Abstract
Effective therapies for pancreatic ductal adenocarcinoma (PDAC) have remained limited. Conventional chemotherapies for pancreatic cancer (PC) suffer from dose-limiting toxicities and limited efficacy due to drug resistance, poor biodistribution, and extensive desmoplasia. Targeted delivery of microRNAs to modify the tumor microenvironment, in combination with chemotherapeutics, can enhance outcomes by mitigating off-target toxicity and reducing fibrosis and drug resistance associated with PC therapies. To address these challenges, we developed a tumor-guided dual-targeting nanosystem for the codelivery of miR-345 and gemcitabine. This system leverages the intrinsic chemistry of pentablock copolymers for selective endolysosomal escape in tumor cells as well as targeting through functionalization with the tumor-penetrating peptide iRGD (a multifunctional construct referred to as mGP-i). The mGP-i nanosystem exploits both passive and active targeting mechanisms within the tumor microenvironment to enhance the selective uptake and synergistic activity of miR-345 and gemcitabine in pancreatic tumors. The mGP-i nanosystem exhibited stability against RNase degradation and serum proteins for 24 h, with rapid release of gemcitabine over 48 h and prolonged miR-345 release over 1 week. In vivo biodistribution studies following intravenous administration in mice bearing subcutaneous PC tumors showed rapid and selective accumulation of mGP-i within tumor tissues. In an orthotopic syngeneic pancreatic tumor mouse model, mGP-i treatment significantly reduced tumor burden and metastasis compared with the control. Immunohistochemical analysis of mGP-i-treated tumors revealed reduced fibrosis and lower expression of the proliferation marker Ki-67, alongside increased TUNEL-positive cells, indicating apoptosis. Moreover, E-cadherin expression increased, while vimentin expression decreased, suggesting a transition toward a less invasive phenotype with reduced metastatic potential. These findings highlight mGP-i as a promising platform for tumor-targeted combination therapies in pancreatic cancer.
Keywords: nanomaterial, therapeutic, engineering, miRNA, drug delivery


1. Introduction
Current chemotherapy treatments for pancreatic ductal adenocarcinoma (PDAC) are largely ineffective, leading to the dismal 5-year overall survival rate of 13% in pancreatic cancer (PC) patients. Late-stage detection of PC, as well as poor biodistribution, dose-limiting toxicity, and drug resistance of traditional chemotherapies, are contributing factors to this poor prognosis. After surgical resection, gemcitabine (Gem) is one of the most commonly used first-line treatments for PC patients. However, PC often exhibits resistance to Gem, and higher dosages result in significant toxic side effects, with only minimal improvements in patient survival. , Pancreatic cells that are resistant to Gem have been shown to up-regulate sonic hedgehog (SHH), which is a key regulator of epithelial-to-mesenchymal transition (EMT), which further exacerbates the problem and can ultimately increase metastatic potential and drug resistance. Additionally, the extensive dense fibrotic tissue known as desmoplasia, which surrounds PC tumor cells, is also driven by SHH signaling. , Desmoplasia creates a physical barrier for chemotherapy penetration into the tumor, increasing the need for effective drug delivery approaches. Novel combination treatments with targeted drug delivery vehicles that address the downstream impacts of SHH signaling are needed. MicroRNAs (miRNAs) play a critical role in regulating gene expression at a post-translational level, influencing various processes related to cancer progression, metastasis, and treatment resistance. Therapeutic miRNAs that specifically target cancer-promoting genes represent a promising avenue for PC treatment, particularly when combined with standard chemotherapies. miR-345 is significantly down-regulated in PC tissues and cell lines. Restoring miR-345 has been shown to inhibit proliferation and metastasis and increase apoptosis of PC cells. , While miR-345 is a promising therapeutic agent, the effective clinical use of miRNA has been limited due to challenges associated with its delivery, stability, cellular entry, and endosomal escape. , Recently, several polymeric nanoparticle systems have been extensively explored for the delivery of therapeutic cargo. We have previously demonstrated a pentablock copolymer-based nanoscale dual-delivery system for delivering miR-345 and Gem to address these challenges. The pentablock copolymers are composed of temperature-responsive Pluronic F127 and pH-responsive poly(diethylaminoethyl methacrylate) (PDEAEM) end blocks that allow for electrostatic complexation with miRNA to form polyplexes. The dual-delivery nanoscale platform demonstrated strong stability and efficiently delivered miR-345 and Gem to pancreatic cancer cell lines, as well as to an orthotopic pancreatic cancer mouse model, following intraperitoneal administration. Despite these encouraging early findings, targeted nanoscale therapies compatible with intravenous delivery , are urgently needed to more effectively address the challenges posed by fast-growing tumors and mitigate off-target toxicity, inadequate tumor accumulation, and the dose-limiting toxicities typical of chemotherapy.
Due to their size, nanoparticles can passively accumulate in the tumor microenvironment through the enhanced permeation and retention (EPR) effect, although the heterogeneous vascular architecture of pancreatic tumors makes this advantage inconsistent. , Active tumor targeting requires the incorporation of a bioactive molecule in the delivery vehicle to selectively increase the uptake of the payload at the target site. Nanoparticles conjugated with targeting ligands take advantage of active tumor targeting to improve the accumulation of the payload in the tumor. Integrins αvβ3 and αvβ5, as well as neuropilin-1 (NRP-1), are differentially expressed in PC and surrounding stroma and have been investigated as targets for drug delivery. , iRGD is a 9-amino acid peptide that has shown high affinity for αvβ3 and αvβ5 integrins and NRP-1. , Several groups have shown the ability of iRGD to improve uptake in cancerous tissues, including PC. , , Importantly, two completed phase 1 clinical trials investigated iRGD, referred to as CEND-1, LSTA1, or Certepetide, which showed no safety concerns. − Currently, there are four ongoing clinical trials of iRGD in combination with multiple other chemotherapeutics, which underscores the importance of tumor targeting using iRGD. −
Our past in vitro work showed that because of their chemistry, the pentablock copolymers promote selective endosomal escape in cancer cells by exploiting differences in lysosomal pH between cancer cells and normal cells. , In the present study, we test this intrinsic targeting ability of the pentablock copolymers in vivo. We hypothesized that integrating the tumor-penetrating peptide iRGD into the pentablock copolymer–miRNA-345/Gem nanosystem would enable a more effective dual tumor-targeted therapeutic strategy for pancreatic cancer. The pentablock copolymer was functionalized with the iRGD peptide using the click chemistry method, followed by characterization using FTIR, 1H NMR, and UV-spectroscopy techniques. The stability of the iRGD-guided nanosystem was assessed using gel electrophoresis, as well as size and zeta potential measurements. The impact of iRGD functionalization on biodistribution and tumor targeting was investigated in a pancreatic tumor mouse model using in vivo imaging. The efficacy of the functionalized nanosystem carrying miR-345 and Gem, when administered intravenously to mice, confirmed increased accumulation in the tumor and significantly reduced tumor burden and metastasis in orthotopically implanted tumor-bearing mice, providing a very promising approach for the treatment of PC.
2. Materials and Methods
2.1. Polymer Synthesis and Characterization
Chemicals for the pentablock copolymer synthesis were purchased from Fisher Scientific and Sigma-Aldrich. The pentablock copolymer was synthesized and characterized as previously described. Briefly, Pluronic F127 was reacted with α-bromoisobutyryl bromide to make a brominated macroinitiator. Simultaneously, N-propylpyridynyl methanimine (NPPM) ligand was synthesized. Macroinitiator, NPPM ligand, and N,N-(diethylamino)ethyl methacrylate (DEAEM) with cuprous oxide nanoparticles as a catalyst were reacted by atom transfer radical polymerization (ATRP) to synthesize poly(2-diethylaminoethyl methacrylate) (PDEAEM)-based pentablock. The structure and molecular weight of polymers were determined via 1H NMR in deuterated chloroform using the Varian MR-400 (Varian Inc., Palo Alto, CA, USA).
2.2. Polymer Functionalization
The functionalization of the pentablock copolymer with iRGD required three reactions: (1) azidation reaction, (2) click reaction, and (3) NHS/amine conjugation. The azidation reaction is an SN2 nucleophilic substitution reaction required to substitute the bromines on the ends of the pentablock with azides. Unless otherwise noted, chemicals for functionalization reactions were purchased from Thermo Fisher Scientific (Waltham, MA, USA) and Sigma-Aldrich (Burlington, MA, USA). First, the pentablock and 10× molar excess sodium azide were dissolved in dimethylformamide (DMF) in a round-bottomed flask. The flask was moved to an oil bath set to 50 °C and allowed to react overnight. The pentablock-azide was then precipitated in chilled hexanes and filtered. The pentablock-azide solids were dissolved in Milli-Q water and ultimately lyophilized. Fourier-transform infrared spectroscopy (FTIR) was done to determine the presence of azides on the pentablock using the Nicolet iS50 FT-IR (Thermo Fisher Scientific, Waltham, MA, USA). The next reaction was to add an N-hydroxysuccinimide ester (NHS) to the end blocks of the pentablock-azide. The strain-promoted azide–alkyne cycloaddition (SPAAC) click reaction was chosen because it is highly efficient and does not require a copper catalyst, which is difficult to remove and can cause cellular toxicity in later studies. Dibenzocyclooctyne (DBCO) modified to contain an NHS ester (DBCO-NHS) was purchased directly from Vector Laboratories (previously Click Chemistry Tools, Newark, CA, USA). DBCO contains the alkyne that reacts with the azides on the pentablock-azide. Pentablock was dissolved in 0.2× PBS, while 2× molar excess DBCO-NHS was dissolved in dimethyl sulfoxide (DMSO). The dissolved pentablock and DBCO-NHS were combined and stirred for 20 h at room temperature. The reaction was monitored for completion by taking samples and observing the UV spectra at 310 nm decrease. The solution was then dialyzed against 0.2× PBS in 10 kDa MWCO Slide-A-Lyzer Mini Dialysis Devices (Thermo Scientific). The solution was dialyzed for a total of 24 h, with the PBS being exchanged after the first hour. The solution was then lyophilized.
The final reaction was to conjugate the NHS ester on pentablock-DBCO-NHS to primary amines on the iRGD peptide. The iRGD peptide with an amino acid sequence of c(CRGDKGPDC) was synthesized and purchased from the Protein Facility of the Iowa State University Office of Biotechnology. iRGD and 3× molar excess pentablock-DBCO-NHS end groups were dissolved in PBS (pH 7.4) and reacted for 4 h at room temperature under constant stirring. The solution was dialyzed and lyophilized by using the same method previously stated for the click reaction. FTIR was used to determine the presence of iRGD conjugated to the pentablock. The iRGD attached to the pentablock was quantified using a microbicinchoninic acid (microBCA) assay kit (Thermo Scientific) with a standard curve plotted by using known iRGD standards. The functionalized pentablock copolymer with attached iRGD is referred to in the paper as P-i.
2.3. Synthesis and Characterization of Functionalized Nanosystem
Gem-loaded Pluronic F127 micelles were synthesized similar to our previous work using the thin-film hydration method. Briefly, gemcitabine (TCI America, Portland, OR, USA) and Pluronic F127 (Sigma-Aldrich) were dissolved in acetonitrile in a round-bottom flask. The acetonitrile was evaporated off using a rotary evaporator, allowing the Gem and Pluronic F127 to form a thin, dry film on the bottom of the flask. The film was dissolved in Milli-Q water and subsequently lyophilized. The encapsulation efficiency and loading of Gem into the micelles were determined using reverse-phase UV-HPLC. All eluents were purchased from Fisher Chemical (Thermo Fisher Scientific) and were HPLC grade. An isocratic solvent ratio of 60:20:20 Milli-Q water with 0.1% trifluoroacetic acid to methanol to acetonitrile was used as the mobile phase at a flow rate of 1 mL/min for 10 min in a Zorbax Eclipse XDB-C8 5 μm 4.6 × 150 mm column. The Gem was measured at a wavelength of 275 nm and eluted at 1.65 min. The miR-345 used in all studies was Hsa-miR-345-5p miRNA mimic sequence GCUGACUCCUAGUCCAGGGCUC, purchased from QIAGEN (Hilden, Germany). After pentablock copolymer synthesis and functionalization with iRGD, miR-345 was electrostatically complexed to the pentablock copolymer (P) or P-i at various N/P ratios (the ratio of nitrogen in the pentablock to phosphates in miR-345). Complexation was done by mixing the required volume of P or P-i at 10 mg/mL with miR-345 at 66.7 pg/μL in PBS and incubating the mixture at room temperature for 30 min. To assess complete complexation, the electrophoretic mobility of the mixtures was examined. The complexes, labeled as mP (containing pentablock P + miR-345) or as mP-i (containing functionalized pentablock P-i + miR-345), were loaded into a 1.5% (w/v) agarose gel with 0.5 μg/mL ethidium bromide. The gel was run with 1× Tris/acetate/EDTA (TAE) buffer at 100 mV for 30 min. The iBright Imaging System (Invitrogen, Waltham, MA, USA) was used to visualize and image the gels. An N/P ratio of 30 was used in further experiments as both mP and mP-i complexation were saturated at this ratio. To synthesize the final delivery vehicles, Gem micelles (G) in PBS were added to mP and mP-i at a concentration of 20 mg/mL with the volume necessary to achieve the desired therapeutic dosage of Gem. These mixtures were allowed to self-assemble via hydrophobic interactions at room temperature to form the pentablock combination delivery nanosystems mGP and mGP-i, containing both Gem and miR-345.
2.4. Stability and Release Characterization
Nanosystems mGP and mGP-i, without or with iRGD functionalization, respectively, were prepared at N/P = 30 with 0.35 μg miR-345 per sample and 1:5 P or P-i to gemcitabine by weight. The zeta potential and sizes of mGP and mGP-i were measured in Milli-Q water at 37 °C and pH 7.4 using the Zetasizer Nano ZS90 (Malvern Instruments Ltd., Worcester, UK). The stability of these delivery vehicles was assessed after incubating them in media containing 10% (v/v) fetal bovine serum (FBS), 2 μg/mL RNase A, or 20 μg/mL RNase A for 24 h. RNase A was purchased from MP Biomedicals (Solon, OH, USA). The size and zeta potential were measured again, and gel electrophoresis was used to visualize the RNase and serum stability of mGP and mGP-i. The samples were loaded into the gel and run in the same conditions as previously stated. Next, the release profiles of both Gem and miR-345 from mGP and mGP-i were determined. The nanosystems mGP and mGP-i were prepared as previously stated and diluted in PBS. Samples in triplicate containing 0.5 μg miR-345 at N/P = 30 and 70 μg of Gem total were added to 20 kDa MWCO Slide-a-Lyzer Mini Dialysis Devices and placed in centrifuge tubes containing 1× PBS. The samples were put in a 37 °C shaking incubator. At each time point, the PBS in the centrifuge tube was used for Gem and miR-345 quantification and replaced with fresh PBS. The same HPLC method was used to quantify Gem in the release study as was used to determine the encapsulation efficiency. The miR-345 concentration in release samples was measured using the Quant-iT RiboGreen RNA kit (Invitrogen) according to the manufacturer’s protocol.
2.5. Cell Culture and Viability Assays
Cell culture reagents including Dulbecco’s Modified Eagle Medium (DMEM), Roswell Park Memorial Institute Medium (RPMI), penicillin-streptomycin (Pen-Strep), fetal bovine serum (FBS), and 0.25% trypsin-EDTA were purchased from Gibco (Waltham, MA, USA) and Invitrogen. The human pancreatic cancer cell line AsPC-1 was cultured in RPMI supplemented with 10% (v/v) FBS and 1% penicillin-streptomycin. AsPC-1 is isolated from the ascites of a patient with pancreatic adenocarcinoma and is moderately to highly differentiated. This cell line was obtained from ATCC (Manassas, VA, USA). Additionally, a syngeneic mouse cell line derived from pancreatic tumors of KPC mice, referred to as KCT-3248 cells, was cultured in DMEM media supplemented with 10% (v/v) FBS and 1% penicillin-streptomycin. The KCT-3248 cell line was generated and sourced from the University of Nebraska Medical Center by Dr. Satyanarayana Rachagani. All cell lines were incubated at 37 °C with 5% carbon dioxide and were subcultured every 2–3 days. For cell viability assays, cells were seeded in 96-well plates at 8,000 cells/well and incubated overnight. Then the media was exchanged, and the cells were treated with either the pentablock copolymer (P), pentablock copolymer functionalized with iRGD (P-i), or iRGD to examine the toxicity of the polymers alone from 25 μg/mL to 150 μg/mL polymer. The plates were incubated for 48 h, followed by the addition of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye (Invitrogen) to a final concentration of 0.5 mg/mL. The plates were returned to the incubator for 3 h. Then the media was removed, and a stop solution (1:1 methanol:DMSO) was added. The plates were then put on a shaker to fully dissolve. The absorbances of the wells were measured at 570 nm. This experiment was repeated with combination treatments of mGP, mGP-i, and all controls in KCT-3248 cells. The dosage in that experiment was 10 pmoles miR-345 with increasing concentrations of Gem (1 μM, 2.5 μM, 5 μM, 10 μM, 20 μM, 30 μM, 50 μM). This study was done in triplicate.
2.6. Combination Index
The combination effect of miR-345 (m) and Gem (G) on human and murine PC cells was determined as reported by us previously. Briefly, AsPC-1 and KCT-3248 were seeded in a 96-well plate at a density of 8 × 104 cells per well and cultured. The cells were then treated with the miR-345 and Gem combination (1:48) for 72 h with the total dose in the range of 0.3–5 μg (m+Gem). The m+G combination was compared with mP+G, ensuring that the total doses of m and G were similar in both treatment groups. The viability of the treated cells was determined using MTT reagent. The growth inhibition data from the MTT assay were used to derive the combination index (CI) values with the CompuSyn software. A CI > 1 signifies synergism, CI < 1 specifies antagonism, and CI = 1 means an additive effect of the combination.
2.7. In Vitro Cellular Uptake Study
AsPC-1 cells were seeded in a 48-well plate and grown to full confluency. The cells were incubated with FAM-labeled miRNA: FAM-m (30 pmol), FAM-mP, and FAM-mP-i treatments in DMEM for 2 h. The FAM-labeled miRNA 216a was used as a model for the uptake study. The medium was then removed, and the cells were washed multiple times using 1× PBS. This was followed by lysing the cells using RIPA buffer for 30 min in the dark at room temperature. The cell lysates were then transferred to a 96-well black plate, and the FAM fluorescence measurements were recorded at an excitation/emission wavelength of 485/525 nm by using a SpectraMax i3x microplate reader (Molecular Devices, San Jose, CA).
2.8. Ex Vivo iRGD Affinity Assay
Pancreatic cancer tissues were collected from the untreated control mice from experiments under IACUC #40196 at the University of Missouri. Orthotopically implanted murine xenograft tumors, AsPC-1 and CD18/HPAF, were grown in athymic nude mice, while orthotopically implanted syngeneic tumors, KCT-3248, were grown in C57BL/6 mice. Normal murine pancreas tissue was also collected from C57BL/6 mice. The pancreatic cancer tissues were paraffin-embedded and cut into 4-μm sections. The slides were baked in the oven overnight at 55 °C. After removal from the oven, the slides were immediately washed in xylenes, followed by rehydration in a series of ethanol washes with decreased ethanol concentration. The slides were then washed in PBS, and the antigens on the tumor sections were retrieved by placing them in 10 mM citrate buffer (pH 6) at 90 °C for 20 min, followed by cooling to room temperature. The slides were washed thrice in PBS (5 min each time) and placed in a blocking solution containing 5% horse serum in PBS with 0.05% Tween 20 for 1 h. The slides were then washed in PBS. Prior to the procedure, miR-345 was labeled with Cy5 using the Label IT Cy5 Nucleic Acid Labeling Kit (Mirus Bio, Madison, WI, USA) according to the manufacturer’s recommendation. A volume of 300 μL of mGP-i containing 0.34 μg of miR-345-Cy5 was pipetted on top of each tissue section and kept in a dark and cold (4 °C) room overnight. The next day, the slides were washed thrice with PBS and then treated with 300 nM DAPI for 10 min and washed in PBS. Finally, the sections were imaged using an ECHO Revolve fluorescence microscope (San Diego, CA, USA).
2.9. Pluronic Micelles Labeled with Alexa Fluor 647
Pluronic F127 was labeled with Alexa Fluor 647 dye using the following procedure. The Pluronic F127-based brominated macroinitiator that was previously used in PB synthesis was used in the following reactions. The Pluronic F127 macroinitiator was dissolved with a 10× molar excess of sodium azide in DMF. The flask was moved to an oil bath set to 50 °C and allowed to react overnight. The resulting Pluronic-azide was precipitated in chilled hexanes, filtered, and dried overnight under vacuum. Next, copper sulfate and ascorbic acid were dissolved in water, and Pluronic F127-azide was dissolved in DMF. Alexa Fluor 647 alkyne (AF647) (Invitrogen) was added to the Pluronic-azide solution at a 1:10 mass ratio. The ascorbic acid and copper sulfate were mixed with the Pluronic-AF647 solution and reacted, protected from light, for 2 h at room temperature. The solution was then dialyzed against 0.2× PBS with 3 kDa MWCO Slide-a-Lyzer Mini Dialysis Devices. Finally, the Pluronic-AF647 solution was frozen and lyophilized.
2.10. Intravenous Biodistribution Study in Subcutaneous Pancreatic Tumor Mouse Model
The biodistribution study was performed in mice under the approval of the Institutional Animal Care and Use Committee (IACUC-22-232) at Iowa State University. Female C57BL/6 mice, aged 6 to 8 weeks, were obtained from the Jackson Laboratory (Bar Harbor, ME, USA). The mice were allowed to acclimate for 3–5 days before tumor induction began. Tumors were inoculated by injecting 2 million KCT-3248 cells subcutaneously into the right flanks of the mice and subsequently allowing them to grow for 10 to 14 days. Four groups were chosen for this experiment, including PBS (n = 4), dye only (n = 4), mGP (n = 5), and mGP-i (n = 5).
For assessing the biodistribution, mice were anesthetized under nebulized 2% isoflurane, and fluorescence images of the dorsal and ventral sides of each mouse were captured on the IVIS Spectrum (PerkinElmer, Waltham, MA, USA). The fluorescence images of the mice were captured prior to injections to establish the baseline fluorescence profile. The imaging parameters used for live animal imaging were Ex/Em 640 nm/680 nm with a 2-s exposure. The dosage for each mouse in the mGP and mGP-i groups was 20 pmol miR-345 complexed with either P or P-i at an N/P ratio of 30 and finally polyplexed with Pluronic F127-AF647 at a 1:5 weight ratio of P to Pluronic F127-AF647. A free dye group received the equivalent AF647 cadaverine (Invitrogen) treatment as a control group. The mice were injected i.v. with the treatments diluted in PBS (final volume 200 μL), and fluorescence images were captured at different time intervals of 0.5 h, 1 h, 2 h, 4 h, 9 h, and 23 h. Postimaging, the mice were euthanized, followed by dissection of the tumor and vital organs, including liver, spleen, kidneys, brain, heart, and lungs. The dissected organs were washed with PBS, dried, and imaged at Ex/Em 640 nm/680 nm with a 5-s exposure. All the images were analyzed using the Aura software (Spectral Instruments Imaging, Tucson, AZ, USA). The tumor fluorescence from the live animal imaging was determined by subtracting the mean radiance at different time intervals from the predosing baseline values. For the ex vivo organ imaging, the mean radiance values from control PBS-treated mice were considered the baseline and subtracted from the treatment groups.
2.11. Intraperitoneal Biodistribution Study in Orthotopically Implanted Syngeneic Tumor Mouse Model
This biodistribution study was performed in C57BL/6 mice under the approval of the IACUC (No. 40196) at the University of Missouri. Mice were obtained from Jackson Laboratory at 6–8 weeks old and allowed to acclimate in a pathogen-free environment for 2 weeks. Tumors were inoculated by injecting subconfluent KCT3248-firefly-Luciferase cells (0.5 × 106 cells each) in 50 μL phosphate-buffered saline (PBS) into the head of the pancreas of the mice while under anesthesia (xylazine and ketamine). Tumor growth was monitored by bioluminescence live animal imaging for 15 days until the tumors were fully developed. The mice with fully developed tumors were divided into 3 groups: PBS, Cy5-mGP-i, and Cy5-mGP. The miR-345 used in this study was labeled using a Label IT Cy5 Nucleic Acid Labeling Kit according to the manufacturer’s recommendations. The tumor-bearing mice were injected i.p. with 100 pmol miR-345-Cy5 complexed at an N/P ratio of 30 with P or P-i. Three mice from each group were sacrificed at the following time points postinjection: 0 h, 8 h, 24 h, 48 h, and 72 h. The pancreas, spleen, kidneys, heart, lungs, and liver were collected, washed in PBS, and prepared in OCT compound for tissue sectioning. The tissues were sectioned at 4 μm thick and stored at −80 °C. Stored tissue sections were retrieved from a −80 °C freezer and left to dry and thaw at room temperature for at least 1 h before initiating the mounting process. Thorough washing was performed by submerging the sections in fresh 0.1 M Tris-HCl, 0.15 M NaCl, 0.01% Tween 20 buffer (TBS-T) and placing them on a shaker for 3 min. Washing was repeated 4 times. Then, each tissue section was fixed for 10 min with approximately 500 μL of 4% paraformaldehyde (PFA) solution. After fixation, tissue sections were subjected to three consecutive washes for 3 min in fresh TBS-T. VECTASHIELD PLUS Antifade Mounting Medium with DAPI (60 μL) (Vector Laboratories) was then gently pipetted onto the center of each slide, followed by carefully placing a 24 × 60 mm coverslip on the tissue section. Lastly, the coverslip was sealed, and tissue sections were covered and stored in the fridge at 4 °C. The mounted tissues were imaged using the ECHO Revolve Microscope in the inverted position with a 4× magnification objective utilizing DAPI and Cy5 fluorescence channels. DAPI settings were adjusted for each tissue sample, while Cy5 settings remained the same throughout the study. The mounted tissue sections were placed upside down onto the microscope stage and shielded with a black cover to mitigate interference from external light sources. Images of the entire tissue section were captured in a grid with a 15% overlap between successive positions.
All of the images were analyzed using our novel web-based image processing platform (PixF) to determine the total Cy5 fluorescence in the tissue section. PixF can automatically and rapidly quantify the fluorescence in biological images. PixF gleans the spectral relationships between distinct colors in one or more fluorescent images and splits raw images into its user-chosen monochrome channels determined using a color picker. A user can choose up to 10 unique color channels and simultaneously process up to 500 images. PixF screens through these images and performs a side-by-side comparison of the amount of each color present and represents it as a horizontally stacked bar chart or box plot. The Cy5 fluorescence intensity was measured at 0 h, 8 h, and 72 h postinjection of PBS and Cy5-labeled mGP and mGP-i in mice with orthotopically implanted pancreatic tumors. Data were collected from the kidneys, heart, lungs, liver, and spleen (Figure S3). PixF is readily PixF is readily usable from: https://agrivax.studio/pixf-tools.
2.12. Efficacy Studies for Orthotopically Implanted Syngeneic Tumor Mouse Model
Animal experiments were conducted in accordance with the “Guidelines for the Care and Use of Laboratory Animals” established by the United States Public Health Service. The studies were performed under approved protocols sanctioned by the Institutional Animal Care and Use Committees (IACUC #40196) at the University of Missouri. Male and female C57BL/6 mice, aged 6 to 8 weeks, were obtained from the Jackson Laboratory. These mice, regardless of sex, were housed in a pathogen-free environment for 2 weeks to acclimatize them. This study aimed to evaluate the therapeutic efficacy of the iRGD functionalized nanosystem for combination delivery (mGP-i, n = 8) and compare it to functionalized monotreatments (mP-i and GP-i, n = 8) as well as the nonfunctionalized combination delivery nanosystem (mGP, n = 9) and free drug combination treatment (mG, n = 8) without the pentablock delivery vehicle. The subconfluent KCT3248-firefly-Luciferase cells (0.5 × 106 cells each) were suspended in 50 μL phosphate-buffered saline (PBS), which was injected into the head of the pancreas of the mice while under anesthesia (xylazine and ketamine) to establish syngeneic tumors. Tumors were allowed to develop for 8 days and confirmed by bioluminescence imaging on the AMI-HTX (Spectral Instruments Imaging) after injecting D-luciferin i.p. to determine the luciferase expression. The mice were randomized based on tumor size from the luciferase imaging, and the first treatments were given on day 8. All of the treatments in this study were given by tail vein injections twice per week for 4 weeks. The dosage of treatments included 10 pmoles of miR-345-5p and 3 μg of Gem. The N/P ratio used for the nanosystems mGP and mGP-i was 30. Tumor growth was monitored weekly using luciferase imaging on the AMI-HTX after i.p. injection of D-luciferin. At the terminal point of the treatment period (1 week after the last treatment), mice were euthanized, and tumors were excised; part of it was flash frozen (RNA and protein studies), and the remaining half was fixed in 10% buffered formalin for immunohistochemistry studies. Histological examination was performed to evaluate tumor morphology, cellularity, necrosis, and apoptosis. Kaplan–Meier survival curves were constructed to assess overall survival rates across different treatment groups.
2.12.1. Histology
Pancreatic tumor samples harvested from the mice were fixed in 10% buffered formalin. The samples were then processed and embedded in paraffin blocks. From each block, 4 μm sections were prepared and mounted on glass slides. The prepared pancreatic tissue sections were used for hematoxylin and eosin (H&E), Mason’s trichrome (MAT) staining, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, and Ki67 immunohistochemistry staining from all treatment groups.
2.12.2. Hematoxylin and Eosin (H&E) Staining
The 4 μm pancreatic tumor sections were deparaffinized in xylene and rehydrated through graded ethanol solutions (100% to 20% ethanol in PBS). Hematoxylin staining was performed for 5–10 min to highlight cell nuclei, followed by rinsing to remove excess stain. Eosin was applied for 1–2 min to stain cytoplasmic components and extracellular matrix. The slides were then dehydrated using increasing concentrations of alcohol (20%–100%), cleared in xylene, and mounted on a coverslip using a suitable mounting medium. Histological examination was conducted under a light microscope at 20× or 40× magnification to assess tumor morphology, cellularity, and necrosis, with representative images captured for analysis. The H&E-stained tissues were scored based on atypical cellular morphology, hyperchromasia (increased staining intensity of nuclei), pleomorphism (variation in shape and size of nuclei), and increased mitotic figures indicating rapid cell division. Additional factors included loss of acinar differentiation, formation of irregular gland-like structures, stromal density, desmoplastic stromal reaction, immune cell infiltration, vascular invasions, and necrosis.
2.12.3. Masson’s Trichrome Staining (MAT)
The 4 μm paraffin sections were deparaffinized with xylene, rehydrated through ethanol, and stained using Weigert’s iron hematoxylin for 10 min to visualize nuclei. Subsequently, the tissue sections were stained with Biebrich scarlet-acid fuchsin for 10 min to highlight cytoplasm and muscle fibers. Sections were differentiated using a phosphomolybdic/phosphotungstic acid solution for 10 min to distinguish connective tissue components, followed by staining with aniline blue for 10 min to highlight collagen and extracellular matrix. After staining, sections were dehydrated through increasing concentrations of ethanol (20–100%), cleared with xylene, and mounted with a resinous medium. Stained sections were analyzed under a light microscope, capturing images to quantify collagen fibers (blue) relative to the total tissue area, with cytoplasm and muscle fibers appearing red and nuclei black.
2.12.4. Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL) Assay
A commercially available kit (Abcam, ab206386) was used to detect apoptotic cells in mouse tissues from orthotopically implanted KCT-3248 tumors. Briefly, 4 μm thick tissue sections were deparaffinized in xylene and rehydrated with graded alcohol, followed by proteinase-K treatment and 3% H2O2 treatment to inactivate endogenous peroxidases in the cells. Biotin-labeled deoxynucleotide incorporation in apoptotic cells catalyzed by the terminal deoxynucleotidyl transferase (TdT) was detected by incubating with a streptavidin-horseradish peroxidase (HRP) conjugate. The signals were detected by 3,3′-diaminobenzidine (DAB) substrate, and sections were further counterstained with methyl green. Positive and negative control tissues treated with DNase I and water instead of TdT were compared.
2.12.5. Immunohistochemistry
For immunohistological analysis, tissue sections were heated overnight at 55 °C and then deparaffinized in xylene (2×, 5 min). The sections were then hydrated through graded alcohol (100%–20%). Then, citrate buffer (0.01 M, 95 °C, pH 6.0) was used for antigen retrieval. Endogenous peroxidase activity was quenched with 3% H2O2 in methanol for 1 h. After PBS washing, sections were blocked with 2.5% horse serum (ImmPRESS kit; Vector Laboratories) for 2 h. Next, sections were incubated with the primary antibodies at 4 °C overnight. The following antibodies from various vendors were used: Anti-Ki67 (Abcam, ab15580), Anti-E-cadherin (Proteintech, 13050-1-AP), and Anti-Vimentin (Proteintech). After overnight incubation, the sections were washed with PBS containing 0.01% Tween 20 (PBST) and then incubated for 30 min with peroxidase-labeled antimouse/antirabbit IgG (ImmPRESS kit, Vector Laboratories). The sections were washed with PBST (3×, 5 min) and then developed using a DAB substrate kit (Vector Laboratories). Counterstaining was performed with hematoxylin. Next, slides were dehydrated with graded alcohol (20–100%), followed by xylene (2×, 5 min). After drying, the slides were mounted with toluene and imaged. , A certified pathologist analyzed all immunostained slides in a blinded manner. An assessment of the slides was done based on the previously reported method where the level of intensity of tumor cell staining (range of 0, no staining; 1+, weak staining; 2+, moderate staining; 3+, intense staining) was made objectively by the pathologist after screening the entire area of the stained tissue section. The cytoplasmic and nuclear compartments of the cells were observed thoroughly, and a percentage of cells that were being stained increased with each level of increased staining intensity, making them directly proportional. The value of each staining level (0, 1, 2, or 3) was multiplied by the respective percentage of tumor cells at that intensity level, and the histogram represents the number of positive cells.
3. Results
3.1. Characterization of Functionalization Reactions
First, the pentablock copolymer was synthesized as stated above. The number-average molecular weight of the pentablock copolymers was determined using 1H NMR end-group analysis and found to be 15 kDa (Figure S1A). Three reactions were required to conjugate iRGD to the pentablock copolymers (Figure A). The substitution reaction replacing the bromines on the pentablock to azides was confirmed via the FTIR spectra, which showed a distinct azide peak at 2100 cm–1 (Figure B). Next, the SPAAC click reaction was confirmed by monitoring the UV intensity of the reaction solution at 310 nm corresponding with the DBCO. The reduced UV intensity over time confirmed that all the DBCO was clicked to pentablock-azide after 3 h (Figure S1B). Finally, the iRGD conjugation reaction was confirmed by FTIR spectra and quantified using a microBCA assay. The combination of OH and NH stretching between 3600 cm–1 to 3200 cm–1 and carbonyl peaks near 1700 cm–1 on the FTIR spectra indicated the presence of amino acids in iRGD present on pentablock-iRGD (Figure C). The quantity of iRGD attached to the pentablock, as determined by microBCA assay, was 1% (w/w) based on extrapolation from the iRGD standard curve (Figure S1C). These characteristics indicate successful functionalization of the pentablock copolymers with iRGD.
1.
Synthesis schematic and reaction characterization of P-i. (A) Simplified schematic of the chemical reactions required to functionalize pentablock copolymers with iRGD. (B) FTIR spectra showing azides (2100 cm–1) were substituted onto the pentablock end blocks (P–N3). (C) FTIR spectra showing lack of azide peak and matching iRGD peaks on pentablock-iRGD (P-i).
3.2. Stability and Release Studies
After confirming the successful functionalization of the pentablock copolymers with iRGD, nanosystems containing the iRGD-functionalized pentablock copolymers (P-i), miR-345 (m), and Gem (G) were synthesized and compared to the nonfunctionalized nanosystems (Figure A). Nanosystems were prepared at various N/P ratios to optimize the electrostatic complexation of miR-345 with P-i. The nanosystems were run on an agarose gel with ethidium bromide. For both mGP and mGP-i, the majority of miR-345 was complexed at N/P ratios of 10 and 20, but there were faint bands even with the miR-345 control, indicating incomplete complexation (Figure B). The N/P ratio of 30 was chosen for the rest of the studies because no uncomplexed miR-345 was detected. Next, the release rates of Gem and miR-345 were measured. The release of Gem from both mGP and mGP-i was complete at 48 h (Figure C). The release profile of Gem was nearly identical between mGP and mGP-i, with approximately 60% of Gem released in the first 4 h and 99% after 24 h (Figure C). The miR-345 release was slower than the Gem release for both mGP and mGP-i (Figure D). The mGP-i group had a slightly increased release rate on the first day and then matched with the mGP release rate for the remainder of the experiment (Figure D). The release of miR-345 was sustained over 7 days, with about 60% being released by day 2 and 94% released from mGP-i by day 7 (Figure D).
2.
Optimization and characterization of mGP-i. (A) Simplified schematic of mGP-i synthesis. (B) Agarose gel with ethidium bromide loaded with miR-345 (m), mP-i, and mP complexed at N/P ratios of 10, 20, and 30 to evaluate complete complexation. Fraction of gemcitabine (C) and miR-345 (D) released from mGP and mGP-i over time. (E) mGP and mGP-i stability evaluated by gel electrophoresis after 24 h incubation with PBS, RNase A, and 10% serum media. (F) Zeta potential of mGP and mGP-i before and after 24 h incubation in PBS or 10% serum media. (G) Hydrodynamic diameter (size) and (H) polydispersity index of mGP and mGP-i before and after 24 h incubation in PBS or 10% serum media. Error bars represent mean ± SEM, n = 3. * and *** represent p < 0.05 and 0.001, respectively.
Following the release studies, the stability of mGP and mGP-i in RNase and serum-containing media was evaluated for 24 h. After incubation at 37 °C in either PBS, 2 μg/mL RNase A, 20 μg/mL RNase A, or 10% serum, mGP and mGP-i complexes were run on an agarose gel. The PBS-treated groups showed that the complexes and even free miR-345 were stable in PBS (Figure E). The slight decrease in intensity of the mGP and mGP-i bands compared to free miR-345 is likely because 34% and 45% of the miR-345, respectively, was released after 24 h. The intensity of the mGP and mGP-i bands was consistent across the RNase and serum-treated groups, indicating they were stable over 24 h (Figure E).
The size and ζ-potential were also examined to assess stability. The zeta potentials of mGP and mGP-i were positively charged before and after incubation in PBS at approximately 2.5 mV. Incubation in 10% serum media resulted in −4.3 mV and −10.7 mV zeta potentials for mGP and mGP-i, respectively (Figure F). The change to negative ζ-potentials was expected due to serum proteins electrostatically attaching to the cationic complexes and could potentially reduce the targeting ability of the nanosystems. There was no significant difference in ζ-potential between mGP and mGP-i in any of the conditions tested. At the 0 h time point, the sizes of the mGP and mGP-i complexes were 20.2 and 17.8 nm, respectively, and showed low polydispersity indices (PDI) of 0.17 and 0.13, respectively (Figure G,H). After 24 h in PBS, the sizes of mGP and mGP-i did not change significantly, with both at around 18.5 nm. The PDI remained low for mGP and for mGP-i after 24 h in PBS (Figure H). The complexes remained stable in 10% serum after 24 h, only increasing 1 nm in size. The PDI increased significantly for both mGP and mGP-i, again due to the serum proteins attaching to the complexes (Figure H). Overall, both mGP and mGP-i exhibited excellent stability for 24 h in the presence of RNase A and 10% serum.
3.3. Synergistic Effect of miR-345 and Gem Combination against PC
The combination effect of miR-345 and Gem was examined against AsPC-1 and KCT-3248 cells at various concentrations with the total dose in the range of 0.3–5 μg (m+Gem). The m+G combination was compared with mP+G, with the total dose of m and G kept equivalent across both treatments. In AsPC-1 cells, the m+G combination revealed CI values much higher than 1 as expected. However, the mP+G combination demonstrated a CI significantly lower than 1, indicating strong synergy between mP and G at all tested doses (Figure A). Similar observations were seen in KCT-3248 cells in response to mP+G combinations (Figure B). Overall, these results denote a synergistic effect of the combination of m with G, particularly when it is delivered using the P.
3.
Synergy of m+G combination against PC. Combination index curves of m+G and mP+G combinations in (A) AsPC-1 and (B) KCT-3248 cells (CI < 1: synergism, CI = 1: additive effect, CI > 1: antagonism; Fa: fraction affected).
3.4. Cellular Uptake of m, mP, and mP-i
The cellular uptake study was performed to assess the effect of iRGD modification of P on cellular internalization under in vitro conditions. The assay results revealed that the mP and mP-i groups showed a significant increase of miR uptake in AsPC-1 cells compared to miR alone treatment (Figure ). However, no statistical significance was observed between the uptake of mP and mP-i as expected, highlighting that the iRGD modification mainly aids in vivo tumor targeting. The pentablock copolymer, whether modified or unmodified, shows excellent cellular internalization of the payload, as reported by us previously. ,
4.

Cellular uptake study. Mean fluorescence intensity of AsPC-1 cell lysate treated with FAM-labeled m, mP, and mP-i for 2 h. Error bars represent mean ± SEM, n = 3.
3.5. Affinity to Ex Vivo Pancreatic Tumor Tissues from Mice
After characterizing the nanosystems, an ex vivo affinity assay was performed on mouse pancreatic tumor tissue sections. AsPC-1, CD18/HPAF, and KCT-3248 cell-derived orthotopically implanted tumors as well as healthy mouse pancreatic tissue were used to assess the selective binding of mGP-i to different types of PC tissues. The Cy5 dye was used to label miR-345 in the mGP-i delivery vehicle. Labeling was confirmed by running free miR-345-Cy5 as well as Cy5-mGP-i on gel electrophoresis and imaging with the Cy5 fluorescence channel (Figure S2A). Normal mouse pancreatic tissues showed low binding of mGP-i, and CD18/HPAF-derived xenograft tumors showed a slightly increased binding. The remaining pancreatic cancer ex vivo tissues showed high levels of mGP-i binding, evidenced by the increased fluorescence signal from miR-345-Cy5 (Figure ). This assay showed that mGP-i selectively binds to pancreatic cancer tissues to varying degrees, depending on the cell type. Prior to beginning mouse studies, cell viability assays were performed in KCT-3248 cells to confirm the efficacy of mGP-i, which are shown in the Supporting Information (Figure S2B–D). The following in vivo studies were conducted with the KCT-3248 cell line because it showed increased binding of mGP-i and can be used in a syngeneic mouse model.
5.
Ex vivo affinity of Cy5-labeled mGP-i to pancreatic cancer tissues from mice. Representative fluorescence images of ex vivo mouse pancreas and PC cell line-derived mouse pancreatic tumor tissues after 24 h incubation at 4 °C with mGP-i containing miR-345 labeled with Cy5 (red). DAPI (blue) was used as the counterstain. The scale bars are 20 μm.
3.6. Biodistribution and Selective Accumulation of mGP-i at Pancreatic Tumors
After confirming the selectivity of binding of mGP-i in ex vivo tissues, biodistribution studies were performed to examine the selectivity of accumulation in pancreatic tumors in vivo after i.p. or i.v. administration of mGP and mGP-i. Cy5-mGP-i and Cy5-mGP were administered i.p. in orthotopically implanted KCT-3248 pancreatic tumor-bearing mice. To track the biodistribution of the treatments, the tumors and organs were collected and imaged for Cy5 fluorescence at multiple time points. There was an increase in Cy5-mGP-i at 24 h post-treatment compared to the Cy5-mGP group and background PBS group (Figure S3A). However, there was no significant change in fluorescence intensity compared to the background (PBS-treated mice) in the kidneys, heart, lungs, liver, and spleen in the i.p.-treated mice (Figure S3B–E).
Given that we observed an increase in the accumulation of mGP-i in the pancreas, we proceeded to perform a biodistribution study using i.v. administration. The biodistribution of i.v.-administered AF647-labeled mGP, mGP-i, and free AF647 dye was measured with live animal imaging of C57BL/6 mice bearing KCT-3248 cell-derived subcutaneous tumors. Mice with visible and palpable subcutaneous tumors were imaged for baseline fluorescence detection and then injected with AF647-labeled delivery vehicles via tail-vein injections. Images were taken at various time points between 0.5 and 23 h postinjection (Figure A). Both mGP and mGP-i showed rapid selective accumulation in the tumors compared to the free dye (Figure B). No fluorescence was detected from the PBS group, and only a very small accumulation of free dye was seen in the tumor sites. The average mGP-i mean radiance followed a trend of being higher than that of mGP at all the time points, although not statistically significant, and both showed a drop in fluorescence with time after the 0.5 h time point. The mice were euthanized 24 h postinjection, and the tumor and vital organs were excised. Ex vivo imaging of the tumors again showed greater accumulation of mGP and mGP-i compared to that of free dye (Figure C). The kidneys showed accumulation of mGP and mGP-i compared to that of the free dye as well. Very low amounts of mGP and mGP-i were detected in the liver, spleen, brain, and heart (Figure C). Interestingly, the lungs treated with mGP-i showed significant accumulation compared to that of mGP and free dye-treated lungs. Overall, these results indicate that mGP and mGP-i are readily accumulated in tumor tissues, but mGP-i does outperform mGP.
6.
Biodistribution of i.v.-administered mGP-i in subcutaneous tumor-bearing mice. (A) Schematic timeline of the biodistribution study. (B) Mean radiance of the subcutaneous tumors in C57BL/6 mice from live animal imaging at time points between 0.5 and 23 h post tail vein injection of AF647-labeled mGP and mGP-i. (C) Mean radiance of ex vivo organs from the mice with the IVIS 24 h after treatment. Error bars represent mean ± SEM, n = 4 (PBS and dye only), and n = 5 (mGP and mGP-i). Statistical analysis was done with 2-way ANOVA and Tukey’s multiple comparisons test. *, **, ***, and **** represent p < 0.05, 0.01, 0.001, and 0.0001, respectively. Only p < 0.05 is graphed.
3.7. mGP-i Efficacy Study in Orthotopically Implanted Syngeneic Pancreatic Tumor Mouse Model
Next, the efficacy of mGP-i in inhibiting orthotopically implanted pancreatic tumors in mice was compared to the controls (PBS and P-i), monotherapies with functionalized delivery vehicles (mP-i and GP-i), and the nontargeted combination therapies of mGP and mG (free miR-345 and Gem) (Figure A). The Kaplan–Meier survival curves showed that mice treated with mGP-i had the highest overall survival rate at the study endpoint (Figure B). This group had the longest median survival time among all of the treatment groups. Tumor-bearing mice treated with mGP-i also showed the greatest reduction in tumor growth, as assessed by both bioluminescence imaging and tumor weight (Figure C). The mP-i-treated group also showed a significant reduction in tumor size, although it was not as much as that of the mGP-i group. Ex vivo imaging of distant organs revealed a substantial reduction in metastatic spread in the mice treated with combination therapy (mG, mGP, and mGP-i) compared to the controls and groups with monotherapies. Out of all the groups, mGP-i-treated mice saw the most significant reduction in metastasis overall, with no metastasis detected in the lungs, kidneys, testes/ovaries, or cecum, and no more than 37.5% of mice had metastasis in the diaphragm, intestines, or spleen (Figure D). The mGP-treated mice had reduced metastatic spread, except for the lungs, where 75% of the mice in this group had metastasis.
7.
Efficacy of mGP-i in treating orthotopically implanted KCT-3248 pancreatic tumors in mice. (A) Schematic of the in vivo efficacy study plan and timeline. (B) Kaplan–Meier survival curve from the efficacy study. (C) Average tumor weights from the mice. (D) Heat map based on the percent of animals that had metastasis in each respective organ. Error bars represent mean ± SEM, n = 10 (PBS group), n = 8 (mG, mGP-i, mP-i, and GP-i), and n = 9 (mGP). Statistical analysis of tumor weights was done with ordinary one-way ANOVA. Only p < 0.05 was graphed. * represents p < 0.05.
3.8. Improved Histological and IHC Scores in mGP-i-Treated Mice
Further histological investigation using H&E staining of tumor specimens indicated significant changes in tumor form and cellularity across the therapy groups. Tumor tissues from the mGP-i group had lower cellularity, a lower mitotic index, less atypia, and fewer hyperchromatic nuclei in the tumor cells. They also exhibited higher necrosis, more severe apoptosis, and a lower EMT impact compared with tumors from the control group. In contrast, the control tumors displayed dense, poorly differentiated cells with high mitotic activity, indicative of aggressive tumor growth. The mP-i and mGP groups likewise had reduced cellularity and necrosis, albeit less than the mGP-i group. Tumors treated with mP-i, GP-i, and mG showed moderate changes in histological markers, with less apparent effects than the mGP-i and mGP groups (Figure A,B).
8.
Histology and immunohistochemistry markers of pancreatic tumor tissues from treated mice. (A) Representative microscope images from the pancreatic tumors from the efficacy study mice, including H&E staining, MAT staining, Ki-67, and TUNEL assay. (B) Histology scores from the H&E-stained tissues. Lower values indicate healthier tissues. (C) Area of fibrosis determined from the MAT staining. (D) Percent of Ki-67 positive cells indicating proliferative markers. (E) Percent of TUNEL positive cells indicating apoptosis of cells. Error bars are mean ± SEM, n = 8. Statistical analysis was done with ordinary one-way ANOVA and Tukey’s multiple comparisons test. Any groups that share a letter have calculated p > 0.05.
Next, MAT staining of the tumor tissue sections revealed distinct stromal changes among different treatment groups. In the control groups, an extensive fibrotic stroma was evident, characterized by dense collagen deposition surrounding the tumor cells. The mice tumors treated with mP-i, GP-i, and mG groups displayed moderate stromal fibrosis, with reduced collagen content compared to the controls. Notably, the mGP-i group exhibited by far the least amount of fibrotic stroma (5%), indicating a significant reduction in the level of collagen deposition and stromal fibrosis. The mGP group also saw a significant reduction in the fibrotic area, although it was not as great as that of the mGP-i group. These findings suggest that the combination therapy of miR-345 plus Gem, when delivered effectively, not only targets the tumor cells but also modulates the tumor microenvironment, reducing fibrosis (Figure A,C). To evaluate the therapeutic effects of different treatment groups on cell proliferation, we performed immunohistochemistry (IHC) using the Ki67 antibody, a cell proliferation marker (Figure A,D). In the control groups, a high density of Ki67-positive cells, greater than 60%, was observed, indicating a significant tumor proliferation. The group treated with mGP-i showed a significant reduction in cell proliferation, with the lowest Ki67 expression of 14%. The mP-i, GP-i, and mGP groups also showed a reduction in Ki67 expression, albeit less than the mGP-i group, indicating that targeted nanoparticles outperform nontargeted therapies, and among the targeted therapies, the combination treatment with miR-345 and Gem works synergistically.
To assess the percentage of apoptosis induced by different treatments, we performed a TUNEL assay. Representative images from the assay revealed apoptotic cells marked by dark brown-stained nuclei using DAB. The control groups displayed minimal TUNEL-positive cells of ∼5%, indicating low levels of apoptosis. In contrast, the treatment groups exhibited a significant increase in TUNEL-positive cells, with the mGP-i group showing the highest fraction at 52%. The mP-i, GP-i, and mGP exhibited moderate impact on apoptosis with approximately 30% of TUNEL-positive cells. This again suggests that the targeted combination therapy has a superior therapeutic efficacy (Figure A,E).
3.9. EMT Markers in mGP-i-Treated Tumors
After observing the significantly decreased metastasis in mGP-i-treated mice, we aimed to analyze the effects of the therapies on epithelial-mesenchymal transition (EMT) markers. The pancreatic tumor tissue sections were stained for E-cadherin and vimentin in all treatment groups (Figure A,B). The results demonstrated that E-cadherin, an epithelial phenotype marker, was expressed differently in each group. E-cadherin expression was lowest in the control groups, which corresponded to a loss of epithelial features and enhanced tumor invasion. Tumor-bearing mice treated with miR-345 (mP-i, mG, mGP, and mGP-i) resulted in at least a modest increase in E-cadherin expression, indicating a partial restoration of epithelial characteristics. Notably, the group treated with the mGP-i combination had the highest E-cadherin levels, indicating a considerable shift toward a more epithelial and less-invasive tumor phenotype. In contrast, the control groups had a high vimentin expression, which is associated with tumor aggressiveness and mesenchymal characteristics. The mP-i, mG, and mGP groups showed a moderate drop in the vimentin expression levels, indicating partial EMT suppression. Surprisingly, the mGP-i group had the lowest vimentin expression, indicating considerable suppression of the EMT process, leading to decreased metastatic potential. These findings clearly show that targeted delivery with mGP-i nanosystems has a superior therapeutic effect, effectively promoting an epithelial phenotype while suppressing mesenchymal traits, potentially reducing tumor invasiveness and metastasis more effectively than other treatment strategies (Figure A,C).
9.
EMT markers in pancreatic cancer tissues from treated mice. (A) Representative images of IHC pancreatic tumor section staining for E-cadherin and vimentin. (B) Bar graph representing the IHC scores for E-cadherin. (C) Bar graph representing the IHC scores for vimentin. Error bars are mean ± SEM, n = 8. Statistical analysis was done with ordinary one-way ANOVA and Tukey’s multiple comparisons test. Any groups that share a letter have calculated p > 0.05.
4. Discussion
Treating pancreatic cancer remains challenging as traditional chemotherapies have failed to significantly improve the prognosis for PC patients. The limitations of typical chemotherapies are associated with dose-limiting toxicity, off-target toxicity, and drug resistance. Targeted delivery of combination treatments is one approach that can address these challenges. This study examined how pentablock copolymer nanosystems functionalized with the tumor-penetrating peptide iRGD and loaded with miR-345 and gemcitabine can provide dual targeting to pancreatic tumors and provide new efficacious treatment options. Codelivery of miR-345-5p and gemcitabine offers significant advantages in synergistic cancer therapy by molecular-level gene regulation with cytotoxic chemotherapy, potentially enhancing tumor cell chemosensitivity, overcoming drug resistance mechanisms, and reducing required chemotherapy doses through targeted, controlled release systems. − Compared with other synergistic approaches such as dual small-molecule combinations or chemo-immunotherapy, this strategy can provide more precise modulation of oncogenic pathways and improved therapeutic indices. However, challenges remain, including complex codelivery carrier design, stability, targeted delivery, differential pharmacokinetics, and risk of off-target effects.
Functionalization of the pentablock copolymers with iRGD was successful, as evidenced by FTIR and microBCA assay (Figure ). At an N/P ratio of 30, there was no difference in the ability of mGP and mGP-i to electrostatically complex with miR-345 and serve as combination delivery vehicles. The sizes of mGP and mGP-i nanosystems were both close to 20 nm, which is in the ideal range to exploit the EPR effect in pancreatic tumors. Additionally, these nanosystems were stable for at least 24 h in the presence of RNase A and 10% serum media, which should provide sufficient time for transport to tumors. The release profile showed that all the Gem was released after 48 h and about 94% of the miR-345 was released after 7 days. This release profile and excellent stability of mGP-i ensure rapid exposure of Gem and prolonged exposure of miR-345 to the target tissues, which complements its selective binding properties, as demonstrated by the affinity assay. Rapid release of Gem is advantageous for controlling aggressive pancreatic tumors, as it enables one to quickly attain therapeutic concentrations needed to rapidly suppress tumor growth. The drug combination index studies showed the synergistic effect of the mP+G combination on AsPC-1 and KCT-3248 cells compared to the noncarrier-mediated group (m+G) (Figure ). The pentablock copolymer alone may exhibit some intrinsic biological effects, and while any potential contribution from the polymer cannot be entirely excluded, it is unlikely to account for the magnitude of the observed therapeutic benefit. The cell viability assay results (Figure S4) show the significant cytotoxic effect of the mP+G group in comparison with the polymer alone on pancreatic cancer cell viability. Importantly, the enhanced therapeutic outcome observed with the combination formulation suggests that the overall effect is predominantly driven by the synergistic interaction between the payloads, facilitated by the delivery system.
Our past in vitro work showed clearly that because of their intrinsic chemistry, the pentablock copolymers promote selective endosomal escape in cancer cells by exploiting differences in lysosomal pH between cancer cells and normal cells. , For intracellular distribution in vitro studies, where the mGP and mGP-i are added to the culture of pancreatic cancer cells, we would not expect to see much difference between cellular internalization of mGP and mGP-i because of the excellent internalization inside the cells due to the pentablock copolymers. , This is exactly what we observe for the mGP and mGP-i nanosystems from cellular internalization in this study (Figure ). However, we can clearly see that the uptake is significantly higher at 2.5 h for both the mGP and mGP-i polymers in pancreatic cancer cells compared to the miRNA alone. The mGP-i is expected to mainly aid with targeting in vivo in distant cells, as seen from the biodistribution studies (Figure ) showing much more rapid accumulation of the mGP-i in the pancreatic tumors. Further, the affinity assay showed selective binding of mGP-i to ex vivo mouse pancreatic cancer tissues compared to normal mouse pancreas tissue, especially the tumors derived from AsPC-1 and KCT-3248 PC cell lines. This finding aligns with other studies showing the selectivity of iRGD and the differential expression of integrins and NRP-1 in pancreatic tumors. , Accordingly, we hypothesized that the mGP-i administered intravenously to treat mice would have increased its accumulation in the KCT-3248 tumors compared to mGP. This was confirmed as the biodistribution study showed a trend of rapid accumulation of mGP-i in pancreatic tumors, higher than that of mGP. Both the mGP and mGP-i groups showed significantly higher accumulation in pancreatic tumors than the free dye group. This is likely due to the ability of the pentablock copolymers to selectively enable endosomal escape in cancer cells as opposed to normal cells, , as observed in our previous in vitro studies. Optimization of iRGD functionalization to further increase the number of iRGD peptides attached to the pentablock copolymer, as well as control the orientation of the iRGD, could potentially enhance mGP-i biodistribution and efficacy further. Ex vivo imaging of excised distant organs 24 h postinjection also showed significant accumulation of mGP and mGP-i in the tumors and kidneys compared to free dye, but not in the livers, spleens, hearts, or brains. Unexpectedly, mGP-i showed significant accumulation in the lungs compared to mGP and free dye. Integrins αvβ3 and αvβ5 are expressed in lung tissues. , Specifically in lung endothelial cells, αvβ5 integrins are highly expressed. The increased accumulation of mGP-i may be due to the fact that iRGD specifically targets αvβ3 and αvβ5 integrins. We relied on fluorescence-based biodistribution to evaluate the in vivo distribution profile. The future studies will incorporate quantitative Gem-based analysis to further validate targeted delivery efficiency.
In the syngeneic KCT-3248 orthotopically implanted pancreatic cancer mouse model, the survival probability of mGP-i-treated mice was the highest at the study endpoint compared to all other groups, consistent with the biodistribution studies and the rapid accumulation of mGP-i in pancreatic tumors. The tumor mass in the mGP-i-treated groups was the lowest of all groups and showed significantly decreased metastasis. The histology scores, derived from H&E staining, were slightly decreased in the mG group compared to the controls, while the mGP and mGP-i nanosystem groups showed significant decreases, indicating that these treatments resulted in healthier pancreatic tissues. The same trend was true for the areas of fibrosis and Ki67-positive cells, although mGP-i nanosystems also outperformed mGP. Again, the decrease in fibrosis and proliferative cells indicates that mGP-i treatment promotes healthier pancreatic tissues. Additionally, the monotherapies of mP-i and GP-i also decreased histology scores, the area of fibrosis, and Ki-67-positive cells compared to controls but not as significantly as mGP-i. The inverse trend was true for TUNEL-positive cells, again indicating that mGP-i is the most effective in causing apoptosis of tumor cells, and miR-345 works synergistically with Gem to cause apoptosis. This suggests that combination delivery nanosystems are necessary to enhance the treatment of pancreatic tumors and that iRGD functionalization for tumor targeting was the most effective approach. This reinforces that the combination of miR-345 and Gem, when loaded into iRGD-targeted pentablock copolymer nanosystems, works synergistically to treat PC. Taken together, mGP-i nanosystems significantly improved histology scores, reduced the area of fibrosis, reduced the number of proliferative cells, and increased the number of apoptotic cells.
Earlier reports on detailed mechanistic studies provide insights into the molecular pathways linking miR-345 to EMT suppression or stromal remodeling. , On the basis of this, to investigate metastatic potential, tumor tissue sections were stained for E-cadherin and vimentin expression. Reduced levels of E-cadherin with increased levels of vimentin are associated with EMT and increased metastatic potential. E-cadherin levels for the GP-i and mG groups were slightly increased compared to the controls, but mP-i and mGP had moderately increased levels of E-cadherin. The mGP-i group had the greatest increase in E-cadherin. The inverse trend was true for the vimentin levels. This indicated that when effectively delivered using iRGD-functionalized pentablock copolymer nanosystems loaded with the combination therapy of miR-345 and Gem, it was the most effective in reducing EMT. These results are consistent with the decrease in the percentage of animals with metastasis in the distant organs of the mGP-i-treated mice. In summary, these findings highlight mGP-i as a promising therapeutic strategy for pancreatic cancer while also underscoring the need for GMP-compliant scale-up to advance this nanosystem toward clinical investigation.
5. Conclusions
The study showed the efficacy of using functionalized pentablock copolymers for combination therapies for pancreatic cancer, with the advantages of (i) the ability of the cationic amphiphilic micelle-forming pentablock copolymers with protonatable tertiary amines to complex, condense into nanostructures, and protect the negatively charged miRNA from degradation; (ii) the ability of the triblock part of the pentablock copolymers to solubilize gemcitabine due to their amphiphilic nature for combination delivery of miRNA and gemcitabine; (iii) the ability for facile formulation of the nanoscale systems for combination therapy in aqueous environments; (iv) the ability of the pentablock copolymers themselves to target tumors by promoting uptake and selective endosomal escape of the miRNA in cancer cells as opposed to normal cells; and (v) the ability of the pentablock copolymers conjugated with iRGD to target integrins αvβ3 and αvβ5 that are differentially expressed in pancreatic cancer and stroma. This study demonstrated that iRGD-functionalized nanosystems are stable and effective for the codelivery of miR-345 and Gem to treat PC tumors. The results demonstrated that miR-345 and Gem work synergistically to treat PC, especially when targeted to tumors in vivo. iRGD functionalization improved the biodistribution of these nanosystems, and mGP-i outperformed mGP and other controls in in vivo therapeutic efficacy studies. This work is the first to demonstrate the dual-targeting ability of nanoscale systems in vivo for pancreatic tumors, enabling effective therapies through the chemistry and design of pentablock copolymers, as well as the iRGD functionalization of these polymers. Studies investigating the detailed mechanisms by which the combination of miR-345 and Gem inhibits EMT and metastasis in PC are warranted, as this work demonstrated the impact of targeted delivery of the miR-345 and Gem combination treatment on E-cadherin and vimentin levels.
Supplementary Material
The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsami.5c25021.
Figures for 1H NMR of pentablock copolymer, UV spectra characterization of the click reaction, characterizing miR-345 labeling using agarose gel, cell viability assays, intraperitoneal biodistribution study by fluorescence imaging of tumor and vital organs of mice (PDF)
B.M.W.: Methodology, Investigation, Formal analysis, Visualization, Writingoriginal draft, Writingreview and editing; S.N.N.: Methodology, Formal analysis, Investigation, Writingreview and editing; S.K.N.: Methodology, Investigation, Writingreview and editing; K.D.: Investigation, Writingreview and editing; C.P.M.: Investigation; B.M.A.: Investigation; S.R.: Conceptualization, Funding acquisition, Supervision, Writingreview and editing; S.M.: Conceptualization, Funding acquisition, Supervision, Writingreview and editing. S.R. and S.M.: Joint corresponding authors with equal contribution.
The authors acknowledge financial support from the National Institutes of Health, National Cancer Institute (R01 CA247763). S.K.M. also received support from the Carol Vohs Johnson Chair. R.C. acknowledges NSF EPSCoR RII Track-1#2242763 for supporting the development of PixF image processing toolkit used in this work.
The authors declare the following competing financial interest(s): Surya Mallapragada has equity interests in ImmunoNanoMed Inc. The other authors declare no conflicts of interest.
References
- Siegel R. L., Kratzer T. B., Giaquinto A. N., Sung H., Jemal A.. Cancer statistics, 2025. CA. 2025;75(1):10–45. doi: 10.3322/caac.21871. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fudalej M., Kwasniewska D., Nurzynski P., Badowska-Kozakiewicz A., Mekal D., Czerw A., Sygit K., Deptala A.. New Treatment Options in Metastatic Pancreatic Cancer. Cancers. 2023;15(8):2327. doi: 10.3390/cancers15082327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang L., Zhang Y., Wang W., Zhu Y., Chen Y., Tian B.. Gemcitabine treatment induces endoplasmic reticular (ER) stress and subsequently upregulates urokinase plasminogen activator (uPA) to block mitochondrial-dependent apoptosis in Panc-1 cancer stem-like cells (CSCs) PLoS One. 2017;12(8):e0184110. doi: 10.1371/journal.pone.0184110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Koltai T., Reshkin S. J., Carvalho T. M. A., Di Molfetta D., Greco M. R., Alfarouk K. O., Cardone R. A.. Resistance to Gemcitabine in Pancreatic Ductal Adenocarcinoma: A Physiopathologic and Pharmacologic Review. Cancers. 2022;14(10):2486. doi: 10.3390/cancers14102486. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Neoptolemos J. P., Kleeff J., Michl P., Costello E., Greenhalf W., Palmer D. H.. Therapeutic developments in pancreatic cancer: current and future perspectives. Nat. Rev. Gastroenterol. Hepatol. 2018;15(6):333–348. doi: 10.1038/s41575-018-0005-x. [DOI] [PubMed] [Google Scholar]
- Quint K., Tonigold M., Di Fazio P., Montalbano R., Lingelbach S., Ruckert F., Alinger B., Ocker M., Neureiter D.. Pancreatic cancer cells surviving gemcitabine treatment express markers of stem cell differentiation and epithelial-mesenchymal transition. Int. J. Oncol. 2012;41(6):2093–2102. doi: 10.3892/ijo.2012.1648. [DOI] [PubMed] [Google Scholar]
- Bulle A., Lim K. H.. Beyond just a tight fortress: contribution of stroma to epithelial-mesenchymal transition in pancreatic cancer. Signal Transduction Targeted Ther. 2020;5(1):249. doi: 10.1038/s41392-020-00341-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Merika E. E., Syrigos K. N., Saif M. W.. Desmoplasia in Pancreatic Cancer. Can We Fight It? Gastroenterol. Res. Pract. 2012;2012:781765. doi: 10.1155/2012/781765. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bailey J. M., Swanson B. J., Hamada T., Eggers J. P., Singh P. K., Caffery T., Ouellette M. M., Hollingsworth M. A.. Sonic hedgehog promotes desmoplasia in pancreatic cancer. Clin. Cancer Res. 2008;14(19):5995–6004. doi: 10.1158/1078-0432.CCR-08-0291. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Su M. C., Nethi S. K., Dhanyamraju P. K., Prabha S.. Nanomedicine Strategies for Targeting Tumor Stroma. Cancers. 2023;15(16):4145. doi: 10.3390/cancers15164145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Smolarz B., Durczynski A., Romanowicz H., Hogendorf P.. The Role of microRNA in Pancreatic Cancer. Biomedicines. 2021;9(10):1322. doi: 10.3390/biomedicines9101322. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chu X., Wei D., Liu X., Long D., Tian X., Yang Y.. MicroRNAs as potential therapeutic targets for pancreatic cancer. Chin Med. J. (Engl.) 2022;135(1):4–10. doi: 10.1097/CM9.0000000000001826. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Srivastava S. K., Bhardwaj A., Arora S., Tyagi N., Singh S., Andrews J., McClellan S., Wang B., Singh A. P.. MicroRNA-345 induces apoptosis in pancreatic cancer cells through potentiation of caspase-dependent and -independent pathways. Br. J. Cancer. 2015;113(4):660–668. doi: 10.1038/bjc.2015.252. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Natesh N. S., White B. M., Bennett M. M. C., Uz M., Kalari Kandy R. R., Batra S. K., Mallapragada S. K., Rachagani S.. Emerging Role of miR-345 and Its Effective Delivery as a Potential Therapeutic Candidate in Pancreatic Cancer and Other Cancers. Pharmaceutics. 2021;13(12):1987. doi: 10.3390/pharmaceutics13121987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Z., Peng Y., Zhou H., Zhang M., Ju D., Chen Z.. MiRNA-based drugs: challenges and delivery strategies. Appl. Microbiol. Biotechnol. 2025;109(1):247. doi: 10.1007/s00253-025-13620-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Uz M., Kalaga M., Pothuraju R., Ju J., Junker W. M., Batra S. K., Mallapragada S., Rachagani S.. Dual delivery nanoscale device for miR-345 and gemcitabine co-delivery to treat pancreatic cancer. J. Controlled Release. 2019;294:237–246. doi: 10.1016/j.jconrel.2018.12.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ma X., Fan Z., Peng J., Nie L.. Ischemic Area-Targeting and Self-Monitoring Nanoprobes Ameliorate Myocardial Ischemia/Reperfusion Injury by Scavenging ROS and Counteracting Cardiac Inflammation. Adv. Sci. 2025;12(11):e2414518. doi: 10.1002/advs.202414518. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Determan M. D., Cox J. P., Mallapragada S. K.. Drug release from pH-responsive thermogelling pentablock copolymers. J. Biomed. Mater. Res., Part A. 2007;81a(2):326–333. doi: 10.1002/jbm.a.30991. [DOI] [PubMed] [Google Scholar]
- Balaban E. P., Mangu P. B., Khorana A. A., Shah M. A., Mukherjee S., Crane C. H., Javle M. M., Eads J. R., Allen P., Ko A. H.. et al. Locally Advanced, Unresectable Pancreatic Cancer: American Society of Clinical Oncology Clinical Practice Guideline. J. Clin. Oncol. 2016;34(22):2654–2668. doi: 10.1200/JCO.2016.67.5561. [DOI] [PubMed] [Google Scholar]
- Liu L., Kshirsagar P. G., Gautam S. K., Gulati M., Wafa E. I., Christiansen J. C., White B. M., Mallapragada S. K., Wannemuehler M. J., Kumar S.. et al. Nanocarriers for pancreatic cancer imaging, treatments, and immunotherapies. Theranostics. 2022;12(3):1030–1060. doi: 10.7150/thno.64805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Park J., Choi Y., Chang H., Um W., Ryu J. H., Kwon I. C.. Alliance with EPR Effect: Combined Strategies to Improve the EPR Effect in the Tumor Microenvironment. Theranostics. 2019;9(26):8073–8090. doi: 10.7150/thno.37198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Juiz N. A., Iovanna J., Dusetti N.. Pancreatic Cancer Heterogeneity Can Be Explained Beyond the Genome. Front. Oncol. 2019;9:246. doi: 10.3389/fonc.2019.00246. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hurtado de Mendoza T., Mose E. S., Botta G. P., Braun G. B., Kotamraju V. R., French R. P., Suzuki K., Miyamura N., Teesalu T., Ruoslahti E.. et al. Tumor-penetrating therapy for beta5 integrin-rich pancreas cancer. Nat. Commun. 2021;12(1):1541. doi: 10.1038/s41467-021-21858-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wey J. S., Gray M. J., Fan F., Belcheva A., McCarty M. F., Stoeltzing O., Somcio R., Liu W., Evans D. B., Klagsbrun M.. et al. Overexpression of neuropilin-1 promotes constitutive MAPK signalling and chemoresistance in pancreatic cancer cells. Br. J. Cancer. 2005;93(2):233–241. doi: 10.1038/sj.bjc.6602663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zuo H.. iRGD: A Promising Peptide for Cancer Imaging and a Potential Therapeutic Agent for Various Cancers. J. Oncol. 2019;2019:9367845. doi: 10.1155/2019/9367845. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kapp T. G., Rechenmacher F., Neubauer S., Maltsev O. V., Cavalcanti-Adam E. A., Zarka R., Reuning U., Notni J., Wester H. J., Mas-Moruno C.. et al. A Comprehensive Evaluation of the Activity and Selectivity Profile of Ligands for RGD-binding Integrins. Sci. Rep. 2017;7:39805. doi: 10.1038/srep39805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mamnoon B., Loganathan J., Confeld M. I., De Fonseka N., Feng L., Froberg J., Choi Y., Tuvin D. M., Sathish V., Mallik S.. Targeted polymeric nanoparticles for drug delivery to hypoxic, triple-negative breast tumors. ACS Appl. Bio Mater. 2021;4(2):1450–1460. doi: 10.1021/acsabm.0c01336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ma L., Chen Q., Ma P., Han M. K., Xu Z., Kang Y., Xiao B., Merlin D.. RGD-functionalized PEGylated nanoparticles for enhanced colon tumor accumulation and targeted drug delivery. Nanomedicine. 2017;12(16):1991–2006. doi: 10.2217/nnm-2017-0107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hou X., Chen Q., Fang Y., Zhang L., Huang S., Xu M., Ren Y., Shi Z., Wei Y., Li L.. iRGD-Guided Silica/Gold Nanoparticles for Efficient Tumor-Targeting and Enhancing Antitumor Efficacy Against Breast Cancer. Int. J. Nanomed. 2024;19:8237–8251. doi: 10.2147/IJN.S474135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dean A., Gill S., McGregor M., Broadbridge V., Jarvelainen H. A., Price T.. Dual alphaV-integrin and neuropilin-1 targeting peptide CEND-1 plus nab-paclitaxel and gemcitabine for the treatment of metastatic pancreatic ductal adenocarcinoma: a first-in-human, open-label, multicentre, phase 1 study. Lancet Gastroenterol. Hepatol. 2022;7(10):943–951. doi: 10.1016/S2468-1253(22)00167-4. [DOI] [PubMed] [Google Scholar]
- ClinicalTrials.gov Phase 1b/2 Clinical Study on Safety, Pharmacokinetics, and Preliminary Efficacy of CEND-1 for Injection in Patients With Advanced Metastatic Pancreatic Ductal Adenocarcinomain: i. Cend Therapeutics (Ed.)NCT05052567; ClinicalTrials, 2021. [Google Scholar]
- ClinicalTrials.gov. A Phase 1 Clinical Trial of CEND-1 in Combination With Nabpaclitaxel and Gemcitabine in Metastatic Exocrine Pancreatic Cancer, NCT03517176; ClinicalTrials, 2018. [Google Scholar]
- ClinicalTrials.gov A Phase 1B/2A Trial of CEND-1 in Combination with Neoadjuvant FOLFIRINOX Based Therapies in Pancreatic, Colon and Appendiceal Cancers (CENDIFOX), in: i. Cend Therapeutics (Ed.) NCT05121038; ClinicalTrials, 2021. [Google Scholar]
- ClinicalTrials.gov A Phase II, Randomized, Double-blind, Multi-center, Placebo-Controlled Study of the Efficacy and Safety of CEND-1 in Combination With Chemotherapy as First-Line Therapy in Patients With Locally Advanced Unresectable or Metastatic Pancreatic Ductal Adenocarcinoma, NCT06261359; ClinicalTrials, 2024. [Google Scholar]
- ClinicalTrials.gov A Phase 1b/2a, Double-blind, Placebo-controlled, Three Arm, Randomized Study Evaluating Continuous Infusion of LSTA1 Over 4 h When Added to Standard of Care (SoC) Versus a Single Intravenous (IV) Push of LSTA1 When Added to SoC, Versus SoC Alone in Subjects With Metastatic Pancreatic Ductal Adenocarcinoma (mPDAC) Who Have Progressed on FOLFIRINOX (FORTIFIDE), NCT06592664; ClinicalTrials, 2024. [Google Scholar]
- ClinicalTrials.gov. A Randomised, Double-blinded Phase II Study of Gemcitabine and Nab-Paclitaxel With LSTA1 (Certepetide) or Placebo in Patients With Untreated Metastatic Pancreatic Ductal Adenocarcinoma, S. University of (Ed.) p, in NCT05042128; ClinicalTrials, 2021. [Google Scholar]
- Zhang B., Mallapragada S.. The mechanism of selective transfection mediated by pentablock copolymers; part I: investigation of cellular uptake. Acta Biomater. 2011;7(4):1570–1579. doi: 10.1016/j.actbio.2010.11.032. [DOI] [PubMed] [Google Scholar]
- Zhang B., Mallapragada S.. The mechanism of selective transfection mediated by pentablock copolymers; part II: nuclear entry and endosomal escape. Acta Biomater. 2011;7(4):1580–1587. doi: 10.1016/j.actbio.2010.11.033. [DOI] [PubMed] [Google Scholar]
- Golombek S. K., May J. N., Theek B., Appold L., Drude N., Kiessling F., Lammers T.. Tumor targeting via EPR: Strategies to enhance patient responses. Adv. Drug Delivery Rev.Adv. Drug Delivery Rev. 2018;130:17–38. doi: 10.1016/j.addr.2018.07.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nethi S. K., Kothadiya S., White B. M., Rachagani S., Bardhan R., Mallapragada S. K.. Polyanhydride Copolymer-Based Niclosamide Nanoparticles for Inhibiting Triple-Negative Breast Cancer: Metabolic Responses and Synergism with Paclitaxel. ACS Appl. Mater. Interfaces. 2024;16(51):70362–70377. doi: 10.1021/acsami.4c17961. [DOI] [PubMed] [Google Scholar]
- Chen L., Wang H., Zhang H., Mu W., Shi X., Chen X.. Engineered gold nanoparticle-based miRNA precision regulation for tumor diagnosis and synergistic therapy. Smart Mater. Med. 2025;6(2):225–239. doi: 10.1016/j.smaim.2025.07.001. [DOI] [Google Scholar]
- Zhang Y., Yu X., Luo L., Xu Y., Zhang H., Mao Z., Zhang Y., Yang C., Wang L., Zhang P.. et al. Engineered manganese-BODIPY coordinated nanoadjuvants for enhanced NIR-II photo-metalloimmunotherapy. J. Controlled Release. 2024;376:1115–1129. doi: 10.1016/j.jconrel.2024.11.005. [DOI] [PubMed] [Google Scholar]
- Yi Y., Peng Z., Liu Y., Hao H., Yu L., Wen S., Sun S., Shi J., Wu M., Mei L.. siRNA micelleplexes-mediated glutamine metabolism re-engineering for vascular normalization-boosted photo-immunotherapy. Acta Pharm. Sin. B. 2025;15(4):2237–2252. doi: 10.1016/j.apsb.2025.02.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu Z., Hu W., Cai Y., Wang N., Omer A. M., Ling J., Mei L., Ouyang X. K.. Calcium peroxide functionalized mesoporous polydopamine nanoparticles triggered calcium overload for synergistic tumor gas/photothermal therapy. J. Colloid Interface Sci. 2025;690:137332. doi: 10.1016/j.jcis.2025.137332. [DOI] [PubMed] [Google Scholar]
- Wu J.. The Enhanced Permeability and Retention (EPR) Effect: The Significance of the Concept and Methods to Enhance Its Application. J. Pers. Med. 2021;11(8):771. doi: 10.3390/jpm11080771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Twu N.-C., Teoh Y. C., Tan C. P. H., Danudoro R., Cheng X., Espin-Palazon R., Bell T., Gimenez-Lirola L., Chowdhury R., Nelli R. K.. Spatial mapping of influenza and coronavirus receptors in the respiratory and intestinal tract epithelium of beef cattle using advanced PixF image analysis. Sci. Rep. 2025;15:44029. doi: 10.1038/s41598-025-28429-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Akashi Y., Oda T., Ohara Y., Miyamoto R., Kurokawa T., Hashimoto S., Enomoto T., Yamada K., Satake M., Ohkohchi N.. Anticancer effects of gemcitabine are enhanced by co-administered iRGD peptide in murine pancreatic cancer models that overexpressed neuropilin-1. Br. J. Cancer. 2014;110(6):1481–1487. doi: 10.1038/bjc.2014.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Singh B., Fu C. Z., Bhattacharya J.. Vascular expression of the αβ-integrin in lung and other organs. Am. J. Physiol. Lung C. 2000;278(1):L217–L226. doi: 10.1152/ajplung.2000.278.1.L217. [DOI] [PubMed] [Google Scholar]
- Su G., Hodnett M., Wu N., Atakilit A., Kosinski C., Godzich M., Huang X. Z., Kim J. K., Frank J. A., Matthay M. A.. et al. Integrin alphavbeta5 regulates lung vascular permeability and pulmonary endothelial barrier function. Am. J. Respir. Cell Mol. Biol. 2007;36(3):377–386. doi: 10.1165/rcmb.2006-0238OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feng A., Yuan X., Li X.. MicroRNA-345 inhibits metastasis and epithelial-mesenchymal transition of gastric cancer by targeting FOXQ1. Oncol. Rep. 2017;38(5):2752–2760. doi: 10.3892/or.2017.6001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Niknami Z., Muhammadnejad A., Ebrahimi A., Harsani Z., Shirkoohi R.. Significance of E-cadherin and Vimentin as epithelial-mesenchymal transition markers in colorectal carcinoma prognosis. EXCLI J. 2020;19:917–926. doi: 10.17179/excli2020-1946. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.








