both Mcl-1 and MMP-2 mRNA. Moreover, suppression of Mcl-1 expression by curcumin was associated with enhanced apoptosis induced by ABT-737 in breast cancer cells

Conclusion:

In conclusion, curcumin demonstrates anti-tumor activity in human breast cancer cells by inhibiting colony formation, cell migration, and cell survival. Furthermore, curcumin can augment the apoptotic effect of ABT-737 by suppressing the expression of Mcl-1.

Key Words: ABT-737, Apoptosis, Breast cancer, Curcumin, Mcl-1

Introduction

Breast cancer is the most common and the second leading cause of cancer deaths in women [1]. The most common treatment options for breast cancer include surgery, radiation therapy, chemotherapy, hormone therapy and targeted therapy [1, 2]. Today, chemoresistance is the one of the main obstacles to breast cancer treatment [1]. Therefore, understanding the molecular mechanisms and developing new methods to overcome chemoresistance is essential.

Mitochondrial pathway of apoptosis is regulated by two groups of Bcl-2 family proteins including pro- and anti-apoptotic members of Bcl-2 family which consist of 1-4 homologs domains of Bcl-2 (B-H), including BH1, BH2, BH3 and BH4 [3]. Over-expression of anti-apoptotic members of Bcl-2 family is often observed in different types of cancer cells, which is associated with increased cell growth, cell survival and chemoresistance [4, 5]. Moreover, previous studies show that the expression levels of Bcl-2 protein is increased in breast cancer cells that strongly linked to the pathological stages and survival rate of breast cancer patients [6, 7]. Therefore, targeting Bcl-2 anti-apoptotic protein members, such as Bcl-2 protein, can be a potential strategy for breast cancer treatment.

ABT-737 is a small BH3-mimetic specifically binds to the hydrophobic groove of Bcl-xL, Bcl-2 and to a lesser extent Bcl-w. Binding of ABT-737 to anti-apoptotic proteins lead to release of pro-apoptotic proteins and induction of apoptosis [8, 9]. ABT-737 showed the anti-cancer potential as a single agent or in combination with chemotherapeutic drugs in many types of cancers [8-12]. Studies have shown that ABT-737 does not target Mcl-1, and increased expression of Mcl-1 is linked to the ABT-737 resistance in tumor cells [7, 9, 12]. Therefore, inhibiting Mcl-1 represents a acceptable strategy to sensitize tumor cells to ABT-737 [13-15].

Curcumin (diferuloylmethane) is a hydrophobic polyphenol derived from Curcuma longa. Curcumin has been shown to have anti-cancer potential in different types of tumors, including breast cancer [16-18]. Previous findings have shown that curcumin can effectively suppress the proliferation of breast cancer cells in vitro and in vivo. Moreover, it significantly improves the anti-tumor properties of some traditional chemotherapeutic agents and targeted therapies [19, 20]. However, the effect of curcumin and ABT-737 combination on cancer cells has not been investigated so far. In this research we hypothesized that curcumin can enhance the therapeutic effect of ABT-737 in breast cancer cells by suppression of Mcl-1 expression. Therefore, we examined the effect of curcumin on Mcl-1 expression and sensitivity of breast cancer cells to ABT-737 in vitro.

Materials and Methods

Cell culture

In this experimental study, human breast cancer cell lines MCF-7 and MDA-MB-231 were obtained from the Pasteur Institute (Tehran, Iran). The cells were cultured in RPMI-1640 medium (Gibco, Invitrogen, Life technologies, Germany) supplemented with 100 U/ml penicillin-streptomycin (Gibco), 10% heat-inactivated fetal bovine serum (FBS) (Gibco), 2 mM of glutamine, and 1% sodium pyruvate, at 37 °C in a 95% humidified atmosphere containing 5% CO2.

Cytotoxicity assay

The effect of curcumin on the sensitivity of MDA-MB-231 and MCF-7 cells to ABT-737 was assessed using MTT assay. Curcumin (C21H20O6) and ABT-737 ( C42H45ClN6O5S2), both obtained from Cayman (Ann Arbor, MI, USA). The experiment was subdivided into five groups: ABT-737, curcumin, ABT-737 + curcumin, blank control and solvent control. In brief, cells were seeded in 96-well tissue culture plates at a density of 3 × 103 cells/well. After overnight incubation, the cells were treated with different concentrations of ABT-737 (0-32 μM), curcumin (0-32 μM) for 48 hours. Next, the cytotoxic effect of the compounds was evaluated by using a cell proliferation MTT kit (Roche Diagnostics GmbH, Mannheim, Germany) following the manufacturer’s instructions. The absorbance (A) of each well was measured on a multi-plate reader (Awareness Technology, Palm City, FL, USA) at a wavelength of 570 nm with a reference wavelength of 650 nm. The survival rate (SR) was determined by the equation as follows: SR (%) = (A Test /A Control) ×100%. IC50 (half max inhibitory concentration) values were calculated using Prism 6.01 software (GraphPad Software Inc., San Diego, CA, USA).

Analysis of combined drug effects

The combination effect of ABT-737 and curcumin was evaluated for its impact on the survival of breast cancer cells using the Cho-Talalay method [21], which employs the combination index (CI) analysis. The data obtained from MTT assay were transformed into Fraction affected (Fa values ranging from 0 to 1, where Fa=0 represents 100% cell survival and Fa=1 represents 0% cell survival. The CompuSyn program (ComboSyn Inc., Paramus, NJ, USA) was used to calculate Fa values. The CI value were used to determine the type of interaction, with CI less than 1 indicating synergism, a CI equal to 1 indicating an additive effect, and a CI greater than 1 indicating antagonism.

Cell proliferation assay

The antiproliferative effects of ABT-737 and curcumin were assessed by trypan blue staining. Briefly, the cell lines were cultured in six-well plates at a density of 5×104 cells/well and treated with ABT-737 and curcumin, alone and in combination. After the treatment, the cells were allowed to incubate for duration of 5 days. At different times, total cells were collected by trypsinization. Subsequently, cell suspensions were subjected to staining with 0.4% trypan blue (Merck KGaA, Darmstadt, Germany) for 3 min. The viable cells, or stained cells, were enumerated using an inverted microscope (Nikon Instrument Inc., Melville, NY, USA) and a hematocytometer. Cell viability was evaluated by comparing the percentage of viable cells to the blank control group.

Quantitative real-time PCR (qRT-PCR)

After the 48 h treatments, total RNA was isolated from the cell lines using the RNA extraction kit (Parstous, Tehran, Iran) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized from 2 µg of total RNA using Easy cDNA Synthesis Kit (Parstous) and oligo-dT primer, as described by the manufacturer. The qRT-PCR analysis was conducted utilizing the LightCycler 96 System (Roche Diagnostics GmbH, Mannhein, Germany) and SYBR Green qPCR MasterMix (Parstous). The specific component of qRT-PCR reactions were 1 µl of cDNA template, 10 µl of SYBR Green qRT-PCR MasterMix, 0.2 µM of each of the primers, and 7 µl of distilled water. The specific primers used for qRT-PCR analysis were as follows: forward, 5’-ATACCATCGAGACCATGCG-3’, reverse, 5’-CCAATGATCCTGTATGTGATCTG-3’, for MMP-2, forward, 5’- TAGTTAAACAAAGAGGCTGGGA-3’, reverse, 5’- CCTTCTAGGTCCTCTACATGG -3’, for Mcl-1, and forward, 5’-GACATCCGCAAAGACCTGTA-3’, and reverse, 5’- GGAGCAATGATCTTGATCTTCA-3’, for β-actin. The experimental conditions were as follows: an initial incubation step at a temperature of 95 oC for 10 min, followed by 35 cycles at 95 oC for 15 seconds, 57 oC for 20 sec, and 72 oC for 20 sec. To determine the relative gene expression levels, the comparative CT methods [22] were used. To ensure accurate and reliable results, the expression levels were normalized using β-actin as an endogenous control gene.

Wound healing assay

Breast cancer cells were cultured into 6-well plates in complete growth medium. An artificial scratching was made using 2 mm wide pipette tips when the cells had grown to 90%. The plates were washed 2 times with sterile PBS and then filled with complete medium containing IC50 doses of ABT-737 and curcumin, alone and in combination. After 48 h, the wound closure was photographed using an inverted microscope.

Colony formation assay

MCF-7 and MDA-MB-231 cells (5×103 cells/well) were seeded in 6-well plates. Then cells were allowed to attach overnight and then treated with IC50 doses of ABT-737 and curcumin for 48h. After 10 days, the colonies were fixed with 3.7% paraformaldehyde and stained with 0.4% crystal violet. The number of grown colonies was measured and assessed as the ratio of the number of treated cells to control cells

Hoechst 33342

The two breast cancer cell lines were separately plated at the density of 4 × 104 cells/well in 12-well plates for 24 h. Then the cells were exposed to ABT-737 and curcumin. After 48 h of incubation, the cells were washed twice with PBS, fixed in 3.7% formaldehyde and stained with Hoechst 33342 (Beyotime, Jiangsu, China) for 10 minutes. Under an inverted fluorescence microscope, cells showing condensed or fragmented nuclei were defined as apoptotic cells.

Apoptosis ELISA assay

The measurement of the total amount of cytosolic mono- and oligonucleosomes that were released by apoptotic cells was conducted using the cell death detection ELISA plus kit (Roche Diagnostics GmbH). The cultivation of breast cancer cells was carried out at a density of 1×105 cells/well in 6-well plates. Cells were collected and resuspended in a lysis buffer 48 h after treatments. The resulting suspension was then subjected to centrifugation at 200 g. Subsequently, 20 µl of resulting supernatant was combined with 80 µl of a solution containing anti-histone-biotin and anti-peroxidase. The combined mixture was then transferred to individual wells of a sreptoavidin-coated plate. After 2 h of incubation, the wells were washed and 100 µl of 2, 2-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) solution was added to each well. The ABTS stop solution was utilized to terminate the reactions, and the absorbance was immediately determined at 405 nm using ELISA microplate reader. The fold change in apoptosis was obtained by dividing the absorbance value of treatment group by the absorbance value of the control group.

Caspase-3 activity assay

The in vitro activity of the caspase-3 assay was measured according to the colorimetric caspase-3 activity assay Kit (Abnova Corporation, Taipei, Taiwan). After treatment, the cells were collected and lysed in a cell lysis buffer. The cell lysate was centrifuged at 10,000 g for 1 min. Next, the supernatant was transferred to a fresh tube. Then, 50 µl of 2X reaction buffer containing 10 mM DTT and 5 μl of 4 mM caspase-3 (DEVD-pNA) colorimetric substrate were added to each sample. Following a 2 h incubation period at 37 οC, the absorbance was measured using a microplate reader at a wavelength of 405 nm.

Statistical analysis

Results in this study are shown as mean ± standard deviation (SD) of at least three independent experiments. Statistical comparisons between groups were evaluated using one-way analysis of variance (ANOVA) and Student’s t-test. The statistical analyses were performed by GraphPad Prism software (GraphPad, San Diego, CA, USA). P-values less than or equal to 0.05 were considered statistically significant.

Results

Curcumin enhanced the sensitivity of breast cancer cells to ABT-737

To assess whether curcumin could increase the sensitivity of the breast cancer cells to ABT-737, a combination treatment of curcumin and ABT-737 on MDA-MB-231 and MCF-7 cells was performed. The results of MTT assay showed that treatment with curcumin and ABT-737 alone, markedly reduced the cell survival rate in a dose-dependent way (relative to the blank control) (Figure 1). Moreover, combination treatment further decreased the cell survival rate relative to curcumin or ABT-737 alone (p<0.05). The IC50 values of curcumin and ABT-737 for 48 h treatment were 12.8 and 2.6 µM in MDA-MB-231 cells, and 23.9 and 4.1 µM in MCF-7 cells, respectively (Table 1). As illustrated in Table 1, the combination treatment with curcumin and ABT-737 led to a significant decrease in the IC50 value, relative to the monotreatment. These data propose that curcumin can increase the sensitivity of breast cancer cells to ABT-737.

Figure 1.

Figure 1

Open in a new tab

Effect of Curcumin and ABT-737 on Cell Proliferation and Survival. The breast cancer cells were treated with curcumin and ABT-737 at concentrations indicated in the study. After a period of 24 h, the MTT assay was conducted to assess the survival of the cells. The resulting data was then utilized to plot the cell survival curves using GraphPad software (A and D). The data presented in this study represents the mean±SD of three independent experiments. The combination index (CI) values were determined by analyzing the fractional affected (Fa) values obtained from the MTT assay using CalcuSyn software (B and E). C and F show the proliferation curves of the breast cancer cells.

The combination effect of curcumin and ABT-737 on breast cancer cells was synergistic

To evaluate whether the effect of curcumin and ABT-737 on cell survival is responsible for their synergistic impact, we performed the combination index analysis, based on the non-constant method of Chou-Talalay. The CI-Fa plot demonstrated that the combination of curcumin (0-32 µM) with ABT-737 (0-32 µM) on breast cancer cells resulted in a synergistic interaction (CI<1) combination. Notably, the pronounced synergistic effect was observed after 48 h of treatment, with a combination of 4 µM curcumin and 4 µM ABT-737 (CI=0.70), with Fa level of 0.93 in MDA-MB-231 cell line (Figure 1). Moreover, in MCF-7 cells the strongest synergistic effect was obtained at 4 µM curcumin in combination with 4 µM ABT-737 (CI=0.71), with Fa level of 0.78 (Figure 1).

Curcumin increased the proliferation inhibition effect of ABT-737

We then studied the effect of curcumin and ABT-737 on the proliferation of the breast cancer cells. The cells were treated with curcumin and ABT-737, alone and in combination. Cell viability was then evaluated by trypan blue assay during a period of 5 days. The cell proliferation curve showed that compared with the control groups, the viability of the cells in curcumin, ABT-737 and combinatorial group significantly reduced in a time-dependent way. In MDA-MB-231 cells, the cell viability in curcumin, ABT-737 and combinatorial group decreased to 78 %, 77 % and 71 % respectively, after 24 h of treatment, and then to a further 44 %, 41 % and 40 %, at the end of the experiment (p<0.05; Figure 1). Similar results were observed in the MC-7 cell line. The IC50 value in combined group was lower than the IC50 value where the reagents were used individually. These results indicate that the combined effect of two agents on inhibiting cell proliferation is more potent than their individual effects.

Curcumin reduced the expression of Mcl-1 (apoptotic) and MMP-2 (Metastatic) genes

qRT-PCR method was used to analysis the effect of curcumin and ABT-737 on gene expression. The results demonstrated that 48 h after the treatment of MDA-MB-231 and MCF-7 cells with curcumin, the mRNA levels of Mcl-1 and MMP-2 decreased relative to the blank control group (p<0.05). Treatment with ABT-737 did not cause a significant change in the expression of MMP-2 and enhanced the expression of Mcl-1 (Figure 2). Moreover, combination treatment significantly lowered the expression of MMP-2 compared to the blank control and ABT-737 treated cells. The effect of combination treatment and MMP-2 expression was markedly less than curcumin treated cells. Mcl-1 gene expression in the combination group demonstrated a clear difference with the single treatment and blank control groups (Figure 2). These findings suggest that curcumin may have the potential to neutralize the effect of ABT-737 on Mcl-1 expression. The mRNA expression levels in solvent control group were found to be similar to these in the blank control group, indicating no significant difference (p>0.05).

Figure 2.

Figure 2

Open in a new tab

RT-qPCR Analysis of Breast Cancer Cells. The MCF-7 and MDA-MD-231 cells underwent a 24 h treatment with curcumin and ABT-737 (IC50 doses). The expression levels of Mcl-1 and MMP-2 mRNA in MCF-7 (A and B) and MDA-MD-231 (C and D) cells were subsequently assessed using the RT-qPCR technique and the 2-(∆∆Ct) method. Results are presented as mean±SD (n=3). #p<0.05 relative to single treatment; *p<0.05 relative to blank control.

Curcumin enhanced the ABT-737-mediated inhibition of breast cancer cell migration

Wound-healing assay was used to assess the effects of a combination treatment with curcumin and ABT-737 on breast cancer cell migration. Wound-healing assay showed that treatment with curcumin and ABT-737 alone inhibited breast cancer cell migration, while, combined treatment showed the same effect at a lower dose (Figure 3). Quantitative analysis of cell migration in wound healing was executed (Figure 3). These results indicate that curcumin enhances the ABT-737-mediated inhibition of breast cancer cell migration.

Figure 3.

Figure 3

Open in a new tab

Effect of Curcumin and ABT-737 on Colony Formation and Migration of Breast Cancer Cells. The cells were treated with IC50 doses of curcumin and ABT-737 for 48 h. The migration of MCF-7 (A and B) and MDA-MB-231 (C and D) cells was quantified by measuring wound closure areas 48 h after treatments. E and F show the Effect of curcumin and ABT-737 on colony formation in breast cancer cells. The cell colonies were stained with crystal violet and the number of colonies was observed after 48 h. Data were representative of three independent experiments.

Curcumin decreased the colony formation rate of breast cancer cells

Antitumor activities of curcumin and ABT-737 in MDA-MB-231 and MCF-7 cells were also determined using the colony formation assay. Results showed that the colony formation ability of MDA-MB-231 and MCF-7 cells was significantly reduced after the exposure to curcumin and ABT-737 (Figure 3). Moreover, in the combination treatment group, a significant reduction in colony formation of both cell lines was observed compared to control cells (p<0.05).

The apoptotic effect of ABT-737 in breast cancer cells was potentiated by the addition of curcumin

To analysis whether the inhibitory effect of compounds on cell survival was related to the induction of apoptosis, the MDA-MB-231 and MCF-7 cells were exposed to the IC50 doses of curcumin, ABT-199 and their combination for 48 h. Then, we carried out Hoechst 33342 nuclear staining and ELISA cell death assay. Results clearly demonstrated the occurrence of apoptotic cells containing nuclear fragments in cells treated with curcumin and ABT-737. Conversely, the control cell did not exhibit this particular characteristic (Figure 4). Moreover, the combination treatment did not result in a significant change in the number of apoptosis cells compared to the cells that were treated with a single agent.

Figure 4.

Figure 4

Open in a new tab

Induction of Apoptosis by Curcumin and ABT-737 in Breast Cancer Cells. MCF-7 and MDA-MB-231 breast cancer cells were treated with IC50 doses of curcumin and ABT-737 for 48 h. Nuclear morphological changes were observed using Hoechst33342 staining and a fluorescence microscope (A). Fold change in apoptosis was measured using ELISA cell death assay (B). C show caspase-3 activity of breast cancer cells after 48 h treatment.

The ELISA cell death assay results indicated a notable increase in apoptosis after 48 hours of exposure to curcumin and ABT-737. The extent of apoptosis in MDA-MB-231 cells were found to be 5.1 and 4.8 times higher in curcumin or ABT-737 treated cells, respectively (compared to the blank control group, p<0.05). Moreover, the extent of apoptosis was determined to be 4.9 times greater in the combination group at the specified time point (p<0.05). Conversely, no significant changes in apoptosis were observed in the solvent control group when compared to the blank control group (p>0.05). Similar results were observed in the MCF-7 cell line.

The results indicate that the combination of two agents has a more potent effect in inducing apoptosis compared to the individual agent alone. This is evident from the fact that IC50 dose of the combination group is lower than that of either agent alone. The enhanced apoptotic effect observed aligns with the results obtained from the MTT assay.

Caspase-3 activity enhanced after treatment of the breast cancer cells with curcumin and ABT-737

In order to investigate the underlying nuclear process of apoptosis triggered by curcumin and ABT-737, a caspase-3 activity assay was performed. The results demonstrated a significant increase in caspase-3 activity in the cell exposed to curcumin or ABT-737 (p<0.05). Moreover, the level of caspase-3 activity in breast cancer cells treated with the combination of curcumin and ABT-737 did not differ when compared to the caspase-3 activity in cells treated with either curcumin or ABT-737 alone (p>0.05, Figure 4).

Discussion

The management of breast cancer requires a multifaceted approach that includes both local and systemic strategies. These may encompass procedures like surgical tumor removal, the use of targeted antibody treatments, chemotherapy, and small inhibitory molecules. Nevertheless, the efficacy of chemotherapy in addressing breast cancer is frequently impeded by the intricate and varied characteristics of the illness, leading to the development of drug resistance [1-3]. It is crucial to emphasize the significance of creating innovative and enhanced approaches for treating breast cancer in a more efficient manner. Up-regulation of anti-apoptotic proteins have been correlated with heightened cellular proliferation, resistance to pharmaceutical therapies, diminished cell apoptosis, and an unfavorable prognosis for individuals suffering from breast cancer. It has been reported that cancer cells with increased Mcl-1 levels show resistance to ABT-737 [4, 5, 7]. The concept of combining ABT-737 with Mcl-1 inhibitors represents a promising strategy for overcoming resistance to ABT-737 in cancer treatment [9, 15, 23]. Thus, in this study, we investigated the impact of curcumin on the expression of Mcl-1 and the sensitivity of breast cancer cells to ABT-737.

The results of our study demonstrated that the administration of either curcumin or ABT-737 individually resulted in a notable decrease in cell survival and triggered apoptosis. However, when curcumin and ABT-737 were used in combination, there was a significant reduction in the IC50 value and a synergistic decrease in the cell survival rate compared to using formononetin or ABT-737 alone. The IC50 dose required for the combination treatment was lower than the IC50 dose needed for either compound on its own. Therefore, our data clearly indicate that the combined use of these two agents has a more pronounced impact on cell survival and apoptosis than the treatment with each agent separately. So far, numerous investigations have been conducted to explore the correlation between the expression level of the Mcl-1 gene in cancer cells and their resistance to ABT-737. For example, Konopleva et al. [24] in a study investigated the factors influencing the sensitivity and resistance of AML cells to ABT-737. Their research revealed that AML cells exhibiting elevated levels of anti-apoptotic proteins such as Bcl-xL, Mcl-1, or Bcl-2, along with decreased levels of Bim, a pro-apoptotic protein, is associated with the resistance of AML cells to ABT-737. Furthermore, the activation of survival pathways, like the PI3K/Akt pathway, was identified as a contributing factor to the resistance of AML cells to ABT-737. Tahir et al. [25] in another study investigated the contribution of Bcl-2 family member proteins to the cellular response of different small-cell lung cancer cells to ABT-737. They found that small-cell lung cancer cell lines that exhibited heightened expression of Bcl-2, Bcl-xL, Bim, and Noxa, along with diminished levels of Mcl-1, demonstrated susceptibility to ABT-737. Wang et al. [26] demonstrated that A-1210477, a specific inhibitor of Mcl-1, exhibited the ability to overcome resistance to ABT-737 in AML cells that had up-regulated Mcl-1. By combining A-1210477 with ABT-737, a synergistic effect was observed, leading to the induction of apoptosis in AML cells. In their study, Woo et al. [15] conducted research on the effect of YM155, a survivin inhibitor, and ABT-737 on cellular apoptosis in lung cancer, glioma, and renal cell carcinoma cells. They found that YM155 played a crucial role in enhancing the sensitivity of tumor cells to ABT-737 by reducing the expression of Mcl-1. In this study, we demonstrated that curcumin decreases the expression of the Mcl-1 mRNA and enhances the apoptosis caused by ABT-737 in MCF-7 and MDA-MB-231 breast cancer cells. Our results are in agreement with the above previous reports and confirm that curcumin can increase the sensitivity of the breast cancer cells to ABT-737 by suppressing the Mcl-1expression.

We also investigated the effect of curcumin and ABT-737 on gene expression. The result of qPCR revealed that ABT-737 enhanced the expression of Mcl-1 mRNA without affecting the expression of MMP-2 mRNA. Moreover, curcumin lowered the expression of both MMP-2 and Mcl-1 mRNA in tumor cells. In combination treatment, curcumin lowered the increased Mcl-1 mRNA induced by ABT-737, which was associated with inhibition of cell proliferation, colony formation, and cell migration, and enhanced apoptotic sensitivity to ABT-737. In accordance with our study, various studies have been conducted regarding the effect of curcumin on gene expression and cellular process of tumor cells. A previous study showed that curcumin inhibits tumor proliferation and induces apoptosis by inhibition of prosurvival pathways, including STAT3, AKT, and NF-kB in CLL B cells. Moreover, curcumin suppressed expression of the anti-apoptotic proteins Mcl-1 and XIAP, and up-regulated the pro-apoptotic protein Bim [27]. In another study, the effect of the dual PI3K/Akt and mTOR inhibitor NVP-BEZ235 and curcumin on human renal carcinoma Caki cells was investigated. The results of this study revealed that curcumin markedly induced apoptosis in NVP-BEZ235-treated cells. Moreover, combined treatment with NVP-BEZ235 and curcumin induces apoptosis through p53-dependent Bcl-2 mRNA down-regulation at the transcriptional level and Mcl-1 protein down-regulation at the post-transcriptional level [28]. Zou et al. [29] investigated the role of Flap endonuclease 1 (FEN1) in cisplatin resistance and the chemosensitizing effects of curcumin in breast cancer cells. They showed that FEN1 over-expression enhances cisplatin resistance in breast cancer cells, and that FEN1 knockdown by curcumin enhances cisplatin sensitivity. In a study, Attia et al. [30] investigated the effect of curcumin in combination with paclitaxel on MCF-7 breast cancer cells. Results showed that curcumin in combination with paclitaxel have synergistic cytotoxic interaction in MCF-7 breast cancer cells. Moreover, they showed that drug combination enhanced the expression of Bax, Caspase 7 and 9, and down-regulated the expression of multidrug resistance complex (MDR-1 or P-glycoprotein). Aggarwal et al. [31] in another study demonstrated that paclitaxel activates NF-kB in breast cancer cells and curcumin inhibits it. Curcumin also suppressed the paclitaxel-induced expression of anti-apoptotic (XIAP, IAP-1, IAP-2, Bcl-2, and Bcl-xL), proliferative (COX-2, c-Myc, and cyclin D1), and metastatic proteins (VEGF, MMP-9, and ICAM-1). It also enhanced apoptosis. The results presented in the above reports are consistent with our research, suggesting that treatment involving curcumin has the potential to increase the susceptibility of cancer cells to chemotherapeutic agents, such as ABT-737, through the activation of apoptosis.

Two primary signaling pathways regulate cellular apoptosis: the extrinsic pathway and the intrinsic or mitochondrial pathway [32]. The intrinsic pathway is activated by harmful stimuli within the cell, leading to the release of cytochrome c and the activation of caspases-9. In contrast, the extrinsic pathway is triggered by ligands binding to death receptors on the cell’s surface, resulting in the activation of caspase-8. Both pathways converge at caspase-3, a central player in the apoptotic process. Caspase-3 activation initiates a proteolytic cascade, activating other caspases and initiating a series of apoptotic events [32]. The regulation of intrinsic pathway is performed by the pro- and anti-apoptotic members of the Bcl-2 family proteins [33]. In apoptotic conditions, the pro-apoptotic members such as Bak and Bax are activated. Activated Bak and Bax cause the mitochondrial outer membrane permeability (MOMP), release of cytochrome c into the cytoplasm, and subsequently activation of caspases. The anti-apoptotic proteins such as Bcl-2 and Mcl-1, when not sequestered by pro-apoptotic members, inhibit apoptosis [34]. ABT-737, a synthetic BH3-mimic, exhibits strong binding affinity towards Bcl-2, Bcl-Xl, and Bcl-w proteins. However, its affinity towards Mcl-1 is relatively low. Research indicates that the up-regulation of Mcl-1 is linked to a decrease in the toxicity of ABT-737 and the development of secondary resistance. Consequently, inhibiting the Mcl-1 protein has been suggested as a potential approach to enhance the sensitivity to ABT-737 [8-10, 12, 35].

Curcumin has been shown to cause changes the expression of Bcl-xL, XIAP, Mcl-1 and Bcl-2 through AKT, NF-kB and STAT3 signaling pathways by which inhibits cell proliferation and triggers apoptosis [36]. Studies have shown that curcumin can induce apoptosis through both the extrinsic and intrinsic pathways. However, the exact mechanism of action is still unclear [37]. In this study, we demonstrated that curcumin decreases the expression Mcl-1. The observed change in gene expression was found to be closely correlated with the initiation of cellular apoptosis. Additionally, down-regulation of Mcl-1 was correlated with heightened responsiveness to ABT-737. The findings of our study indicate that curcumin has the potential to not only induce cell death but also increase the susceptibility of breast cells to chemotherapeutic drugs like ABT-737. This effect is achieved by altering the expression of Mcl-1, a protein involved in cell survival.

We also examined the effect of the compounds on cell migration. Matrix metalloproteinases (MMPs) are a family of proteolytic enzymes that play a crucial role in the progression of cancer, particularly in tumor invasion, neoangiogenesis, and metastasis. The MMPs are involved in the degradation of the extracellular matrix, which allows for the spread of cancer cells. High levels of MMPs have been correlated with poor overall survival in various types of solid tumors, including breast, lung, colon, gastric, pancreatic, and prostate cancer [38]. Our results showed that treatment with each of ABT-737 or curcumin inhibits the rate of cell migration. Inhibition of cell migration by curcumin was associated with suppression of MMP-2 gene expression in breast cancer cells. Our findings confirm the results of several past studies and show that curcumin plays a role in inhibiting cell migration and metastasis by reducing the expression of MMP-2 [36].

Curcumin exhibits extremely poor oral bioavailability (<1%) due to low water solubility, rapid metabolism (glucuronidation/sulfation), and chemical instability at physiological pH. These pharmacokinetic limitations result in subtherapeutic plasma concentrations despite high oral doses (up to 12 g/day), creating a significant gap between promising preclinical results and clinical efficacy. While in vitro studies show activity at µM concentrations, human trials achieve only nM levels, with >90% of circulating compounds being inactive metabolites. Translational challenges are compounded by inconsistent clinical trial designs and insufficient focus on bioavailability-enhanced formulations. Solutions include nanoparticle delivery (e.g., Theracurmin increasing bioavailability 185-fold), phytosome complexes (Meriva), and piperine adjuvants though manufacturing scalability and rigorous clinical validation remain critical for therapeutic translation.

In conclusion, our study revealed that the combined administration of curcumin and ABT-737 resulted in a significant decrease in the IC50 value. Furthermore, this combination treatment exhibited a synergistic effect in reducing colony formation, impeding cell growth, and enhancing cell death compared to individual treatments. Notably, curcumin demonstrated its ability to inhibit cell migration and induce apoptosis in breast cancer cells by down-regulating MMP-2 and Mcl-1, respectively. Interestingly, the expression of Mcl-1 was observed to increase following treatment with ABT-737. Additionally, curcumin exhibited the potential to augment the apoptotic impact of ABT-737 in breast cancer cells by suppressing Mcl-1.

Table 1.

IC50 Values of the Curcumin and ABT-737, Alone and in Combination, in MCF-7 and MDA-MB-231 Cell Lines.

IC50 (µM)
MCF-7 MDA-MB-231
Curcumin 23.9 12.8
ABT-737 4.1 2.6
Combination 1.3* 0.8*
Open in a new tab

Data are expressed as the mean±SD (n=3). *p<0.05 versus single treatment

Author Contribution Statement

Study concept and design: HK and AA; Acquisition of data: ZSM, HB and HK; Analysis and interpretation of data: ZSM, HK and AA; Drafting of the manuscript: ZSM, HB, HK and AA; Critical revision of the manuscript for important intellectual content: HK and AA; Funding recipients: HK and AA..

Acknowledgements

The authors thank the Molecular and Medicine Research Center, Arak University of Medical Sciences (AUMS), for providing the necessary equipment for this work.

Funding Statement

This work was supported by a grant from the Molecular and Medicine Research Center from AUMS of Iran [Grant number 4037].

Ethical approval

This work was supported by a grant from the Molecular and Medicine Research Center from AUMS of Iran [IR.ARAKMU.REC.1400.284].

Conflict of interest

The authors have no conflict of interest to declare

References

  • 1.Waks AG, Winer EP. Breast cancer treatment: A review. Jama. 2019;321(3):288–300. doi: 10.1001/jama.2018.19323. [DOI] [PubMed] [Google Scholar]
  • 2.Ji X, Lu Y, Tian H, Meng X, Wei M, Cho WC. Chemoresistance mechanisms of breast cancer and their countermeasures. Biomed Pharmacother. 2019;114:108800. doi: 10.1016/j.biopha.2019.108800. [DOI] [PubMed] [Google Scholar]
  • 3.Galluzzi L, Vitale I, Aaronson SA, Abrams JM, Adam D, Agostinis P, et al. Molecular mechanisms of cell death: Recommendations of the nomenclature committee on cell death 2018. Cell Death Differ. 2018;25(3):486–541. doi: 10.1038/s41418-017-0012-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Warren CFA, Wong-Brown MW, Bowden NA. Bcl-2 family isoforms in apoptosis and cancer. Cell Death Dis. 2019;10(3):177 . doi: 10.1038/s41419-019-1407-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Dillon CP, Green DR. Molecular cell biology of apoptosis and necroptosis in cancer. Adv Exp Med Biol. 2016;930:1–23. doi: 10.1007/978-3-319-39406-0_1. [DOI] [PubMed] [Google Scholar]
  • 6.Kønig SM, Rissler V, Terkelsen T, Lambrughi M, Papaleo E. Alterations of the interactome of Bcl-2 proteins in breast cancer at the transcriptional, mutational and structural level. PLoS Comput Biol. 2019;15(12):e1007485. doi: 10.1371/journal.pcbi.1007485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Williams MM, Cook RS. Bcl-2 family proteins in breast development and cancer: Could mcl-1 targeting overcome therapeutic resistance? Oncotarget. 2015;6(6):3519–30. doi: 10.18632/oncotarget.2792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sakakibara-Konishi J, Ikezawa Y, Oizumi S, Kikuchi J, Kikuchi E, Mizugaki H, et al. Combined antitumor effect of γ-secretase inhibitor and abt-737 in notch-expressing non-small cell lung cancer. Int J Clin Oncol. 2017;22(2):257–68. doi: 10.1007/s10147-016-1060-3. [DOI] [PubMed] [Google Scholar]
  • 9.Yalniz FF, Wierda WG. Targeting bcl2 in chronic lymphocytic leukemia and other hematologic malignancies. Drugs. 2019;79(12):1287–304. doi: 10.1007/s40265-019-01163-4. [DOI] [PubMed] [Google Scholar]
  • 10.Hwang E, Hwang SH, Kim J, Park JH, Oh S, Kim YA, et al. Abt-737 ameliorates docetaxel resistance in triple negative breast cancer cell line. Ann Surg Treat Res. 2018;95(5):240–8. doi: 10.4174/astr.2018.95.5.240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Li R, Zang Y, Li C, Patel NS, Grandis JR, Johnson DE. Abt-737 synergizes with chemotherapy to kill head and neck squamous cell carcinoma cells via a noxa-mediated pathway. Mol Pharmacol. 2009;75(5):1231–9. doi: 10.1124/mol.108.052969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Florent R, Weiswald LB, Lambert B, Brotin E, Abeilard E, Louis MH, et al. Bim, puma and noxa upregulation by naftopidil sensitizes ovarian cancer to the bh3-mimetic abt-737 and the mek inhibitor trametinib. Cell Death Dis. 2020;11(5):380 . doi: 10.1038/s41419-020-2588-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kang MH, Wan Z, Kang YH, Sposto R, Reynolds CP. Mechanism of synergy of n-(4-hydroxyphenyl)retinamide and abt-737 in acute lymphoblastic leukemia cell lines: Mcl-1 inactivation. J Natl Cancer Inst. 2008;100(8):580–95. doi: 10.1093/jnci/djn076. [DOI] [PubMed] [Google Scholar]
  • 14.Kim LH, Shin JA, Jang B, Yang IH, Won DH, Jeong JH, et al. Sorafenib potentiates abt-737-induced apoptosis in human oral cancer cells. Arch Oral Biol. 2017;73:1–6. doi: 10.1016/j.archoralbio.2016.08.034. [DOI] [PubMed] [Google Scholar]
  • 15.Woo SM, Min KJ, Seo BR, Seo YH, Jeong YJ, Kwon TK. Ym155 enhances abt-737-mediated apoptosis through mcl-1 downregulation in mcl-1-overexpressed cancer cells. Mol Cell Biochem. 2017;429(1-2):91–102. doi: 10.1007/s11010-016-2938-0. [DOI] [PubMed] [Google Scholar]
  • 16.Wang Y, Yu J, Cui R, Lin J, Ding X. Curcumin in treating breast cancer: A review. J Lab Autom. 2016;21(6):723–31. doi: 10.1177/2211068216655524. [DOI] [PubMed] [Google Scholar]
  • 17.Ghasemi F, Bagheri H, Barreto GE, Read MI, Sahebkar A. Effects of curcumin on microglial cells. Neurotox Res. 2019;36(1):12–26. doi: 10.1007/s12640-019-00030-0. [DOI] [PubMed] [Google Scholar]
  • 18.Bagheri H, Ghasemi F, Barreto GE, Rafiee R, Sathyapalan T, Sahebkar A. Effects of curcumin on mitochondria in neurodegenerative diseases. Biofactors. 2020;46(1):5–20. doi: 10.1002/biof.1566. [DOI] [PubMed] [Google Scholar]
  • 19.Song X, Zhang M, Dai E, Luo Y. Molecular targets of curcumin in breast cancer (review) Mol Med Rep. 2019;19(1):23–9. doi: 10.3892/mmr.2018.9665. [DOI] [PubMed] [Google Scholar]
  • 20.Tajbakhsh A, Hasanzadeh M, Rezaee M, Khedri M, Khazaei M, ShahidSales S, et al. Therapeutic potential of novel formulated forms of curcumin in the treatment of breast cancer by the targeting of cellular and physiological dysregulated pathways. J Cell Physiol. 2018;233(3):2183–92. doi: 10.1002/jcp.25961. [DOI] [PubMed] [Google Scholar]
  • 21.Ashofteh N, Amini R, Molaee N, Karami H, Baazm M. Mirna-mediated knock-down of Bcl-2 and mcl-1 increases fludarabine-sensitivity in cll-cii cells. Asian Pac J Cancer Prev. 2021;22(7):2191–8. doi: 10.31557/APJCP.2021.22.7.2191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Amri J, Molaee N, Karami H, Baazm M. Combination of two mirnas has a stronger effect on stimulating apoptosis, inhibiting cell growth, and increasing erlotinib sensitivity relative to single mirna in a549 lung cancer cells. Biotechnol Appl Biochem. 2022;69(4):1383–94. doi: 10.1002/bab.2211. [DOI] [PubMed] [Google Scholar]
  • 23.Baev DV, Krawczyk J, O׳Dwyer M, Szegezdi E. The bh3-mimetic abt-737 effectively kills acute myeloid leukemia initiating cells. Leuk Res Rep. 2014;3(2):79–82. doi: 10.1016/j.lrr.2014.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Konopleva M, Contractor R, Tsao T, Samudio I, Ruvolo PP, Kitada S, et al. Mechanisms of apoptosis sensitivity and resistance to the bh3 mimetic abt-737 in acute myeloid leukemia. Cancer Cell. 2006;10(5):375–88. doi: 10.1016/j.ccr.2006.10.006. [DOI] [PubMed] [Google Scholar]
  • 25.Tahir SK, Yang X, Anderson MG, Morgan-Lappe SE, Sarthy AV, Chen J, et al. Influence of Bcl-2 family members on the cellular response of small-cell lung cancer cell lines to abt-737. Cancer Res. 2007;67(3):1176–83. doi: 10.1158/0008-5472.CAN-06-2203. [DOI] [PubMed] [Google Scholar]
  • 26.Wang Q, Hao S. A-1210477, a selective mcl-1 inhibitor, overcomes abt-737 resistance in aml. Oncol Lett. 2019;18(5):5481–9. doi: 10.3892/ol.2019.10891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ghosh AK, Kay NE, Secreto CR, Shanafelt TD. Curcumin inhibits prosurvival pathways in chronic lymphocytic leukemia b cells and may overcome their stromal protection in combination with egcg. Clin Cancer Res. 2009;15(4):1250–8. doi: 10.1158/1078-0432.CCR-08-1511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Seo BR, Min KJ, Cho IJ, Kim SC, Kwon TK. Curcumin significantly enhances dual pi3k/akt and mtor inhibitor nvp-bez235-induced apoptosis in human renal carcinoma caki cells through down-regulation of p53-dependent Bcl-2 expression and inhibition of mcl-1 protein stability. PLoS One. 2014;9(4):e95588. doi: 10.1371/journal.pone.0095588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Zou J, Zhu L, Jiang X, Wang Y, Wang Y, Wang X, et al. Curcumin increases breast cancer cell sensitivity to cisplatin by decreasing fen1 expression. Oncotarget. 2018;9(13):11268–78 https://doi. doi: 10.18632/oncotarget.24109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Attia YM, El-Kersh DM, Ammar RA, Adel A, Khalil A, Walid H, et al. Inhibition of aldehyde dehydrogenase-1 and p-glycoprotein-mediated multidrug resistance by curcumin and vitamin d3 increases sensitivity to paclitaxel in breast cancer. Chem Biol Interact. 2020;315:108865. doi: 10.1016/j.cbi.2019.108865. [DOI] [PubMed] [Google Scholar]
  • 31.Aggarwal BB, Shishodia S, Takada Y, Banerjee S, Newman RA, Bueso-Ramos CE, et al. Curcumin suppresses the paclitaxel-induced nuclear factor-kappab pathway in breast cancer cells and inhibits lung metastasis of human breast cancer in nude mice. Clin Cancer Res. 2005;11(20):7490–8. doi: 10.1158/1078-0432.CCR-05-1192. [DOI] [PubMed] [Google Scholar]
  • 32.Karami H, Baradaran B, Esfahani A, Sakhinia M, Sakhinia E. Therapeutic effects of myeloid cell leukemia-1 sirna on human acute myeloid leukemia cells. Adv Pharm Bull. 2014;4(3):243–8. doi: 10.5681/apb.2014.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Nazmabadi R, Pooladi M, Amri J, Abbasi Y, Karami H, Darvish M. Dihydroartemisinin enhances the therapeutic efficacy of bh3 mimetic inhibitor in acute lymphoblastic leukemia cells via inhibition of mcl-1. Asian Pac J Cancer Prev. 2024;25(1):325–32. doi: 10.31557/APJCP.2024.25.1.325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Shahverdi M, Amini R, Amri J, Karami H. Gene therapy with mirna-mediated targeting of mcl-1 promotes the sensitivity of non-small cell lung cancer cells to treatment with abt-737. Asian Pac J Cancer Prev. 2020;21(3):675–81. doi: 10.31557/APJCP.2020.21.3.675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kim EY, Jung JY, Kim A, Chang YS, Kim SK. Abt-737 synergizes with cisplatin bypassing aberration of apoptotic pathway in non-small cell lung cancer. Neoplasia. 2017;19(4):354–63. doi: 10.1016/j.neo.2017.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zoi V, Galani V, Lianos GD, Voulgaris S, Kyritsis AP, Alexiou GA. The role of curcumin in cancer treatment. Biomedicines. 2021;9:9. doi: 10.3390/biomedicines9091086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Laubach V, Kaufmann R, Bernd A, Kippenberger S, Zöller N. Extrinsic or intrinsic apoptosis by curcumin and light: Still a mystery. Int J Mol Sci. 2019;20:4. doi: 10.3390/ijms20040905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Winer A, Adams S, Mignatti P. Matrix metalloproteinase inhibitors in cancer therapy: Turning past failures into future successes. Mol Cancer Ther. 2018;17(6):1147–55. doi: 10.1158/1535-7163.MCT-17-0646. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Asian Pacific Journal of Cancer Prevention : APJCP are provided here courtesy of West Asia Organization for Cancer Prevention

RESOURCES