Coordinated roles of melatonin and putrescine in modulating oxidative balance and gene expression during postharvest life of Alstroemeria hybrida

Abstract

This study investigated the effects of preharvest foliar application of putrescine and melatonin on enzymatic and non-enzymatic antioxidant systems, as well as molecular responses, in cut Alstroemeria hybrida cv. Amatista during postharvest storage. The experiment was arranged as a factorial completely randomized design with three factors and three replications. Treatments consisted of putrescine at three concentrations (0, 1.5, and 3 mM), melatonin at three concentrations (0, 50, and 100 µM), and four sampling times (0, 5, 10, and 15 days) during the postharvest period. Evaluated parameters included total phenolic and flavonoid contents, antioxidant capacity determined by DPPH radical scavenging activity, activities of antioxidant enzymes (catalase, superoxide dismutase, guaiacol peroxidase, and ascorbate peroxidase), and relative expression levels of SAMDC and SPMS genes. The results demonstrated that preharvest application of putrescine and melatonin significantly enhanced phenolic and flavonoid accumulation, antioxidant capacity, and enzymatic antioxidant activities throughout postharvest storage. Among the treatments, the combined application of 1.5 mM putrescine and 50 µM melatonin consistently induced the strongest antioxidant responses. Gene expression analysis further revealed a marked upregulation of SAMDC and SPMS transcripts in response to these treatments. Overall, the findings highlight the synergistic role of putrescine and melatonin and suggest that the combined application of 1.5 mM putrescine and 50 µM melatonin represents an effective and practical strategy for improving oxidative balance and postharvest performance of cut Alstroemeria flowers.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-46433-w.

Introduction

Alstroemeria hybrida is among the most commercially significant cut flowers in the global floriculture industry, having recently gained substantial popularity in markets such as Canada, Japan, the United Kingdom, and the United States¹. This widespread appeal is primarily attributed to its diverse and vibrant flower colors, which greatly enhance its ornamental value^2,3. Taxonomically, Alstroemeria was initially placed within the Liliaceae family, later reassigned to Amaryllidaceae, and is currently classified in the Alstroemeriaceae family based on recent phylogenetic studies. This monocotyledonous genus includes cold-sensitive annual or perennial plants, predominantly cultivated as perennials in tropical and subtropical climates⁴. The plant features alternate, glabrous leaves varying in color from grayish green to dark green, with broad laminae borne on short petioles. Flowering stems typically bear fewer leaves compared to the well-developed foliage of vegetative stems⁵. The terminal inflorescence is umbel-like, comprising florets with two distinct whorls of three petals each, differing in size and shape, and often marked by spots and streaks that add to their ornamental appeal⁴.

Despite its commercial importance, postharvest quality deterioration presents a major challenge for cut Alstroemeria flowers. These flowers are prone to rapid leaf yellowing during the postharvest period, which significantly compromises stem quality even before petal senescence begins. Consequently, leaf color, final flower size, and timing of petal abscission are critical quality parameters that influence the marketability and postharvest longevity of Alstroemeria⁶. In addition to these quality concerns, recent studies suggest that enhancing antioxidant defense pathways during preharvest stages may help mitigate postharvest deterioration in Alstroemeria⁷. The senescence mechanism in Alstroemeria is categorized as type II, primarily characterized by premature leaf yellowing, while the florets often retain satisfactory ornamental quality during this stage⁸.

In addition to leaf yellowing, ethylene plays a significant role in postharvest quality decline of Alstroemeria. Leaf yellowing has been linked to ethylene-induced chlorophyll degradation, which accelerates senescence. The application of certain compounds, such as polyamines, has been demonstrated to suppress ethylene biosynthesis and activity, thereby prolonging the vase life of cut Alstroemeria flowers⁹. Floret abscission further contributes to the reduction in vase life and ornamental value. Although Alstroemeria produces relatively low levels of endogenous ethylene, it exhibits considerable sensitivity to exogenous ethylene. This sensitivity can be effectively mitigated through the use of ethylene inhibitors¹⁰.

Polyamines are aliphatic compounds that share a common biosynthetic precursor, S-adenosyl methionine (SAM), with ethylene and are considered important plant growth regulators¹¹. These small molecules are ubiquitous across all living organisms and are synthesized from basic amino acids such as ornithine, arginine, and lysine. They play crucial roles in promoting cell proliferation and growth, although their precise functions in organogenesis remain under debate¹². Free polyamines primarily enhance cell division¹³ and, together with auxins and cytokinins, contribute to the formation of floral primordia and vegetative growth¹¹. Given their shared biosynthetic precursor with ethylene, polyamines are often regarded as anti-senescence agents. Exogenous application of polyamines has been shown to delay senescence in various plant species¹². Among the three major polyamines in plants, putrescine is a key intermediate in the common biosynthetic pathway, containing two amino groups and serving as a precursor for spermidine and spermine¹⁴.

Polyamines play a crucial role in cell division and elongation. They are essential for vegetative growth, including leaf area, fresh and dry weight of aerial and root organs, and flower number¹⁵. The ability of polyamines to delay senescence may be related to their capacity to inhibit ethylene production and stabilize cellular membranes¹⁶. The effects of polyamine application have been extensively studied. For example, Farooq et al.¹⁷ evaluated the efficacy of polyamines at varying concentrations—4 mM spermidine, 6 mM putrescine, and 6 mM spermine—applied as pulse treatments to maintain the postharvest quality of cut Consolida ajacis flowers. Their findings revealed a significant increase in petal phenolic content, with polyamines enhancing the activity of antioxidant enzymes such as superoxide dismutase, catalase, and ascorbate peroxidase to counteract the damaging effects of reactive oxygen species. Similarly, Tavallali et al.¹⁸ investigated the foliar application of spermidine, spermine, and putrescine (at 0.5, 1, and 2.5 mM) on secondary metabolites and antioxidant activity of potted Calendula officinalis flowers, reporting significant increases in total phenolic content, flavonoids, and antioxidant capacity. Ahmad et al.¹⁹ assessed the impact of different spermidine concentrations (1, 2, and 3 mM) and salicylic acid (1 and 2 mM) sprays on Calendula officinalis, finding that spermidine application significantly enhanced activities of antioxidant enzymes—including superoxide dismutase, peroxidase, and catalase—as well as total phenolic compounds, antioxidant capacity, and flavonoid content compared to control treatments. Moreover, Jiang et al.²⁰ explored the effects of various concentrations of spermine (0.1, 0.2, and 0.3 mM) and putrescine (1.5, 3, and 4.5 mM) foliar sprays on Anoectochilus roxburghii orchids. Their results showed that polyamine treatments significantly increased antioxidant enzyme activities (superoxide dismutase, peroxidase, and catalase) and secondary metabolite contents during the flowering stage. Additionally, the activity of S-adenosyl methionine decarboxylase (SAMDC), a key enzyme in polyamine biosynthesis, was notably upregulated following polyamine application.

Melatonin is an endogenous indoleamine involved in numerous physiological processes throughout the plant life cycle, including regulation of shoot and root growth, chlorophyll preservation, fruit ripening, and responses to environmental stresses. Several studies have also demonstrated its crucial role in delaying leaf senescence under various abiotic stresses such as heat, drought, darkness, salinity, and cold^21–27. Reactive oxygen species (ROS), mainly including superoxide anion (O₂⁻) and hydrogen peroxide (H₂O₂), are natural by-products of aerobic metabolism in plants. Excessive accumulation of ROS can initiate oxidative damage, thereby accelerating senescence processes²⁸. Melatonin has been widely recognized for its potent antioxidant properties, acting both as a direct free radical scavenger and as a regulator of key antioxidant enzymes, including superoxide dismutase (SOD), catalase (CAT), peroxidase (POD), and ascorbate peroxidase (APX), thus contributing to cellular redox homeostasis²⁹. In addition, melatonin enhances the accumulation of non-enzymatic antioxidants such as ascorbate, glutathione, and flavonoids, further strengthening the antioxidant defense system and protecting cellular components against oxidative damage³⁰. The beneficial effects of melatonin application have been documented in various plant species. For example, Zulfiqar et al.³¹ examined foliar application of melatonin at 0, 0.1, and 0.2 mM on Gerbera jamesonii under 150 mM NaCl-induced salt stress. Their findings showed that 0.2 mM melatonin significantly enhanced the activity of antioxidant enzymes such as CAT, SOD, and POD. In another experiment, Wang et al.³² evaluated the preharvest application of melatonin (0, 1, 5, 20, and 50 µM) on Chrysanthemum morifolium and reported that melatonin improved leaf antioxidant capacity by modulating ROS-scavenging enzymes. Similarly, Wu et al.³³ investigated postharvest melatonin treatments (0, 0.2, 0.3, 0.4, and 0.5 mg L⁻¹) on Paeonia suffruticosa cv. Diguan and found that melatonin significantly increased the activities of antioxidant enzymes, contributing to delayed senescence and improved postharvest quality.

While Alstroemeria hybrida is a major ornamental crop, its commercial value is limited by premature leaf yellowing and short vase life, which are largely associated with oxidative stress and ethylene-induced senescence. The accumulation of reactive oxygen species (ROS) during senescence accelerates cellular damage, necessitating the activation of antioxidant defense systems to mitigate these effects. Both putrescine and melatonin are known to modulate antioxidant defense systems—through direct ROS scavenging, enhancement of enzymatic activities (e.g., SOD, CAT, APX, GPX), and transcriptional upregulation of stress-responsive genes such as SAMDC and SPMS, which are pivotal in polyamine biosynthesis. Previous studies have demonstrated the role of either polyamines or melatonin in delaying senescence and improving stress tolerance in various ornamental species. However, unlike previous studies that have primarily focused on the individual effects of putrescine or melatonin, to our knowledge, this study represents the first report on the combined preharvest foliar application of putrescine and melatonin in Alstroemeria hybrida, and their synergistic effects on postharvest physiological performance, antioxidant enzyme activities, and gene expression. By integrating biochemical and molecular analyses, the present research provides novel insights into the regulatory mechanisms underlying extended vase life and enhanced stress resilience in this economically important cut flower. These findings have important implications for the development of improved commercial postharvest management strategies aimed at extending vase life and maintaining flower quality in Alstroemeria.

Materials and methods

Plant material and cultivation conditions

The ornamental cultivar Alstroemeria hybrida ‘Amatista’ used in this research was propagated by rhizome segmentation and cultivated under local conditions in Varamin, Iran. Originally bred by Royal Van Zanten (Netherlands), this cultivar is distinguished by its intense purple floral coloration, robust dark green foliage, and tall flowering stems ranging from 70 to 90 cm in height. Its postharvest performance is considered satisfactory, with an average vase life of approximately two weeks. Floral organs typically exhibit a length of 7.5 cm and a diameter of 15 to 20 cm⁵. Figure 1 depicts the representative morphology of the ‘Amatista’ cultivar.

Fig. 1.

Representative view of Alstroemeria cv. Amatista used in this study.

Experimental design and growth conditions

The present study was conducted as a factorial experiment based on a completely randomized design with three replications under soilless cultivation conditions in both greenhouse and laboratory settings. Alstroemeria plants were grown in 7-liter pots (19 cm height × 24 cm diameter) filled with a soilless substrate composed of perlite and cocopeat in a 30:70 ratio. Throughout the growth stages, greenhouse temperatures ranged from 21 to 25 °C during the day and 13 to 17 °C at night. Light intensity varied between 10,000 and 15,000 lx on cloudy days and 30,000 to 50,000 lx on sunny days, while relative humidity was maintained at 60% during the day and 70% at night.

Treatment application

Treatments consisted of foliar applications of melatonin at three concentrations (0, 50, and 100 µM) and putrescine at three concentrations (0, 1.5, and 3 mM). Each compound was applied individually to the plants, and the effects of combined treatments were evaluated through a factorial design by statistically analyzing the interactions between the two compounds. Postharvest evaluations were conducted at four time points (0, 5, 10, and 15 days). The selected concentrations were based on preliminary studies reported in the literature^20,34. Melatonin solutions (50 and 100 µM) were prepared by dissolving the compound in 0.5 mL ethanol, adding 0.5 mL Tween-80 as a surfactant, and adjusting the final volume with distilled water. Putrescine solutions (1.5 and 3 mM) were prepared by dissolving the compound in distilled water containing 0.5 mL Tween-80. Control plants were sprayed with distilled water containing ethanol and Tween-80 at the same concentrations used in the treatment solutions.

Treatments began approximately two months after rhizome planting and establishment, during the active vegetative growth phase characterized by new shoot and branch development. Foliar sprays were applied early in the morning between 7:00 and 9:00 AM to optimize absorption and minimize evaporation. Due to variable canopy sizes during this growth stage, the spray volume per plant was approximately 90 mL, sufficient to uniformly wet all aerial parts, especially the leaves, until runoff. Leaves were dry prior to spraying, and care was taken to avoid excessive dripping. After spraying, plants were not washed but allowed to dry naturally under greenhouse conditions. Treatments were applied every two weeks over two months, totaling four applications per treatment. Figure 2 depicts the Alstroemeria plants grown in the greenhouse.

Fig. 2.

Alstroemeria plants cultivated in pots under greenhouse conditions.

Nutrient solution management

During the first week after rhizome planting, plants were irrigated solely with water to facilitate establishment. This was followed by a two-week treatment with rooting enhancers, including a complete fertilizer with an N-P-K ratio of 10–52−10 applied at a rate of 100 g per 100 L of water, and a Bacillus-based biofertilizer applied at 100 mL per 100 L of water. Subsequently, a customized nutrient solution tailored specifically for Alstroemeria was prepared based on the physicochemical analysis of greenhouse irrigation water and expert consultation in a commercial greenhouse setting. The pH and electrical conductivity (EC) of the nutrient solution were carefully maintained within the ranges of 5.8–6.2 and 1.2–1.5 dS m⁻¹, respectively. Plants were irrigated with 250 mL of the nutrient solution every other day during the vegetative stage, increasing to 500 mL per irrigation event during the flowering stage to meet the higher water demand. The management practices were aligned with established protocols for soilless cultivation of ornamental plants (35; 36; 5).

Measurement of postharvest parameters

Cut Alstroemeria flowers were harvested early in the morning between 7:30 and 9 AM when 1 to 2 florets were partially opened³⁶. This stage was chosen to standardize developmental phases across samples and reduce variability in postharvest behavior. The selected stems were immediately transferred to the adjacent laboratory (less than 5 min transport time) to minimize stress and exposure to external conditions. Lower leaves were removed from the stems, and the stems were recut under running water to a uniform length of 50 cm (initial stem length ranged between 60 and 80 cm). The uniform stem length ensured consistent uptake of the vase solution during postharvest evaluations. Subsequently, the stems were placed in containers containing 250 mL of distilled water supplemented with 4% sucrose solution for postharvest assessments. The addition of sucrose serves as a carbon source to sustain respiration and prolong flower longevity. The flowers were maintained under controlled environmental conditions at 22 °C temperature, 70% relative humidity, and a 12-hour photoperiod with a light intensity of 13 µmol m⁻² s⁻¹. Air circulation was maintained ensure uniform environmental conditions^7,36. Sampling during the postharvest period was performed every five days until the control flowers reached the end of their vase life.

Extraction of petal extracts for measurement of antioxidant capacity, total phenolic content, and flavonoids

For the extraction process aimed at measuring antioxidant capacity, total phenolic compounds, and flavonoid content, 0.5 g of finely ground petal tissue was mixed with 5 mL of 85% methanol. The mixture underwent ultrasonic-assisted extraction at 20 °C for 30 min to enhance compound release. Following extraction, samples were centrifuged at 5000 rpm for 15 min, and the clear supernatant was carefully separated and stored in airtight tubes at − 20 °C until further biochemical assays were performed³⁷.

Measurement of phenol content

To quantify total phenolic content, 1 mL of the prepared extract was combined with 9 mL of distilled water and 1 mL of Folin–Ciocalteu reagent. After mixing thoroughly, the solution was incubated for 5 min, followed by the addition of 10 mL sodium carbonate. The mixture was then left to react at room temperature for 90 min. Subsequently, absorbance was read at 750 nm using a spectrophotometer³⁸.

Total flavonoid content of petals

Total flavonoid content was assessed through the aluminum chloride colorimetric method. In brief, 500 µL of each extract was combined with 1.5 mL of 80% methanol, 100 µL of 10% aluminum chloride, 100 µL of 1 M potassium acetate, and 3.8 mL of distilled water. The mixture was incubated at room temperature for 40 min. Absorbance was then recorded at 380 nm against a blank using a spectrophotometer. Results were expressed as milligrams of quercetin equivalents per gram of fresh weight³⁹.

Antioxidant capacity determination by DPPH radical scavenging assay

To assess the radical scavenging capacity of the extracts, 100 µL aliquots of each extract were combined with 1900 µL of DPPH reagent. The reaction mixtures were incubated in darkness at ambient temperature for 30 min. Subsequently, absorbance readings were taken at 517 nm using a spectrophotometer. The scavenging activity percentage was computed according to the formula below⁴⁰:

Antioxidant capacity)%) = Ac-As/Ac×100.

Where Ac​ is the absorbance of the control (DPPH solution without extract) and As​ is the absorbance of the sample.

Catalase (CAT) enzyme activity

Catalase activity was measured based on the method of Aebi⁴¹. The reaction mixture contained 2.5 mL of 50 mM phosphate buffer, 0.2 mL of 1% hydrogen peroxide, and 0.3 mL of enzyme extract. The decrease in absorbance at 240 nm was recorded for one minute using a spectrophotometer. The enzyme activity was calculated using an extinction coefficient of 43.6 mM⁻¹ cm⁻¹. The change in optical density per minute (ΔOD/min) was used in the calculation. Catalase activity was expressed as micromoles of H₂O₂ decomposed per milligram of protein per minute, according to following Equation:

Ascorbate peroxidase (APX) activity measurement

The activity of ascorbate peroxidase was determined following the method described by Nakano and Asada⁴². The reaction mixture consisted of 2.5 mL of 50 mM phosphate buffer (pH 7), 0.2 mL of 1% hydrogen peroxide, and 0.1 mL of enzyme extract. Enzyme activity was assessed by monitoring the decrease in absorbance at 290 nm over one minute using a spectrophotometer. Calculations were performed using an extinction coefficient of 2.8 mM⁻¹ cm⁻¹. The activity of APX was expressed as micromoles of ascorbic acid oxidized per milligram of protein per minute, based on the change in optical density per minute (ΔOD/min) as shown in following Equation:

Guaiacol peroxidase (GPX) activity measurement

The activity of guaiacol peroxidase was determined according to the protocol by Upadhyaya et al.⁴³. The reaction mixture comprised 1 mL of 50 mM phosphate buffer (pH 7) and 1 mL of 1% guaiacol solution. Enzyme activity was monitored as the increase in absorbance at 420 nm over one minute using a spectrophotometer. Calculations were performed using an extinction coefficient of 26.6 mM⁻¹ cm⁻¹. The enzyme activity was expressed as micromoles of guaiacol oxidized per milligram of protein per minute, based on the change in optical density per minute (ΔOD/min).

Measurement of superoxide dismutase (SOD) activity

The activity of superoxide dismutase was assessed based on its ability to inhibit the photochemical reduction of nitroblue tetrazolium chloride (NBT), following the method of Giannopolitis and Ries⁴⁴. The reaction mixture contained 50 mM potassium phosphate buffer (pH 7), 13 mM methionine, 75 µM NBT, 0.1 mM EDTA, 2 µM riboflavin, and 50 µL of enzyme extract. The reaction tubes were exposed to fluorescent light for 10 min at a distance of 30 cm, after which the light was turned off to stop the reaction. One unit of SOD activity was defined as the amount of enzyme causing 50% inhibition of NBT reduction at 560 nm. The SOD activity was expressed as enzyme units per milligram of protein and calculated using the following formula.

Analysis of relative gene expression levels

In this study, the relative expression levels of the genes SAMDC and SPMS were examined using petal samples collected at the postharvest stage with three biological replicates. Gene expression was evaluated at four postharvest time points: 0, 5, 10, and 15 days. The following steps were carried out to assess the relative expression of these genes.

Primer design

Due to the lack of publicly available genomic sequences for Alstroemeria hybrida, gene-specific primers for the SAMDC and SPMS genes were designed based on the coding sequences of homologous genes from members of the Liliaceae family retrieved from the NCBI database. Multiple sequence alignments were conducted to identify conserved regions suitable for primer design. Primer design was carried out using Primer3Plus (https://primer3plus.com/) to generate candidate primer pairs. The specificity and thermodynamic properties of the primers, including melting temperature (Tm), hairpin formation, and dimerization potential, were evaluated using OligoAnalyzer Tool (Integrated DNA Technologies, https://www.idtdna.com/calc/analyzer). The finalized primer sequences were synthesized by TAG Copenhagen (Table 1).

Table 1.

Primer sequences and optimal annealing temperatures used for Real-Time PCR analysis of target genes. F: Forward primer, R: Reverse primer; GAPDH served as the reference gene.

Gene	Primer Sequence (5’→3’)	Annealing Temperature (°C)
SAMDC	F: TATTCAATGAACGGGATCCAT R: TTGAACCCCATAGTCTCGTAG	57
SPMS	F: AAAGATGAATGCGCCTACCAA R: CCATCCGTTGAGCATAGCAA	57
GAPDH (ref)	F: AGGAAYCCTGAGGAGAT R: ACCTTCTTRGCACCACC	55

RNA extraction procedure

Total RNA was isolated from 80 mg of petal tissue, which had been ground in liquid nitrogen, using the Gene X RNA Extraction Kit according to the manufacturer’s protocol. Initially, the powdered tissue was transferred into a 2 mL microcentrifuge tube containing 800 µL of TRIzol reagent and vortexed thoroughly. The samples were incubated at room temperature for 10 min. Subsequently, 300 µL of chloroform was added to each tube, mixed vigorously by vortexing, and incubated at room temperature for 5 min. Samples were centrifuged at 12,000 rpm for 5 min at 4 °C to facilitate phase separation. The upper aqueous phase (~ 1.5 mL) was carefully transferred to a new microcentrifuge tube, followed by the addition of 300 µL of precipitation reagent (Precipitation Solution). The mixture was vortexed briefly for 15 s and then centrifuged at 12,000 rpm for 5 min at room temperature. The flow-through was discarded. The column was washed by adding 700 µL of Wash Buffer I, followed by centrifugation at 12,000 rpm for 90 s at room temperature; the flow-through was discarded again. The column was further centrifuged at 12,000 rpm for 3 min at room temperature and then transferred to a new collection tube. Subsequently, 100 µL of sterile DEPC-treated water was added to the column, which was incubated at 65 °C for 3 min to elute the RNA. The column was centrifuged at 10,000 rpm for 2 min at room temperature to collect the eluted RNA. RNA concentration and purity were assessed using a Nanodrop spectrophotometer. Finally, the extracted RNA samples were stored at − 80 °C until further use.

Quantification and Quality Assessment of Extracted RNA

The concentration and purity of the isolated RNA samples were evaluated using a Nanodrop spectrophotometer. RNA quality was assessed by measuring absorbance ratios at 260/280 nm and 260/230 nm, while concentration was recorded in ng µL^− 1.

cDNA synthesis

Complementary DNA (cDNA) was synthesized using the SMOBIO cDNA Synthesis Kit following the manufacturer’s guidelines. Initially, 5 µL of RNA was mixed with 1 µL of Oligo dT/Random Primer Mix, and DEPC-treated water was added to reach a final volume of 10 µL. This mixture was incubated at 70 °C for 5 min, then chilled on ice for at least 10 min (Mixture A). In a separate tube, 4 µL of 5X RT buffer (containing DTT and dNTPs), 4 µL DEPC water, 1 µL Reverse Transcriptase enzyme, and 1 µL RNase inhibitor were combined to make Mixture B. Mixtures A and B were then combined and incubated sequentially: 10 min at 25 °C, 50 min at 42 °C, followed by enzyme inactivation at 85 °C for 5 min.

Real-time PCR analysis

Gene expression levels were quantified using the Sinaclone qPCR kit. Each 15 µL reaction contained 1 µL cDNA template, 5.5 µL PCR-grade water, 7.5 µL 2x Master Mix, and 0.5 µL of each forward and reverse primer. Tubes were gently mixed to avoid bubbles. Annealing temperatures were optimized based on melting curve analysis and gel electrophoresis to confirm specificity and correct amplicon size. Thermal cycling included initial denaturation at 95 °C for 15 min, followed by 40 cycles of denaturation (95 °C, 30 s), annealing (variable, 30 s), and extension (72 °C, 20 s). The relative expression of target genes was normalized against GAPDH using the ΔCT method: ∆C_T = C_{T (Target) –} C_{T (Reference)}. Relative gene expression levels were expressed as 2^–ΔΔCt.

A graphical representation of the experimental workflow is presented in Fig. 3 to provide a visual overview of the entire process, from treatment application through postharvest evaluations.

Fig. 3.

Schematic illustration of the experimental workflow. The diagram outlines key stages of the study, including treatment preparation and application (foliar sprays of melatonin and putrescine), plant growth under controlled greenhouse conditions, harvesting of cut Alstroemeria flowers at the appropriate maturity stage, transfer to the laboratory, and subsequent postharvest biochemical and molecular evaluations.

Statistical analysis

The collected data were processed with SAS software version 9.2. The experimental setup was a factorial design within a completely randomized framework, incorporating three factors: melatonin levels, putrescine concentrations, and timing of measurements. Variance analysis (ANOVA) was applied to evaluate the individual and interactive effects of the treatments. For mean separation, Tukey’s HSD test was used at a confidence level of 95%. In the case of molecular assays, mean differences were analyzed by the Student–Newman–Keuls (SNK) method. Furthermore, multivariate statistical tools such as heatmap plotting, Pearson correlation coefficients, and principal component analysis (PCA) were performed utilizing R software (version 5.5; R Foundation for Statistical Computing, Vienna, Austria) to reveal associations and grouping patterns among the variables measured.

Results and discussion

Total phenolic content

The analysis of mean values indicated that total phenolic content in petals increased until the tenth day after harvest, followed by a decrease on the fifteenth day, although this decline was not statistically significant. Foliar application of putrescine and melatonin significantly enhanced total phenolic content at p < 0.05, with a significant interaction between the two compounds (p < 0.05). Among the treatments, the combination of 3 mM putrescine and 50 µM melatonin consistently exhibited the highest phenolic levels across all sampling times, whereas the control (no putrescine or melatonin) and 100 µM melatonin alone showed lower phenolic content (Figure 4).

Fig. 4.

Effects of different concentrations of melatonin (0, 50, and 100 µM) and putrescine (0, 1.5, and 3 mM) on total phenolic content in the petals of cut Alstroemeria flowers ‘Amatista’ during the vase life period. Measurements were performed on the first, 5th, 10th, and 15th days of vase life. Bars represent mean values ± SE. Different letters indicate significant differences among treatments at the 5% probability level according to Tukey’s multiple range test.

Total flavonoid content

According to the statistical analysis of mean comparisons, both the passage of time and the application of putrescine and melatonin significantly enhanced the accumulation of flavonoids in the petals of cut Alstroemeria flowers. As illustrated in Fig. 5, the highest flavonoid concentrations were consistently observed across all four sampling intervals in treatments with 1.5- and 3-mM putrescine, as well as 50 µM melatonin. In contrast, the control group (with no exogenous application of putrescine or melatonin) and the treatment with 100 µM melatonin exhibited notably lower flavonoid levels. By day 15 of the vase life period, a slight decline in flavonoid content was observed across all treatments; however, this reduction was not statistically significant (p > 0.05), likely reflecting the natural progression of senescence, during which the plant’s antioxidant defense mechanisms typically deteriorate.

Our results demonstrated a significant increase in total phenolic and flavonoid contents in Alstroemeria petals up to day 10 of vase life, followed by a slight decline by day 15, consistent with natural senescence. This pattern reflects an intrinsic antioxidant response to oxidative stress during postharvest aging. Treatments with putrescine and melatonin, particularly their combination at 3 mM putrescine and 50 µM melatonin, significantly enhanced phenolic and flavonoid accumulation⁴⁵.

Phenolic compounds serve as potent non-enzymatic antioxidants that scavenge reactive oxygen species (ROS), protecting cellular structures and delaying senescence^46,47. Additionally, phenolics inhibit cell wall–degrading enzymes, preserving petal firmness and extending vase life⁴⁸.

In our study, putrescine significantly increased measured phenolic and flavonoid contents in petals. Previous studies have reported that putrescine can upregulate phenylalanine ammonia-lyase (PAL), the rate-limiting enzyme in phenylpropanoid biosynthesis, and inhibit polyphenol oxidase (PPO), which may contribute to enhanced phenolic and flavonoid accumulation^18,49–52. Similarly, melatonin significantly increased measured phenolic and flavonoid contents. Literature suggests that melatonin can activate the phenylpropanoid pathway through PAL upregulation, inhibit PPO, and modulate gene expression to favor phenolic biosynthesis^54–58. These mechanisms, supported by previous studies^59,60, provide a plausible explanation for the enhanced phenolic and flavonoid contents observed in our petals.

In summary, exogenous application of putrescine and melatonin effectively enhanced phenolic and flavonoid contents in cut Alstroemeria flowers, especially in combination. These improvements, supported by our measured data, contribute to delayed senescence and maintenance of flower quality. Mechanistic insights from previous studies provide a plausible explanation for these effects while maintaining the independence of subsequent discussions on measured antioxidant enzyme activities and other parameters.

Antioxidant capacity assessed by DPPH radical scavenging activity

According to the results of mean comparison analysis, antioxidant capacity of Alstroemeria petals—measured via DPPH radical scavenging assay—increased progressively over time across all treatments. Although a slight reduction was observed on day 15, this decline was not statistically significant. Furthermore, the application of putrescine and melatonin, particularly at concentrations of 1.5- and 3-mM putrescine and 50 µM melatonin, resulted in a marked enhancement of antioxidant capacity compared to the control. Among all treatments, the control group exhibited the lowest DPPH scavenging activity, indicating minimal non-enzymatic antioxidant potential in the absence of exogenous compounds (Fig. 6).

Fig. 5.

Effects of different concentrations of melatonin (0, 50, and 100 µM) and putrescine (0, 1.5, and 3 mM) on total flavonoid content in the petals of cut Alstroemeria flowers ‘Amatista’ during the vase life period. Measurements were performed on the first, 5th, 10th, and 15th days of vase life. Bars represent mean values ± SE. Different letters indicate significant differences among treatments at the 5% probability level according to Tukey’s multiple range test.

Catalase (CAT) enzyme activity

The comparative analysis of treatment means revealed that the application of putrescine and melatonin—either individually or in combination—led to a progressive increase in catalase (CAT) activity up to day 15 of the vase life period. In contrast, in control flowers (without exogenous treatment), catalase activity showed an initial increase until day 10, followed by a noticeable decline by day 15. This decline indicates that while untreated petals were able to mount a partial antioxidant response during the early stages of senescence, they failed to sustain enzymatic defense against oxidative damage during the later stages of senescence. However, exogenous application of putrescine and melatonin appeared to enhance cellular resilience against oxidative stress, as evidenced by continued elevation in catalase activity even on day 15. Notably, although all putrescine and melatonin treatments positively influenced CAT activity, the most pronounced enzymatic activation was observed in response to 1.5 mM putrescine and 50 µM melatonin, suggesting a synergistic or concentration-specific effect (Fig. 7).

Fig. 6.

Effects of different concentrations of melatonin (0, 50, and 100 µM) and putrescine (0, 1.5, and 3 mM) on antioxidant capacity in the petals of cut Alstroemeria flowers ‘Amatista’ during the vase life period. Measurements were performed on the first, 5th, 10th, and 15th days of vase life. Bars represent mean values ± SE. Different letters indicate significant differences among treatments at the 5% probability level according to Tukey’s multiple range test.

Ascorbate peroxidase (APX) activity

Based on the results of mean comparisons, ascorbate peroxidase (APX) activity increased across all treatments up to day 10 of the vase life period. However, by day 15, a general decline in APX activity was observed, although in most treatments this reduction was not statistically significant. In addition, the application of putrescine and melatonin effectively enhanced APX activity throughout the evaluation period. Among the tested concentrations, 1.5 mM putrescine and 50 µM melatonin proved to be the most effective in promoting APX activity. On day 10, this treatment resulted in an enzymatic activity level of 1.97 µmol ascorbic acid per mg protein per minute, representing a 1.41-fold increase compared to the control group at the same time point (Fig. 8). These results suggest that optimal doses of putrescine and melatonin can significantly strengthen the antioxidant defense system during the critical phases of senescence in cut Alstroemeria flowers.

Fig. 7.

Effects of different concentrations of melatonin (0, 50, and 100 µM) and putrescine (0, 1.5, and 3 mM) on catalase enzyme activity in the petals of cut Alstroemeria flowers ‘Amatista’ during the vase life period. Measurements were performed on the first, 5th, 10th, and 15th days of vase life. Bars represent mean values ± SE. Different letters indicate significant differences among treatments at the 5% probability level according to Tukey’s multiple range test.

Guaiacol peroxidase (GPX) activity

The results of the present study demonstrated that guaiacol peroxidase (GPX) activity exhibited a progressive increase up to day 10 across all treatments, followed by a decline by day 15. Notably, the treatment combining 1.5 mM putrescine and 50 µM melatonin showed a significantly greater enhancement in GPX activity compared to other treatments. Specifically, on day 10, this treatment induced a 1.23-fold increase in GPX activity relative to the control at the same time point. The lowest GPX activity was observed in the control group at the first day (Fig. 9).

Fig. 8.

Effects of different concentrations of melatonin (0, 50, and 100 µM) and putrescine (0, 1.5, and 3 mM) on ascorbate peroxidase enzyme activity in the petals of cut Alstroemeria flowers ‘Amatista’ during the vase life period. Measurements were performed on the first, 5th, 10th, and 15th days of vase life. Bars represent mean values ± SE. Different letters indicate significant differences among treatments at the 5% probability level according to Tukey’s multiple range test.

Superoxide dismutase (SOD) activity

The analysis of mean values revealed that, similar to catalase, ascorbate peroxidase, and guaiacol peroxidase enzymes, superoxide dismutase (SOD) activity increased progressively up to day 10 across all treatments. However, measurements on day 15 indicated a declining trend in SOD activity, although this decrease was not statistically significant in any treatment compared to day 10. Moreover, the application of putrescine and melatonin significantly enhanced SOD activity throughout the experiment. Among the treatments, the combination of 1.5 mM putrescine with 50 µM melatonin and 3 mM putrescine with 50 and 100 µM melatonin elicited the most pronounced increases in enzymatic activity compared to other groups (Fig. 10).

Fig. 9.

Effects of different concentrations of melatonin (0, 50, and 100 µM) and putrescine (0, 1.5, and 3 mM) on guaiacol peroxidase enzyme activity in the petals of cut Alstroemeria flowers ‘Amatista’ during the vase life period. Measurements were performed on the first, 5th, 10th, and 15th days of vase life. Bars represent mean values ± SE. Different letters indicate significant differences among treatments at the 5% probability level according to Tukey’s multiple range test.

The antioxidant capacity of Alstroemeria petals, measured by DPPH radical scavenging activity, increased steadily during vase life, peaking around day 10, followed by a slight, non-significant decline by day 15. Treatments with putrescine (1.5 and 3 mM) and melatonin (50 µM) notably enhanced antioxidant capacity compared to the control, which exhibited the lowest activity (Fig. 5). This enhancement indicates improved non-enzymatic antioxidant defense under these treatments.

Regarding enzymatic antioxidants, CAT activity progressively increased in treated flowers up to day 15, whereas control petals showed a decline after day 10, reflecting their limited ability to sustain antioxidant defenses late in senescence. The most pronounced CAT activity was observed with 1.5 mM putrescine + 50 µM melatonin (Fig. 6), suggesting a synergistic effect. Similar temporal patterns and treatment effects were noted for APX, GPX, and SOD, all peaking by day 10 and declining slightly afterward (Figs. 7, 8 and 9).

The progressive increase in antioxidant enzyme activities up to day 10 aligns with the plant’s intrinsic response to oxidative stress triggered by detachment and senescence, characterized by ROS accumulation. Enzymes such as CAT, APX, GPX, and SOD play critical roles in scavenging ROS, thereby protecting cellular components and contributing to extended vase life⁶¹.

Putrescine’s role in enhancing antioxidant enzyme activity likely involves stabilization of enzyme structures and cellular membranes through electrostatic interactions, protecting proteins from oxidative damage and preserving their function (62; 63). It also modulates expression of antioxidant enzyme genes, enhancing activities of SOD, CAT, and peroxidases, which delays senescence and maintains membrane integrity (64; 65). These molecular mechanisms underlie the improved antioxidant status and postharvest quality observed in putrescine-treated flowers, consistent with findings in other ornamentals^18,20,66.

Melatonin acts both as a direct ROS scavenger and an indirect modulator of antioxidant defenses. It upregulates antioxidant enzymes by activating signaling pathways (e.g., Nrf2/ARE, FOXO3a), enhances expression of mitochondrial SOD2, and increases catalase levels, effectively reducing oxidative damage^32,67,68. Additionally, melatonin binds to MT1 and MT2 receptors, triggering gene expression changes that support antioxidant defenses and suppress stress pathways⁵⁵. Its application has consistently improved antioxidant enzyme activities and postharvest longevity in various species, including Camellia sinensis, Paeonia lactiflora, and tuberose^34,69,70.

In summary, our findings demonstrate that exogenous application of putrescine and melatonin enhances both enzymatic and non-enzymatic antioxidant defenses in cut Alstroemeria flowers, particularly when combined. This coordinated antioxidant response mitigates ROS-induced damage, delays senescence, and improves postharvest quality and vase life.

Relative expression of the SAMDC gene

The expression of the SAMDC gene in Alstroemeria petals was significantly influenced by the application of melatonin (Me) and putrescine (Put) over time (Fig. 11). In control flowers (Put 0 mM, Me 0 µM), SAMDC expression remained consistently low across all three time points, with values ranging from 0.35 on day 15 to 0.83 on day 5. However, treatments with exogenous Me and Put led to a substantial upregulation of SAMDC expression, particularly on day 5. The highest expression level was recorded in flowers treated with 3 mM Put + 100 µM Me on day 5 (55.08), followed by 1.5 mM Put + 100 µM Me (52.68), and 1.5 mM Put + 50 µM Me (31.05). Notably, these treatments sustained elevated expression through days 10 and 15, although a gradual decline was observed over time. Interestingly, while most treatments showed the highest expression on day 5, the combination of 3 mM Put + 50 µM Me exhibited a markedly lower peak (12.13), suggesting that excessive Put or suboptimal Me concentration may negatively regulate SAMDC transcription. By day 15, SAMDC levels were still higher than control in all treated samples, especially in the combined Me + Put groups. The melting curve of the SAMDC gene obtained from Real-Time PCR analysis is presented in Fig. 12.

Fig. 10.

Effects of different concentrations of melatonin (0, 50, and 100 µM) and putrescine (0, 1.5, and 3 mM) on superoxide dismutase enzyme activity in the petals of cut Alstroemeria flowers ‘Amatista’ during the vase life period. Measurements were performed on the first, 5th, 10th, and 15th days of vase life. Bars represent mean values ± SE. Different letters indicate significant differences among treatments at the 5% probability level according to Tukey’s multiple range test.

Fig. 11.

Effects of different concentrations of melatonin (0, 50, and 100 µM) and putrescine (0, 1.5, and 3 mM) on SAMDC gene expression in the petals of cut Alstroemeria flowers ‘Amatista’ during the vase life period. Measurements were performed on the 5th, 10th, and 15th days of vase life. Bars represent mean values ± SE. Different letters indicate significant differences among treatments (P ≤ 0.01) according to SNK test.

The results of this study revealed that exogenous application of melatonin and putrescine—particularly in combination—significantly enhanced the expression of the SAMDC gene in Alstroemeria petals, with the greatest induction observed at day 5 of vase life. Notably, treatment with 3 mM putrescine + 100 µM melatonin produced the highest expression levels, which remained elevated through later stages (days 10 and 15). SAMDC encodes S-adenosylmethionine decarboxylase, a key enzyme in polyamine biosynthesis that plays a central role in regulating plant stress responses and senescence. Although SAMDC expression generally declines during flower senescence⁷¹, our findings indicate that melatonin and putrescine treatments counteract this trend by upregulating SAMDC transcription, particularly under combined application. This suggests that enhanced polyamine metabolism is a key mechanism contributing to delayed senescence and improved oxidative stress defense.

The observed upregulation implies that combined treatment may modulate polyamine metabolism more effectively than either compound alone, likely leading to increased levels of spermidine and spermine, which are known to stabilize cellular membranes and scavenge reactive oxygen species (ROS). Consequently, SAMDC induction may contribute to delayed senescence by supporting antioxidant capacity and maintaining redox homeostasis^72–74.

Melatonin functions as a signaling molecule that can regulate gene expression by activating transcription factors such as WRKY, MYB, and ERF, which may enhance transcription of genes like SAMDC in response to oxidative stress^75,76. Furthermore, melatonin suppresses ethylene biosynthesis by downregulating ACS and ACO genes, thereby redirecting the S-adenosylmethionine (SAM) pool toward polyamine production rather than ethylene synthesis⁷⁷. This metabolic shift increases SAM availability for decarboxylation by SAMDC, supporting higher polyamine synthesis and enhanced antioxidative protection.

Similarly, putrescine appears to exert positive feedback on polyamine biosynthesis, potentially through metabolic sensing mechanisms that elevate SAMDC expression⁷⁸. Its ability to reduce ROS and modulate ethylene biosynthesis contributes to a cellular environment favorable for maintaining SAMDC transcription^79,80. Collectively, these findings indicate a synergistic interaction between melatonin and putrescine, delaying senescence through molecular modulation of SAMDC and associated antioxidant defenses⁸¹.

Overall, the observed expression trends support the hypothesis that co-application of melatonin and putrescine sustains metabolic activity during senescence by reinforcing polyamine biosynthesis at the transcriptional level, thereby contributing to prolonged vase life in cut Alstroemeria flowers.

Relative expression of SPMS gene

The expression of the SPMS gene, encoding spermine synthase, was significantly affected by the application of melatonin (Me) and putrescine (Put), both alone and in combination, during the vase life of Alstroemeria petals (Fig. 13). In the untreated control (Put 0 mM, Me 0 µM), SPMS expression was minimal across all three time points, decreasing from 0.57 on day 5 to 0.17 on day 15. Application of 1.5 mM Put alone led to a marked upregulation, with expression levels reaching 11.88 on day 5 and remaining relatively high through day 15 (4.68). The most substantial SPMS expression was observed in the treatment with 1.5 mM Put + 100 µM Me, which peaked at 16.56 on day 5 and remained elevated on days 10 (10.69) and 15 (6.66). Similarly, 3 mM Put + 100 µM Me induced strong SPMS expression (13.14, 10.42, and 9.67 on days 5, 10, and 15, respectively), suggesting that combined treatments effectively sustained gene activity. Interestingly, while 50 µM Me alone induced moderate expression (3.94 on day 5), 100 µM Me alone suppressed SPMS expression (0.45 on day 5), indicating a potential threshold effect of melatonin concentration on gene regulation. Treatments involving both Put and Me generally exhibited higher and more persistent expression than individual applications. The melting curve of the SPMS gene from this study is presented in Fig. 14.

Fig. 12.

Melting curve of the SAMDC gene.

Fig. 13.

Effects of different concentrations of melatonin (0, 50, and 100 µM) and putrescine (0, 1.5, and 3 mM) on SPMS gene expression in the petals of cut Alstroemeria flowers ‘Amatista’ during the vase life period. Measurements were performed on the 5th, 10th, and 15th days of vase life. Bars represent mean values ± SE. Different letters indicate significant differences among treatments (P ≤ 0.01) according to SNK test.

During postharvest senescence, the expression of the SPMS gene typically declines, reflecting a reduced demand for polyamines involved in cellular growth and stress mitigation⁸². Senescence-induced oxidative stress and decreased availability of substrates, such as putrescine and S-adenosylmethionine (SAM), downregulate SPMS expression, accelerating cellular deterioration^83,84. Additionally, senescence suppresses growth-promoting transcription factors, including MYC and bHLH, which are key regulators of polyamine biosynthesis genes. In the absence of these transcription factors, SPMS expression is further diminished⁸⁵.

Exogenous putrescine enhances substrate availability and acts as a signaling molecule to upregulate SPMS via activation of transcription factors such as MYB, NAC, and WRKY, thereby increasing promoter activity and gene expression^72,86. This establishes a positive feedback loop that sustains polyamine homeostasis and reinforces antioxidant defenses by reducing reactive oxygen species (ROS) and stabilizing RNA for transcription⁸⁷.

Melatonin further amplifies SPMS expression by activating transcription factors (MYC2, WRKY, NAC) and mitigating oxidative stress, thus maintaining a cellular environment conducive to transcription^75,88. Melatonin’s suppression of ethylene and abscisic acid signaling diminishes senescence cues, favoring growth- and defense-related pathways, including polyamine biosynthesis⁸⁹. Furthermore, melatonin increases upstream precursors such as SAM and putrescine, reinforcing the biosynthetic pathway and synergistically enhancing SPMS expression^90,91.

Interestingly, high-dose melatonin (100 µM alone) induced a partial suppression of SPMS expression, consistent with the hormesis model, in which moderate melatonin levels optimize polyamine gene expression, whereas excessive concentrations may inhibit this process unless counterbalanced by putrescine. This observation underscores the importance of combined treatments for achieving maximal gene induction and extended postharvest longevity.

In summary, the present results highlight the critical regulatory role of SPMS in modulating polyamine biosynthesis and antioxidant defenses during cut flower senescence. The synergistic enhancement of SPMS by putrescine and melatonin contributes to prolonged vase life and improved resilience to oxidative stress, confirming SPMS as a key molecular indicator of flower physiological quality.

Heatmap clustering analysis

The heatmap clustering analysis (Fig. 15) illustrates the distinct biochemical and molecular responses of Alstroemeria hybrida cv. Amatista to various preharvest foliar treatments with putrescine (Put) and melatonin (Me). The color gradient, from blue (low) to red (high), reflects treatment-induced variations across the evaluated parameters. The observed clustering patterns indicate that putrescine and melatonin exert both independent and synergistic effects on the biochemical and molecular responses of Alstroemeria hybrida. The pronounced increase in superoxide dismutase (SOD) activity across nearly all treatments, particularly at higher putrescine concentrations, underscores the critical role of polyamines in enhancing enzymatic antioxidant defenses. SPMS and SAMDC gene expression peaked in the treatment combining 1.5- and 3-mM putrescine with 100 µM melatonin, highlighting these gene’s specific sensitivity to the combined concentration of putrescine and melatonin. CAT, APX, and GPX activities exhibited moderate increases, especially under combined treatments (1.5 mM Put + 50 µM melatonin), indicating an additive effect of melatonin and putrescine on reactive oxygen species (ROS) scavenging systems, though less pronounced than that observed for SOD. Total antioxidant capacity, as well as phenolic and flavonoid contents, were also elevated under combined treatments but to a relatively lesser extent than enzyme activities and gene expression markers. Their distributions across treatments showed less distinct clustering, implying more generalized biochemical responses. As expected, the control group (0 mM Put + 0 µM Me) exhibited the lowest levels across all measured traits, indicating a substantial enhancement of stress-related defense systems through foliar application of melatonin, putrescine, or their combination. Finally, the dendrogram analysis confirmed these observations. Treatments with combined applications of melatonin and putrescine clustered distinctly from control and single-compound treatments. Similarly, functional traits such as gene expression and enzymatic antioxidants formed coherent sub-clusters, reflecting their interconnected roles in postharvest stress mitigation and delayed senescence.

Fig. 14.

Melting curve of the SPMS gene.

The clear segregation of treatment groups in the dendrogram, with combined treatments clustering distinctly from single and control treatments, emphasizes the unique biochemical and molecular signatures elicited by each regime. These findings support the hypothesis that co-application of putrescine and melatonin synergistically improves postharvest resilience in Alstroemeria through orchestrated regulation of antioxidant responses and polyamine-associated gene activities.

Correlation analysis among biochemical traits and molecular responses

Figure 16 presents the results of Pearson correlation analysis, highlighting strong and significant positive associations among antioxidant enzymes—including superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), and guaiacol peroxidase (GPX)—as well as phenolic compounds (total phenol and flavonoid) and overall antioxidant capacity. The strongest correlations were observed between phenol and flavonoid (r > 0.90), Antioxidant capacity and APX activity (r > 0.90), Antioxidant capacity and flavonoid content (r > 0.85), and Flavonoid and APX activity (r > 0.80) demonstrating a highly coordinated antioxidant defense system involving both enzymatic and non-enzymatic components. Furthermore, SPMS and SAMDC—key genes involved in polyamine biosynthesis—showed positive correlations with several antioxidant traits. Notably, SPMS was strongly correlated with SOD, APX, phenol, flavonoid, and antioxidant capacity. SAMDC showed moderate but still significant correlations, especially with SOD and APX activity. These patterns suggest that enhanced polyamine metabolism via melatonin and putrescine treatments may contribute to the activation of antioxidant pathways, thereby improving oxidative stress resilience in cut Alstroemeria flowers.

Fig. 15.

Heatmap representation of the effects of preharvest foliar application of putrescine (0, 1.5, and 3 mM) and melatonin (0, 50, and 100 µM) on postharvest antioxidant enzyme activities (SOD, CAT, GPX), phenolic compounds (phenol, flavonoid), and antioxidant capacity in cut Alstroemeria hybrida cv. Amatista. Higher intensities (red) indicate elevated levels of the respective traits, highlighting the synergistic enhancement in samples treated with combined putrescine and melatonin.

The observed strong positive correlations among antioxidant enzymes (SOD, CAT, and GPX) and non-enzymatic antioxidants (phenolics and flavonoids) reflect a highly integrated antioxidant system that responds to oxidative stress during postharvest senescence in Alstroemeria hybrida. The close association between enzymatic and non-enzymatic antioxidant components suggests that these systems act synergistically to mitigate reactive oxygen species (ROS) accumulation and maintain cellular homeostasis. Notably, the strong correlations between SPMS and SAMDC expression and antioxidant parameters highlight the regulatory role of polyamines in modulating oxidative stress responses. Polyamines have been shown to stabilize membranes, scavenge free radicals, and enhance the expression of antioxidant-related genes under stress conditions⁷⁸. The strong associations observed in this study imply that preharvest applications of melatonin and putrescine may enhance the polyamine biosynthetic pathway, which in turn contributes to elevated antioxidant enzyme activities and accumulation of phenolic compounds^27,60,78. These results are consistent with previous findings in other ornamental and horticultural species, where polyamine metabolism was linked to improved postharvest longevity through enhanced oxidative stress tolerance e.g^19,49.,. Overall, the correlation patterns reinforce the hypothesis that polyamine-related signaling pathways play a crucial role in improving postharvest quality in Alstroemeria through the orchestration of antioxidant defense mechanisms.

Principal component analysis (PCA)

The PCA biplot (Fig. 17) effectively distinguishes the treatments based on their postharvest biochemical and molecular responses. The first principal component (PC1) explained 75.5% of the total variance, and the second principal component (PC2) accounted for 13.5%, collectively explaining approximately 89% of the dataset variability. Treatments receiving combined applications of putrescine (1.5 and 3 mM) and melatonin (particularly at 50 µM) clustered distinctly in the positive region of PC1, exhibiting strong positive correlations with enhanced activities of antioxidant enzymes including SOD, CAT, APX, and GPX. These treatments were also positively associated with increased total antioxidant capacity, higher phenolic and flavonoid contents, and upregulated expression of polyamine biosynthesis-related genes such as SAMDC and SPMS. In contrast, control treatments and those treated with melatonin alone (without putrescine) positioned predominantly in the negative region of PC1, demonstrating weaker associations with the measured biochemical and molecular parameters. This clear separation highlights a synergistic effect of combined putrescine and melatonin treatments in enhancing the antioxidant defense system and secondary metabolite accumulation during the postharvest period. Furthermore, the close proximity and directional alignment of vectors representing polyamine biosynthesis genes with those of antioxidant enzymes and phenolic compounds underscore their coordinated role in mitigating oxidative stress postharvest. Although PC2 explains a smaller proportion of variance, it contributes to differentiating treatments with intermediate biochemical and molecular responses.

Fig. 16.

Pearson correlation matrix among postharvest antioxidant enzyme activities (SOD, CAT, GPX), total phenolic and flavonoid contents, antioxidant capacity, and the expression levels of SPMS and SAMDC genes in cut Alstroemeria hybrida cv. Amatista. The intensity and orientation of the ellipses represent the strength and direction of the correlations. Dark blue, narrow ellipses indicate strong positive correlations (r approaching + 1). The plot highlights significant associations between polyamine biosynthesis genes and antioxidant-related parameters.

Fig. 17.

Principal component analysis (PCA) biplot showing the distribution of different preharvest treatments of putrescine (0, 1.5, and 3 mM) and melatonin (0, 50, and 100 µM) based on postharvest biochemical and gene expression traits in cut Alstroemeria hybrida cv. Amatista. The first two principal components (PC1 and PC2) explain 75.5% and 13.5% of the total variance, respectively. Red arrows represent variable loadings, and blue dots denote treatment scores.

The PCA analysis effectively highlighted the differential effects of putrescine and melatonin treatments on the biochemical and molecular status of cut Alstroemeria flowers during postharvest storage. The dominant contribution of PC1 (75.5% variance) suggests that the measured antioxidant enzyme activities and secondary metabolites are key drivers of variation among treatments. The clustering of combined treatments (putrescine + melatonin) in the positive region of PC1 indicates a strong enhancement of the antioxidant defense mechanisms. Putrescine, a polyamine known for its role in stress tolerance, likely stabilizes cellular structures and scavenges reactive oxygen species (ROS)^91,92, while melatonin, a potent antioxidant and signaling molecule, may synergistically boost the activity of enzymes like SOD, CAT, APX, and GPX⁹³. This dual treatment effectively reduces oxidative damage, which is consistent with the observed increases in total antioxidant capacity and phenolic compounds. Upregulation of SAMDC and SPMS genes in these treatments further underlines the role of polyamine biosynthesis in enhancing stress resistance⁹⁴. Polyamines are implicated in maintaining membrane integrity, regulating ion channels, and modulating gene expression under stress conditions⁶⁴. Their close association with antioxidant enzymes in the PCA biplot reflects a coordinated network of biochemical pathways that extend flower longevity and quality postharvest. The weaker effects observed in treatments with melatonin alone or control suggest that putrescine is essential to maximize these protective effects. Additionally, the slight separation along PC2 points to subtle differences in treatment responses that may relate to concentration-dependent effects or interactions with other metabolic pathways. Overall, the PCA results provide robust multivariate evidence supporting the synergistic use of putrescine and melatonin as an effective postharvest treatment to improve the biochemical and molecular resilience of cut flowers.

Conclusion

The findings of this study demonstrated that treatment of cut Alstroemeria flowers with putrescine (1.5 and 3 mM) and melatonin (50 µM) significantly improved various physiological and biochemical parameters. Among the tested concentrations, 1.5- and 3-mM putrescine had more pronounced effects on most traits, although the differences between these two concentrations were not statistically significant in many cases. Melatonin at 50 µM showed the greatest impact across most evaluated indices. The activities of antioxidant enzymes—superoxide dismutase (SOD), catalase (CAT), guaiacol peroxidase (GPX), and ascorbate peroxidase (APX)—as well as the levels of total phenols and flavonoids, increased following treatments with putrescine and melatonin. Moreover, expression levels of key polyamine biosynthesis genes, SAMDC and SPMS, were significantly upregulated in response to these treatments. The enhancement of the antioxidant defense system by putrescine and melatonin treatments appears to contribute to improved quality and extended vase life of cut Alstroemeria flowers. The combined treatment of melatonin and putrescine is recommended as the most effective among the tested concentrations for improving postharvest quality of cut Alstroemeria flowers.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Nazdar Mirzaei Esgandian carried out the physiological and biochemical experiments, collected and organized the data, and participated in data analysis. Zohreh Jabbarzadeh drafted the original manuscript, conceptualized and designed the research, supervised the study, and served as the corresponding author. Reza Darvishzadeh was responsible for conducting the molecular assays and contributed to the interpretation of gene expression results. All authors discussed the results, contributed to the final manuscript, and approved its submission.

Data availability

All data generated or analyzed during this study are included in this manuscript.

Declarations

Competing interests

The authors declare no competing interests.