MYO6 and Heart: A Novel Variant in a Deaf Infant With Supraventricular Tachycardia

ABSTRACT

Background

Variants in MYO6 are well known causes of hereditary deafness and have occasionally been linked to cardiac abnormalities, including hypertrophic cardiomyopathy and prolonged QT interval. However, supraventricular tachycardia (SVT) has not previously been associated with this gene.

Aim

To describe a neonate with congenital deafness, paroxysmal SVT, and QT prolongation carrying a novel homozygous MYO6 variant.

Methods

A 2‐month‐old male infant with bilateral congenital sensorineural hearing loss presented with recurrent paroxysmal SVT. Clinical evaluation included ECG, Holter monitoring, echocardiography, and laboratory studies. Whole‐exome sequencing followed by Sanger validation was performed to identify genetic alterations.

Results

The infant experienced repeated SVT episodes responsive to adenosine and was noted to have a prolonged QTc interval of 569 ms in sinus rhythm. Echocardiography showed mild LV enlargement with preserved function and no structural anomalies. Genetic testing revealed a novel homozygous frameshift variant in MYO6 (c.2496_2497delAC; p.H833Qfs*5).

Conclusion

While causality cannot be confirmed, this observation raises the possibility that MYO6 dysfunction may contribute to arrhythmogenic susceptibility in addition to its established role in auditory function. Further studies are warranted to clarify the relationship between MYO6 variants and cardiac conduction abnormalities.

A novel homozygous frameshift variant in the MYO6 gene (c.2496_2497delAC; p.H833Qfs*5) was identified in a neonate presenting with bilateral congenital sensorineural hearing loss, paroxysmal supraventricular tachycardia (SVT), and prolonged QT interval. This graphical abstract illustrates the proposed mechanistic link between MYO6 dysfunction and the coexistence of auditory and cardiac phenotypes. The variant likely disrupts MYO6‐related protein function, leading to cochlear impairment and potential arrhythmogenic susceptibility, highlighting the expanding spectrum of MYO6‐associated disorders beyond hearing loss.

1. Introduction

Hearing loss is the most prevalent sensory impairment in humans, affecting approximately 1 in 400 newborns. While environmental factors contribute to its incidence, more than 50% of pediatric cases are attributed to genetic causes (Carlson et al. 2023). Hereditary sensorineural hearing loss is a genetically heterogeneous condition that may follow autosomal dominant, autosomal recessive, X‐linked, or mitochondrial inheritance patterns (Alkowari et al. 2017). It is categorized as syndromic and non‐syndromic. To date, more than 150 genes have been implicated in nonsyndromic forms, with numerous others associated with syndromic hearing loss.

More than 400 distinct deafness syndromes have been described to date, underscoring the extensive clinical and genetic heterogeneity of hereditary hearing loss (Van Camp and Smith 2025). Variants in the MYO6 gene have been linked to hereditary hearing loss (Redowicz 1999). This gene is located on chromosome 6q13 and encodes myosin VI (MVI), an unconventional motor protein that plays a critical role in intracellular transport and maintaining the structure of hair cells in the inner ear (Melchionda et al. 2001). These hair cells are essential for the conversion of sound waves into electrical signals, a key step in the hearing process. MYO6 variants have been associated with various forms of hereditary hearing loss, including both autosomal dominant and autosomal recessive nonsyndromic deafness (DFNA22 and DFNB37, respectively) (Ahmed et al. 2003). These genetic alterations can impair the function or stability of MVI, leading to degeneration of sensory hair cells and, consequently, to progressive or congenital hearing loss (Hegan et al. 2015; Lehka et al. 2022). Cardiac abnormalities, such as myocardial hypertrophy and prolonged QT interval, have previously been reported in association with MYO6 variants, alongside sensorineural hearing loss (Mohiddin et al. 2004). However, no cases of supraventricular tachycardia (SVT) linked to MYO6 variants have been reported to date. SVT is an arrhythmia originating above the ventricles and is most commonly observed during infancy, especially in children under one year of age (Park and Salamat 2020). The prevalence of this disease is highly variable, ranging from approximately 4 to 400 cases per 100,000 individuals (Luca et al. 2020). Neonates with SVT may present with non‐specific and subtle clinical signs, including pallor, cyanosis, restlessness, tachypnea, and excessive sweating (Moak 2000). A number of genes have been implicated in the pathogenesis of cardiac arrhythmias, making genetic testing a valuable tool for early diagnosis of primary arrhythmic syndromes (Wilde and Bezzina 2005). In this study, we describe a two‐month‐old male patient presenting with hereditary bilateral deafness and SVT associated with a novel variant in the MYO6 gene. This study expands the known clinical spectrum of MYO6‐related disorders, as SVT has not previously been associated with variants in this gene.

2. Materials and Methods

2.1. Patient Recruitment and Clinical Evaluation

A 2‐month‐old male infant (Figure 1A) with bilateral congenital deafness was admitted to the emergency department of Rajaie Cardiovascular Institute, Tehran, Iran, with a diagnosis of paroxysmal supraventricular tachycardia (PSVT) and preliminary suspicion of myocarditis. A comprehensive clinical assessment was performed, including a detailed family history, physical examination, and diagnostic investigations. Cardiac evaluation comprised a 12‐lead electrocardiogram (ECG), 24‐h Holter monitoring, and transthoracic echocardiography (TTE). The QT interval was manually measured on a 12‐lead ECG by an experienced electrophysiologist. The corrected QT interval (QTc) was calculated using Bazett's formula (QTc = QT/√RR) on 12‐lead ECGs recorded during sinus rhythm. QT intervals were measured manually by an experienced pediatric electrophysiologist, and the final QTc value was obtained by averaging measurements from three consecutive cardiac cycles in leads II and V5. QTc was considered prolonged if it exceeded 470 ms. For the infant, auditory function was assessed using both auditory brainstem response (ABR) and otoacoustic emissions (OAE) testing. In ABR, click and tone‐burst stimuli at 0.5, 1, 2, and 4 kHz were presented, and wave V thresholds were determined for each frequency; thresholds above the 95th percentile of age‐adjusted normative data were considered abnormal (Elsayed et al. 2015). In OAE, stimuli around 1, 2, 3, and 4 kHz were delivered, and the presence of reproducible emissions was recorded; absence of emissions in frequencies where responses are expected according to normative data indicated potential hearing impairment (Cavalcante and Isaac Mde 2013). The study protocol was approved by the ethics committee of Rajaie Cardiovascular Institute, Tehran, Iran (IR.RHC.REC.1404.098) and conducted in accordance with the principles outlined in the Declaration of Helsinki. Informed consent to participate was obtained from all the participants in the study for adults. Informed consent to participate was obtained from the parents or legal guardians of any participant under the age of 16.

FIGURE 1.

(A) Pedigree of the family with congenital sensorineural hearing loss and supraventricular tachycardia. The proband (arrow) is a male infant born to consanguineous parents (double line). Individuals with congenital hearing loss are indicated by shaded symbols, and relatives with congenital valvular heart disease are marked accordingly. (B) DNA sequencing chromatogram of MYO6 showing the homozygous c.2496_2497delAC (p.H833Qfs*5) variant in the proband and heterozygous state in the parents. (C) Schematic representation of the MYO6 protein indicating the location of the truncating variant and predicted disruption of functional domains.

2.2. Genetic Testing

Genomic DNA was isolated from peripheral whole blood using the salting‐out method (MWer et al. 1988). The extracted and fragmented DNA was then used to investigate the genetic basis of the disorder. Whole‐exome sequencing (WES) was performed using the Illumina HiSeq 6000 platform with an average read depth of 150× (Macrogen Inc., the Netherlands). Raw sequencing data were analyzed at the Cardiogenetic Research Center, Rajaie Cardiovascular Institute, Tehran, Iran. Candidate variants identified through WES were subsequently validated by Sanger sequencing (Figure 1B). Specifically, causative variants associated with PSVT were confirmed within the family using gene‐specific primers (forward: agcctgggttgagactgtc, reverse: cttaaccagaccatcaatgct) targeting the MYO6 gene. PCR amplification was carried out on a SimpliAmp Thermal Cycler (Thermo Fisher Scientific), and the amplified products were sequenced using an ABI 3500XL Genetic Analyzer (Applied Biosystems). Sequencing data were analyzed using the BioEdit software. Raw paired‐end FASTQ reads generated by WES were aligned to the human reference genome (GRCh37/hg19) using a Burrows–Wheeler aligner (BWA), followed by local realignment, base quality score recalibration, and variant calling with a Genome Analysis Toolkit (GATK)‐based pipeline to detect single‐nucleotide variants and small insertions/deletions. Raw paired‐end FASTQ reads generated by WES were aligned to the human reference genome GRCh37/hg19 using a BWA‐GATK‐based pipeline, which has been locally established and clinically validated in our center. Although GRCh38/hg38 has become the current reference standard in many settings, GRCh37/hg19 was used here to ensure consistency with our existing diagnostic workflows and with legacy datasets and variant databases that are predominantly mapped to this build. Called variants were annotated with a comprehensive annotation suite incorporating population frequency resources (gnomAD, 1000 Genomes, ExAC), ClinVar, and multiple in silico prediction tools. Variants were filtered and prioritized based on quality metrics, minor allele frequency (MAF < 0.01), predicted functional impact (protein‐truncating or missense), and consistency with an autosomal recessive inheritance pattern. Particular attention was given to genes previously associated with hereditary hearing loss and cardiac arrhythmias, leading to the identification of a novel homozygous frameshift variant in MYO6 in the proband.

2.3. Bioinformatic Analysis

The bioinformatics approach was used to predict the functional impact of the identified variant, which is crucial for understanding its potential role in disease pathogenesis. To this end, we employed three established in silico prediction tools: MutationTaster (Schwarz et al. 2014), CADD (Kircher et al. 2014), and Franklin. In addition, the pathogenicity of the variants was evaluated according to the American College of Medical Genetics and Genomics (ACMG) guidelines (Richards et al. 2015). By integrating the computational predictions with the ACMG classification criteria, we aim to enhance our understanding of how specific genetic alterations contribute to SVT and congenital deafness. For prioritizing variants in known deafness genes, we systematically screened the WES data for rare, protein‐altering variants in established arrhythmia‐related and cardiac conduction genes, including ion‐channel, sarcomeric, and other cardiac regulatory genes. In addition, analysis of protein domains as well as secondary structure was also performed; structural modeling of MVI proteins was performed using SWISS‐MODEL (Figure 1C).

3. Results

3.1. Clinical Findings

A 2‐month‐old male infant was admitted to the emergency department of Rajaie Cardiovascular Institute with recurrent episodes of PSVT and a clinical suspicion of myocarditis. According to the parents, symptoms began approximately 20 days prior to admission and included excessive sweating, fatigue, pallor, and a dry cough. They also reported observing an abnormally rapid heart rate. The infant was initially evaluated at another medical center, where he was treated with intravenous adenosine and immunoglobulin (IVIG), leading to a temporary restoration of sinus rhythm. Upon presentation to our center, the patient was hemodynamically stable and afebrile (36.7°C), with a heart rate of 118 beats/min. An initial respiratory rate of 60 breaths/min and oxygen saturation of 92% on room air were recorded during mild irritability at triage; on repeat measurements in a calm state, the respiratory rate decreased to 40–45 breaths/min and oxygen saturation improved to 96%–98% on room air. Throughout the hospitalization, he maintained normal blood pressure for age, normal capillary refill, and no signs of respiratory distress, and did not require supplemental oxygen. He appeared alert and interactive, with no signs of respiratory distress. Cardiovascular examination revealed normal heart sounds, without murmurs, gallops, or pericardial rubs. Pulmonary, abdominal, and neurological examinations were unremarkable. Capillary refill was normal, and peripheral pulses were symmetric and well perfused. The infant is the second child of consanguineous parents. He was born at term via cesarean section following an uncomplicated pregnancy, with a birth weight of 3500 g. There were no perinatal complications. Bilateral congenital sensorineural hearing loss was identified during the neonatal period through routine ABR screening. Diagnostic ABR confirmed absent waveforms at maximum stimulus levels (90 dB nHL) in both ears, consistent with severe‐to‐profound sensorineural hearing loss. OAE testing yielded absent responses bilaterally, supporting cochlear dysfunction. Family history was notable for congenital deafness in multiple relatives and congenital valvular heart disease in a paternal uncle. During hospitalization, the patient experienced recurrent episodes of PSVT, each of which was successfully terminated with the administration of 1 mg intravenous adenosine. A course of IVIG was also administered due to suspected myocarditis. Laboratory evaluation showed elevated cardiac biomarkers, including pro‐B‐type natriuretic peptide (pro‐BNP) at 2703 pg/mL and troponin I at 0.093 ng/mL, supporting myocardial involvement. Inflammatory markers were within normal limits: C‐reactive protein (CRP) at 4 mg/L (considered negative), erythrocyte sedimentation rate (ESR) at 7 mm/h, and procalcitonin at 0.11 ng/mL. Viral serologies were negative, and thyroid function was normal (TSH: 1.58 μIU/mL). ECG during tachycardia showed a flutter‐type PSVT (Figure 2). TTE demonstrated mild left ventricular (LV) enlargement with preserved ejection fraction (EF) estimated between 55% and 60%, and no evidence of structural heart disease or pericardial effusion. Twenty‐four‐hour Holter monitoring revealed a baseline sinus rhythm, with intermittent episodes of junctional escape rhythm and occasional premature atrial contractions (PACs). In sinus rhythm, the manually measured QT interval was prolonged, with a QTc of 569 ms, exceeding the normal range for male infants (Figure 3). This value was calculated using Bazett's formula, based on averaged measurements from three consecutive beats, and serial ECGs during hospitalization consistently showed QTc values ≥ 540 ms, confirming persistent and reproducible QT prolongation.

FIGURE 2.

ECG obtained in the neonate during PSVT at a rate of 300 beats/min (paper speed, 25 mm/s; calibration, 10 mm/mV).

FIGURE 3.

Lead II electrocardiogram obtained in sinus rhythm at a rate of 150 beats/min, showing a prolonged QTc interval of 569 ms (paper speed, 25 mm/s; calibration, 10 mm/mV).

3.2. Genetic Information

WES identified a novel homozygous pathogenic variant in the MYO6 gene: c.2496_2497delAC (p.H833Qfs*5), a frameshift variant that has not been previously reported in public databases, including 1000 Genome, ExAC, and gnomAD (Table 1). Sanger sequencing confirmed the presence of this variant in the proband and demonstrated that both parents were heterozygous carriers. These findings are consistent with an autosomal recessive inheritance pattern, correlating with the observed clinical phenotype. No (likely) pathogenic or clearly suspicious variants were identified in known SVT or arrhythmia‐associated genes that could account for the cardiac phenotype.

TABLE 1.

The information obtained from various database for c.2496_2497delAC variant.

cDNA	AA modification	MutationTaster	1000G	ExAC	gnomAD	CADD	Franklin
c.2496_2497delAC	p.H833Qfs*5	Disease causing	0.0	0.0	0.0	36	Pathogenic

3.3. Bioinformatic Analysis

The c.2496_2497del variant in the MYO6 gene is a novel frameshift variant that introduces a premature stop codon, likely resulting in a truncated, non‐functional MVI protein. This predicted loss of function is consistent with known pathogenic mechanisms underlying MYO6‐related hearing loss. According to the ACMG guidelines, the c.2496_2497del (p.H833Qfs*5) variant can be classified as pathogenic based on the following criteria. PVS1 (very strong): this frameshift variant is predicted to introduce a premature stop codon, leading to nonsense‐mediated decay or a severely truncated protein. MYO6 is a well‐established cause of autosomal recessive nonsyndromic hearing loss (DFNB37), and multiple truncating (nonsense and frameshift) variants have been reported in affected families, supporting loss of function as a known disease mechanism for recessive MYO6‐related disease. Gene‐level constraint metrics from gnomAD further indicate intolerance to loss‐of‐function variation in MYO6 (low LOEUF and high pLI), consistent with selection against true loss‐of‐function alleles. PM2 (moderate): the variant is absent from major population databases, including 1000 Genomes and gnomAD, arguing against a common benign variant. PP3 (supporting): multiple computational tools, including MutationTaster and CADD, predict a deleterious effect, with a high CADD score of 36. Segregation data in the nuclear family are also consistent with autosomal recessive inheritance: the proband is homozygous for the variant, and both parents are heterozygous carriers. However, additional affected relatives were not available for testing, and extended family members with isolated deafness were not systematically genotyped; therefore, the strength of PP1 evidence remains limited, and we acknowledge this as a constraint on the overall level of certainty. To assess the functional impact of the variant, protein analysis was performed using UniProt and multiple sequence alignments across different species. The p.H833Qfs*5 variant introduces a frameshift at residue 833, leading to premature truncation of the C‐terminal tail domain of MVI. In the context of a truncating loss‐of‐function variant, the primary pathogenic mechanism is the predicted loss of the distal tail region rather than alteration of a single conserved residue. Structural modeling of the p.H833Qfs*5 variant revealed that the resulting truncation likely disrupts protein folding and stability. Loss of in the truncated MYO6 protein is expected to impair its normal intracellular transport functions, potentially affecting cardiac muscle contraction and contributing to the pathogenesis of SVT. It should be noted that our conclusions regarding the functional impact of p.H833Qfs*5 are based on in silico predictions, absence from population databases, and structural modeling, and we did not perform experimental assays (such as mRNA expression studies to confirm nonsense‐mediated decay or protein‐level functional analyses). Therefore, while the available evidence is strongly suggestive of a loss‐of‐function effect, definitive confirmation of the variant's impact on MYO6 expression and function will require future functional studies.

4. Discussion

MVI, encoded by the MYO6 gene, is an unconventional actin‐based motor protein that uniquely moves toward the minus end of actin filaments. It contains a motor domain with ATP‐ and actin‐binding sites, a neck region, and a C‐terminal globular tail involved in protein–protein interactions (Alizadehasl et al. 2025; Avraham et al. 1995; Nishikawa et al. 2002; Paz‐Cruz et al. 2023). It participates in a wide range of cellular processes, including endocytosis, membrane protein trafficking, regulation of actin cytoskeleton dynamics, autophagy, and the maintenance of Golgi apparatus organization (Hari‐Gupta et al. 2022). In the cochlea, it plays a critical role in maintaining hair cell stereocilia integrity, and its dysfunction is a recognized cause of sensorineural hearing loss (Ahmed et al. 2003; Oka et al. 2020). Beyond the auditory system, MVI expression has been demonstrated in human cardiac tissue, particularly within the sarcoplasmic reticulum and intercalated discs (Karatsai et al. 2023). Several studies have linked MYO6 variants to cardiac phenotypes, most notably hypertrophic cardiomyopathy and prolonged QT interval (Guo and Zha 2024; Karatsai et al. 2023; Mohiddin et al. 2004; Paz‐Cruz et al. 2023). Experimental data in MVI‐deficient mouse models have shown structural disorganization of intercalated discs, altered calcium handling through overexpression of SERCA2, and changes in vascularization (Hegan et al. 2015; Karatsai et al. 2023). These findings support the concept that MVI dysfunction can affect both the structural and electrophysiological integrity of the heart. However, the spectrum of cardiac manifestations in humans remains incompletely defined and may vary considerably depending on the specific variant. The cardio‐auditory link has historically been recognized in Jervell and Lange‐Nielsen syndrome (JLNS), a condition combining congenital deafness with prolonged QT interval due to potassium channel defects (Jervell and Lange‐Nielsen 1957). The coexistence of severe congenital sensorineural hearing loss and marked QTc prolongation in our patient naturally raises concern for inherited cardio‐auditory channelopathies, most notably JLNS. As such, JLNS and other long QT syndromes were included in the initial differential diagnosis. However, targeted analysis of major LQTS genes (including KCNQ1 and KCNE1) within the WES data did not reveal any pathogenic or likely pathogenic variants, and there was no family history of syncope or sudden cardiac death, while ECGs in the available relatives did not show QT prolongation. These findings make a classic JLNS phenotype less likely, although reduced penetrance or contribution from as‐yet unidentified channelopathy genes cannot be entirely excluded. In this context, the homozygous MYO6 loss‐of‐function variant remains the most compelling genetic finding and may represent either the primary driver or a key modifier of the combined auditory and arrhythmic phenotype. However, the cardiac phenotype in MYO6‐related disease appears more heterogeneous and less well characterized. Our patient, a male neonate with congenital bilateral sensorineural hearing loss caused by a homozygous frameshift variant in MYO6, presented with both prolonged QTc and recurrent SVT in the absence of structural heart disease. Prolonged QTc interval has been reported in MYO6‐related phenotypes (Karatsai et al. 2023; Mohiddin et al. 2004) and is a known substrate for life‐threatening ventricular arrhythmias; however, SVT has not been previously described in this context. Although the presence of this arrhythmia in our patient may be coincidental, the known localization of MVI within intercalated discs (Karatsai et al. 2023) raises the possibility that its dysfunction could disrupt electrical conduction not only in the ventricles but also in the atria and other parts of the cardiac conduction system. Moreover, common secondary causes of SVT, such as viral myocarditis, were considered and excluded based on the negative viral serologies and normal inflammatory markers. Given that our observation is based on a single patient, we cannot establish a causal link between MYO6 variants and SVT. Nonetheless, this case raises the hypothesis that the electrophysiological phenotype of MYO6‐associated disorders might extend beyond ventricular repolarization abnormalities to include supraventricular conduction disturbances. Further case series, family studies, and mechanistic research will be necessary to determine whether these findings reflect a broader component of the MYO6‐related cardiac spectrum. Most pathogenic MYO6 variants reported to date are missense mutations, often located in the motor domain, and typically cause progressive, juvenile‐onset hearing loss. For example, Japanese cohort studies identified ~27 MYO6 variants in 33 families, accounting for ~2.4% of autosomal dominant, with onset often before age 40 and accelerated progression after 40 years (Oka et al. 2020). Missense variants such as p.E60Q or compound heterozygotes like p.Trp793Gly/Lys794Asn were functionally validated and associated with early‐onset (8–10 years) hearing loss. It should be acknowledged that the Bazett formula may overestimate QTc at higher heart rates, particularly in infants, and that manual QTc assessment is subject to interobserver variability. However, in our patient the heart rate during sinus rhythm was within a moderate range for age, QTc measurements were averaged over multiple beats and leads, and serial ECGs consistently showed markedly prolonged QTc values (≥ 540 ms), which reduces the likelihood that the extreme QTc prolongation reported here is solely attributable to formula‐related overcorrection or measurement error. A limitation of this study is that, although we performed a targeted analysis of established arrhythmia‐related genes in the exome data, we cannot completely exclude the presence of undetected variants in yet‐unknown or newly emerging SVT genes, and future reanalysis may reveal additional contributors to the cardiac phenotype.

5. Conclusion

We describe a neonate with congenital deafness, recurrent PSVT, and QTc prolongation carrying a homozygous MYO6 variant. Although we cannot conclude that the arrhythmias and QT prolongation are directly caused by this variant, the coexistence of these features raises the possibility that MYO6 may have a role in cardiac rhythm regulation in addition to its known link to hearing loss. Further studies are needed to clarify whether this association is causal or coincidental.

Author Contributions

T.M. and A.T. drafted the work. S.K. designed the project and performed WES analysis. M.K., N.M., and M.M. surveyed the patient clinically. All authors reviewed the manuscript.

Funding

The authors have nothing to report.

Ethics Statement

The study protocol was approved by the ethics committee of Rajaie Cardiovascular Institute, Tehran, Iran (IR.RHC.REC.1404.098) and conducted in accordance with the principles outlined in the Declaration of Helsinki.

Consent

Informed consent to participate was obtained from all the participants in the study for adults. Informed consent to participate was obtained from the parents or legal guardians of any participant under the age of 16.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The datasets generated and/or analyzed during the current study are available in the ClinVar repository (https://www.ncbi.nlm.nih.gov/clinvar/variation/4076158/). The accession number of the variant in ClinVar is as follows: NM_004999.4(MYO6):c.2499_2500del (p.His833fs): VCV004076158.1.