Synthesis and characterization of magnetic nanoparticles loaded with curcumin and piperine and investigating the effects of these nanoparticles on Mir16-1 and mediators of apoptosis pathway in breast cancer

Abstract

Curcumin (CUR) and piperine (PIP), as natural polyphenols, exhibit potent anti-cancer effects against many cancers, such as breast cancer. To enhance the efficiency of these drugs when used together and to impart magnetic properties to targeted drug delivery, CUR and PIP were loaded on magnetic iron nanoparticles (NPs) coated with silica (Fe₃O₄@SiO₂). CUR-loaded Fe₃O₄@SiO₂ NPs, PIP-loaded Fe₃O₄@SiO₂ NPs, and CUR/PIP-loaded Fe₃O₄@SiO₂ NPs were prepared using a co-participation approach followed by drug functionalization. The analysis of obtained NPs was done by Vibrating-Sample Magnetometer (VSM), Field Emission-Scanning Electron Microscopy (FE-SEM), Transmission Electron Microscopy (TEM), Energy Dispersive X-ray Spectroscopy (EDS), Element Mapping, Fourier Transform Infrared Spectrometer (FT-IR), and X-ray Powder Diffraction (XRD). Analysis confirmed successful loading of drugs on Fe₃O₄@SiO₂ NPs and the presence of good magnetic properties of prepared NPs. According to the MTT assay, all drug-loaded NPs exhibited an anticancer effect on MCF-7 cells; however, the effect of Fe₃O₄@SiO₂-CUR/PIP magnetic NPs was more pronounced than Fe₃O₄@SiO₂-CUR and Fe₃O₄@SiO₂-PIP applied alone, thus confirming the synergistic effect of the two drugs on NPs. Also, Flow Cytometry results showed the amount of cell apoptosis caused by the IC₅₀ concentration and 48-hour treatment with Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP were estimated to be 63.25%, 61.1%, 75.5% respectively. Furthermore, the Real-time PCR results confirmed the synergistic effect of Fe₃O₄@SiO₂-CUR/PIP nanoparticles in the ratio of Fe₃O4@SiO₂-CUR and Fe₃O₄@SiO₂-PIP in apoptosis induction.These findings offer a novel perspective for targeted cancer therapy using CUR and PIP.

Introduction

Cancer is a major global health concern, affecting not only fertility and life expectancy but also imposing a tremendous physiological and economic burden on communities [1]. Breast Cancer (BC) is the second most common cancer, following lung cancer and the leading cause of cancer-related death in females [2]. According to the World Health Organization (WHO), one in eight women will be diagnosed with BC. Following a BC diagnosis, various treatments such as chemotherapy, surgery, and radiotherapy, can be considered based on the patient’s condition. However, these treatments are often associated with side effects, are expensive, decrease the quality of life, and cause other health-associated problems [3]. Thus, there is a continuous need for novel, readily available agents that possess fewer side effects and are accessible for cancer treatment [4].

Dietary polyphenols, such as Curcumin (CUR) and piperine (PIP). possess antioxidant properties and have shown potential in the treatment and prevention of BC [5]. PIP as a bioavailability-enhancing agent is derived from the black pepper plant, whereas CUR is derived from the Curcuma longa root. These compounds effectively prevent oxidative stress and inflammation and have demonstrated efficacy in treating conditions such as Parkinson’s disease, arthritis, cancer, and epilepsy [6]. These compounds influence crucial signaling pathways and molecular targets, ultimately leading to the prevention of cancer cell metastasis, proliferation, and angiogenesis resulting in the apoptotic pathways [7]. However, short half-life, relatively limited bioavailability, and poor aqueous solubility remain significant challenges in the clinical application of CUR and PIP. Therefore, various types of nanoproducts utilizing CUR and PIP have been developed. Specifically, the encapsulation of CUR and PIP whithin magnetic nanoparticles (MNPs) represent a vital strategy for over coming these limitations [7, 8].

Due to their unique magnetic properties of MNPs, they have gained significantpractical importance in various medical applications, including drug delivery, nanomedicine, molecular diagnosis, and bioimaging [9, 10]. The simultaneous application of MNPs with antioxidants and drugs can improve drug performance, and decrease side effects, and facilitate effective magnetically-guided drug delivery for targeted therapy [11, 12]. Consequently, targeted drug delivery using MNPs is now a crucial area in cancer therapy. In drug delivery systems, hybrid-coated MNPs offer combined benefits: the magnetic core enables easy separation, real-time monitoring of the transport, imaging modalities, and specific drug release at target sites, while the coating provide advantages such as reduced toxicity, increased biocompatibility, suitable chemical functionalization, and surface modifications [13, 14].

Polymers, biomolecules, silica, other metals, etc., were applied for further modification of MNPs. Silica is highly used as a solid combined with magnetic materials. Silica-coated iron oxide NPs (Fe₃O₄@SiO₂) are suitable MNPs for a targeted drug delivery system due to their inert nature, high magnetic properties, high stability, and functionalization ability [15]. After coating iron oxide NPs with silica, this layer protects MNPs against oxidation and aggregation, thereby enhancing the chemical and physical stability of MNPs. Furthermore, the silica surface hydroxyl group allows for surface functionalization with different chemical agents, antioxidants, and drugs via hydrogen bonding [16, 17].

Drug-released systems of silica-coated MNPs are developed considering many stimuli, like light-responsive, thermo-responsive, and pH-responsive for drug delivery with controlled release considering the adjustable surface [18, 19]. Silica functionalization demonstrated the flexible capability of MNPs to release and store hydrophobic and hydrophilic drug, leading to decreased cytotoxicity in cancer therapy [17]. For example, targeted drug delivery of Teniposide by Fe₃O₄@SiO₂ has been employed for brain cancer treatment [20]. Furthermore, functionalized iron oxide MNPs have been utilized as potential drug carriers for targeted delivery of docetaxel to BC cells [21]. The doxorubicin hydrochloride-loaded magnetic silica nanocomposite synthesis and drug release properties against BC cells were studied by Ehsanimehr and coworkers based on the surface functionalization strategy [22]. Abbasi Kajani et al. produced silver/gold decorated silica-coated iron oxide NPs and assessed their anticancer effect on human breast (MCF-7) cell lines [23].

Recent studies on silica-coated MNPs loaded with CUR show effective anticancer activity. For example, A theragnostic nanoplatform consisting of magnetic iron oxide functionalized with curcuminoids (CC) and subsequently covered with silica shows a negligible release of CC under sink conditions [24]. The impact of free CUR versus CUR loaded onto Fe₃O₄ NPs coated with carboxymethyl chitosan was studied on MCF-7 cells using the MTT assay, and the IC₅₀ of loaded CUR showed a remarkable decrease compared to free CUR [8]. Finally, Liu et al. studied targeted delivery system for CUR loaded on magnetic α-Fe₂O₃/Fe₃O₄ heterogeneous nanotubes and its apoptosis mechanism on MCF-7 cell with same result [25].

Furthermore, studies have shown that CUR and PIP can induce apoptosis by altering miRNAs expression. In BC, several miRNAs are dysregulated, with mir16-1 being particularly significant. Among the established targets of mir16-1, we can mention Bcl-2 and PTEN genes. in breast cancer, mir16-1 regulates cell survival and exerts anti-apoptotic effects, primarily by targeting the PTEN-PIK/AKT pathway. Therefore, the synthesized nanoparticles are expected to reduce the expression of mir16-1, which then inhibits the PTEN-PI3K/AKT pathway and induces apoptosis. Additionally, these miRNAs are necessary for coordinating and regulating the early differentiation processes related to tumor cell survival, proliferation, and memory. Thus studying the expression changes of these genes can be a good solution for the treatment of BC [26, 27].

In addition to CUR, numerous in vivo and in vitro studies have reported the anticancer properties of PIP against triple-negative BC cells [28]. Ghasemi Rad et al. Specifically assessed the effects of PIP loaded NPs on BC cells. To enhance the PIP solubility, PIP was conjugated to polymer NPs. Using the MTT assay, They evaluated the viability and growth rate of cancer cells using an MTT method and reported that polymer NPs loaded with PIP inhibited cancer cell growth via stimulating apoptosis [14]. PIP has a potent inhibitory and cytotoxic effect on BC cell line (especially MCF-7) in combination with other chemotherapeutics drugs and nanocarriers such as doxorubicin, paclitaxel, docetaxel, and thymoquinone [29]. Also, the combined effect of CUR and PIP was studied in some literature. For example, the combinatorial and single toxicity of CUR- and PIP-loaded Lignin-g-p (NIPAM-co-DMAEMA) gold nanogels was assessed on U-251 MG GBM cell lines, and cytotoxic effect assessment showed synergistically and enhanced anticancer properties for a combination of PIP with CUR [30]. Bola et al. combined CUR and PIP within emulsion nanoformulations and approved that combinational treatment of HCT116 cells with CUR-PIP-emulsions enhanced the anti-cancer effect of the compounds [31]. However, according to the author’s information, there is no study on the combination cytotoxic effect of CUR and PIP, which is functionalized on silica-coated MNPs. In this study, magnetic iron oxide nanoparticles were loaded by co-precipitation method with surface functionalization with CUR and PIP, which provides improved loading efficiency and stability compared to previously reported methods. This study also demonstrates the synergistic effects of dual drug delivery system based on MNP, which have not been reported in recent papers.

It is hypothesized that the use of silica-coated MNPs loaded with drugs such as CUR and PIP can enhance the drug half-life. This enhancement is attributed to the functionalization, which facilitates targeted delivery to the cancerous cells under an external magnetic field, driven by the magnetic iron oxide core [32]. Moreover, CUR and PIP together are expected to have significant effects on MCF-7 cancer cell and apoptosis pathway mediators with limited side effects due to the confirmed synergistic effect of these drugs.

Therefore, in this study, we prepared three novel magnetic nanoparticle formulations: CUR-loaded silica-coated MNPs (Fe₃O₄@SiO₂-CUR), PIP-loaded silica-coated MNPs (Fe₃O₄@SiO₂-PIP), and combined CUR/PIP-loaded silica coated MNPs (Fe₃O₄@SiO₂-CUR/PIP). Subsequently, the individual and combined effects of these CUR and PIP MNPs on inhibiting the growth of MCF-7 cancer cell lines were evaluated using the MTT method and the changes in the expression of mir16-1 and the mediators of the apoptotic pathway were analyzed, with the ultimate goal of identifying a safe and effective therapeutic method for BC treatment that exhibits superior performance compared to pure CUR and PIP.

Materials and methods

Chemical agents

Ferric salts (FeCl₃.6H₂O and FeCl₂.4H₂O) and tetraethyl orthosilicate (TEOS) were obtained from Merck, Germany. CUR and PIP powder were provided by Sigma Aldrich. Chemical agents and solutions were provided and applied in pure form. MCF-7 BC cell was provided by Pasteur Institute, Iran. MCF-7 cell lines were cultured in RPMI1640 medium (Bio IDEA) treated with 3 mg/ml sodium bicarbonate (Serva co, Germany), Penstrap 1% (Merck, Germany), 20% heat-inactivated fetal bovine serum (FBS) (Gipco, Invitrogen), and followed by incubation at 37 °C in humidified air with 5% CO2. MTT 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide) (Solar Bio), DSMO (dimethy sulfoxide), EDTA (Ethylenediaminetetraacetic acid) (Bio IDEA), and Trypsin were obtained from Sigma Co, Germany.

Characterization

We utilized a field emission scanning electron microscope (FE-SEM) to specify appearance and structural features by SEM (Philips S-4160 and XL 30) with gold coating, connected to element mapping analysis (EMPA) and energy dispersive X-ray spectroscopy (EDX). NPs’ distribution graph was constructed using Origin 8.6 software according to 15 NPs randomly in the SEM image. A vibrating sample magnetometer/alternating gradient force magnetometer (www.mdk-magnetics.com; VSM/AGFM, MDK Co., Iran) determined the magnetic effects and saturation of the NPs. Fourier transform infrared spectrometer (FT-IR) assay was done in real-time using spectroscopic grade KBr and Perkin series over the region 400–4000 cm^− 1. X-ray powder diffraction (XRD) recorded the crystal structure of NPs as well as their phases. Philips X’pert XL 30 diffractometer recorded powder XRD at ambient temperature by Cu Kα (α = 1.54056 Å) in Bragg-Brentano geometry (θ-2θ). Transmission electron microscopy (TEM, EM10C, Zeiss) was used to characterize NP structure. Brunauer-Emmett-Teller (BET) analysis of NPs was performed using the Micromeritics Tristar II plus model device. Zeta–dynamic light scattering (DLS) was performed on a Zeta sizer (Malvern company, England) for investigation of the zeta potential of samples and particle stability. The data were achieved from the abbreviation of three-time measurements.

Generation of Fe₃O₄@SiO₂ NPs

To synthesize Fe₃O₄@SiO₂ NPs, first, 20 mmol of FeCl₃.6H₂O and 20 mmol of FeCl₂.4H₂O were mixed with 40 ml of deionized water followed by mixing by mechanical stirring at room tempreture. Afterward, NH₃ (10 mL) was mixed dropwise with the mixture until obtaining a pH of 12 and a black color sediment. Then, the solution was subjected to a temperature of 150 °C and reflux for 4 h, and after that, ethanol (80 mL) and TEOS (20 mL) were mixed with the solution, followed by stirring at 40 °C for 24 h. Finally, the Fe₃O₄@SiO₂ NPs underwent magnetic detachment and were washed one time with diethyl ether and two times with ethanol and water. The obtained Fe₃O₄@SiO₂ NPs were subjected to drying in a thermal oven (80 °C/12 h).

CUR and PIP loading on Fe₃O₄@SiO₂ NPs

Initially, a balloon was filled with 20 mL ethanol, followed by adding 40 mg of pure CUR and placing on a magnetic stirrer (15 min) to dissolve the CUR and obtain a clear solution; Fe₃O₄@SiO₂ NPs (240 mg) were mixed with the solution and located on a mechanical stirrer at ambient temperature for 4 h. The mixture was located on a super magnet to separate the supernatant fluid. Then, ethanol (2 mL) was mixed with the residue, and stirred for 10 min, to wash drug excesses without attachment to NPs. A test tube was filled with all contents and underwent centrifugation (14,000 rpm/10 min); a pipette separated the supernatant, and an oven was used to dry the precipitate at 80 °C for 4 h, resulting in the CUR-loaded Fe₃O₄@SiO₂ NPs (Fe₃O₄@SiO₂-CUR) product. To prepare the PIP-loaded Fe₃O₄@SiO₂ NPs (Fe₃O₄@SiO₂-PIP) and CUR/PIP-loaded Fe₃O₄@SiO₂ NPs (Fe₃O₄@SiO₂-CUR/PIP), all these steps were followed but the amount of PIP was 150 mg.

Colloidal stability of drug-loaded nanoparticles

Zeta–dynamic light scattering (DLS) was performed for the investigation of particle stability for 5 days. The samples for zeta potential analysis were prepared at 0.5 mg/mL, and then colloidal stability was determined from the Eq. (1).

1

where the colloidal stability of the NPs on each day is as much as the size of the NPs on each day(t_n) to the initial size of the nanoparticles on the first day(t₀).

Determining the drug amount loaded on NPs

A UV-Vis spectrophotometer measured the drug amount [33, 34]. To assess the association between adsorption number and concentration, standard curves were built with standard solutions with certain drug concentrations (CUR or PIP). Following mixing a specific level of drug and NPs and while separating NPs from the primary solution using a magnet, the supernatant was isolated, and a UV-Vis spectrometer measured drug concentration. Afterward, the drug loading efficiency (E) was determined by Eq. 2.

2

The wavelength needed to assess CUR and PIP by a UV-vis device was respectively 450 nm and 342 nm.

In vitro drug release

The dissolution rate of drugs was investigated by an In vitro drug release assessment in PBS solution (pH = 7.4). The prepared NPs were put on a paddle model dissolution device (noavaran co. Iran) at 37 °C at 100 rpm. About 2 mL of the dissolution medium samples was withdrawn, and centrifuged, and then the drug level in solution was measured using UV spectroscopy [35]. The samples were replaced with the same volume of fresh PBS solution in the dissolution device for the next measurement. Finally, the concentrations of drugs were calculated by calibration curve equations which, were obtained in Sect.  2.6. The data were reported as percentages of drug release, where 100% was considered the amount of drug loaded on NPs. All experiments were performed at least three times.

Cytotoxicity and MTT assay

Following cell culture, the toxic effects of Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP on MCF-7 cell lines were assessed using MTT nalysis at 24 and 48 h. Briefly, 10,000 cells were cultured in a plate with 96 wells and received CO₂ 5% at 37 °C for 24 h. Cells received various concentrations (5–25µM) of Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP at 24- and 48-hour intervals with ternary replications. The control was considered a ternary replication with zero µM of the drug. Twenty-four hours after treatment, the cell surface environment was removed, and the wells were added with 10 µL MTT (Solar Bio) solution and 90 µL fresh medium followed by incubation for 4 h. Then, after discarding the perimeter of the wells, 100 µL of DMSO was poured into all wells and the absorbance was recorded at 550–670 nm by an ELISA reader (Elx808, BioTeck, USA).

Flow cytometry

Flow Cytometry assay (BD Biosciences, San Jose, CA, USA) was done considering four groups, MCF-7 cells with media (control group) and cells receiving Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP at IC₅₀ concertation (for 48 h). For this test, four well plates were regarded. A total of 10,000 cells were seeded and incubated in each well for 48 h. The cells received Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP, (IC₅₀ concentration) for 48 h. After incubation, washing of the cells was done with PBS, trypsin zed, and suspension was done with PBS. Annexin-V (Biolegend) was mixed with the suspension, followed by incubation for 10 min. Finally, data were restored using Partec Flomax software.

Real-time PCR

Real-time PCR SYBR Green method was developed by Pishgam (Iran) and was performed by Rotor-Gene 6000 (Corbett Research, Australia). Each reaction contained 1 µL of each primer, 7 µL of deionized water, 1 µL of cDNA (2 ng), and 10 µL of SYBR Green PCR Master Mix, resulting in a total volume of 20 µL. Thermal cycling conditions consisted of 15 s at 95 °C, 20 s at 60 °C, and 30 s at 72 °C, repeated for a total of 40 cycles. Also, primer design was done by Gen runner software and the characteristics of the designed primers were confirmed using NCBI software.

Table 1.

Primers applied for quantitative Real-time PCR

Gene	Forward (5−3)	Reveres (5−3)
Bax	AAA CTG GTG CTC AAG GC	CAC AAA GAT GGT CAC GG
Bcl-2	TAA CGG AGG CTG GGA TG	CAG GAG AAA TCA AAC AGA GGC
β-actin	CTT CCT TCC TGG GCA TG	GTC TTT GCG GAT GTC CAC
Mir16-1	CGGGCTAGCAGCACGTAAAT	CAGCCACAAAAGAGCACAAT
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT

Statistical analysis

All experiment, including MTT, flow Cytometry and Real time PCR assays, were conducted in triplicate (n = 3). Data are presented as mean ± standard deviation (SD). Statistical analyses were perform using SPSS 22. Reletive gene expression levels were calculated using the ∆∆CT. Comparisons among groups were made using one-way analyses of variance (ANOVA) followed by Tukeys multiple Comparison test. A p-value < 0.05 was considered statistically significant. Significant differences in flow Cytometry and Real time PCR similarly assessed using ANOVA with appropriate post hoc tests.

Result

Characterization

The iron oxide NPs obtained from the co-precipitation of Fe(III) and Fe(II) (Stober method) are covered by hydroxyl groups (from NH₄OH), which offers chemical anchors for Si(OEt)₄ (tetraethyl-orthosilicate). A sol-gel procedure was applied to cover Fe₃O₄ NPs with a SiO₂ shell [36, 37]. The hydrolysis of attached Si(OEt)₄ with water, followed by condensation under thermal conditions, leads to the cross-linking of Si-O-Si bonds on the surface of iron oxide NPs. Then, there is a further reaction with CUR or PIP as drugs to produce drug-functionalized MNPs.

SEM was utilized to examine the morphology and size of the functionalized NPs. The SEM images of Fe₃O₄@SiO₂, Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP NPs were provided in Fig. 1a–d. The nano-graphs reveal that the prepared Fe₃O₄@SiO₂ NPs are spherical and uniform with standard size. According to the SEM images, the average size of Fe₃O₄@SiO₂ NPs (62 nm, Fig. 1a) increases following functionalization with the drug (82 nm for Fe₃O₄@SiO₂-CUR, 80 nm for Fe₃O₄@SiO₂-PIP and 93 nm for Fe₃O₄@SiO₂-CUR/PIP, (Fig. 1b-d), suggesting successful CUR and PIP loading on Fe₃O₄@SiO₂ NPs. The low accumulation of NPs can be observed because of the MNPs’ tendency to agglomerate during the analysis of the powder form of NPs. The high-resolution morphology and 2-dimensional projection of NPs were further investigated using TEM (Fig. 2a-c). Figure 2 represents a nearly spherical morphology with a two-phase structure of NPs due to the silica coating of Fe₃O₄ in the synthesized.

Fig. 1.

FE-SEM analysis with different magnification and histogram of nanoparticle size for a Fe₃O₄@SiO_2, b Fe₃O₄@SiO₂-CUR, c Fe₃O₄@SiO₂-PIP, d Fe₃O₄@SiO₂-CUR/PIP NPs

Fig. 2.

TEM analysis with different magnification for a Fe₃O₄@SiO₂-CUR, b Fe₃O₄@SiO₂-PIP, c Fe₃O₄@SiO₂-CUR/PIP NP_S

NPs. According to the synthesis method and the surrounding layer seen in higher magnification (especially in Fig. 2c, NPs have been functionalized with two drugs, CUR and PIP together), it is suggested that drugs are successfully loaded around the Fe₃O₄@SiO₂ NPs. As well as the TEM images also show a uniform distribution of spheres with particle sizes ranging from 10 to 40 nm.

To determine the elemental analysis of NPs, the energy dispersive X-ray (EDS) spectra (Fig. 3a-c) and Element mappings (Fig. 4a-c) of NPs were done. Figures 3a and 4a indicate the presence of Fe, O, Si, and C in the Fe₃O₄@SiO₂-CUR NPs ( Fe 42.4%, O 24.7%, Si 21.7% and C 11.3%). Analysis of Figures (Figs. 3b and c and 4b and c) showed the presence of N element as well as Fe, O, Si, and C in Fe₃O₄@SiO₂-PIP (Fe 56.9%, O 26.8%, Si 8.7%, C 7.1% and N 0.5% ) and Fe₃O₄@SiO₂-CUR/PIP NPs (Fe 51%, O 27.1%, Si 12.3%, C 9.3% and N 0.3% ). Elemental mapping showed uniform distribution and high purity, ensuring that physicochemical properties, including homogeneity, structural integrity, and drug loading efficiency, were maintained. Also, the use of deionized water and precautions taken during synthesis resulted in the absence of potential impurities.

Fig. 3.

EDS analysis for a Fe₃O₄@SiO₂-CUR, b Fe₃O₄@SiO₂-PIP, c Fe₃O₄@sSiO₂-CUR/PIP NP_S

Fig. 4.

Element mapping analysis for a Fe₃O₄@SiO₂-CUR b Fe₃O₄@SiO₂-PIP, c Fe₃O₄@SiO₂-CUR/PIP NP_S

The presence of N element is due to addition of PIP as a drug with the nitrogen element in molecular structure. The analyses are in accordance with the chemical composition of the NPs and approve the functionalization with the drug due to the appearance of N and C element s in iron oxide NPs.

FT-IR spectroscopy (Fig. 5) demonstrated the chemical structure of pure CUR, pure PIP, Fe₃O₄@SiO₂, Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, Fe₃O₄@SiO₂-CUR/PIP NPs. The FT-IR spectrum of pure CUR (Fig. 5a) indicated a sharp absorption band at 3508 cm^− 1 due to the OH of its enol group. A strong absorption band at 1627 cm^− 1, is due to the overlap between C=O and C=C groups.

Fig. 5.

FT-IR analysis of a pure CUR, b pure PIP, c Fe₃O₄@SiO₂ d Fe₃O₄@SiO₂-CUR, e Fe₃O₄@SiO₂-PIP, f Fe₃O₄@SiO₂-CUR/PIP NP_S

The 1507 cm^− 1 absorption band is caused by the (C=O), however, the absorption band at 1275 cm^− 1 is associated with the enol group (C–O) [68]. The pure PIP FT-IR spectrum (Fig. 5b) demonstrates the peaks at 3009 cm^− 1, 2937 cm^− 1, and 2860 cm^− 1 (aliphatic and aromatic C–H bonds),1625 1632 cm^− 1 (overlap between C=O and C=C groups), 1583 cm^− 1 (C=O of amide group), 1489 cm^− 1 (aromatic C=C), 1441 cm^− 1 and 1363 cm^− 1 (CH2), 1249 cm^− 1 and 1194 cm^− 1 (C–O). The FT-IR spectra related to the Fe₃O₄@SiO₂ NPs are depicted in Fig. 5c. The characteristic absorption bands related to Fe₃O₄ NPs are spotted at 400–900 cm^− 1 associated with Fe–O bond stretching methods. The FT-IR findings of Fe₃O₄ NPs agree with other findings [69]. The broad peak at 100–1100 cm^− 1 in Fe₃O₄@SiO₂ NPs spectra (Fig. 5c) is related to the Si–O vibrations, and the Si–O–Si bond confirmed SiO₂ generation on the Fe₃O₄ surface [70]. The FT-IR spectrum of Fe₃O₄@SiO₂-CUR (Fig. 5d) indicates characteristic peaks at 3427 cm^− 1 (broad peak associated with OH of enol and Si–OH and aromatic C–H), 1625 cm^− 1 (distinct peak associated with CUR due to the overlap between C=O and C=C groups), 1068 cm^− 1 (sharp peak associated with Si–O–Si and Si–O in SiO₂ shell of NP) and 635 cm^− 1 and 487 cm^− 1 (sharp and broad peak associated with Fe-O in Fe₃O₄ core of NPs). Such peaks confirmed the CUR loading at Fe₃O₄@SiO₂ NPs. The FT-IR spectrum of Fe₃O₄@SiO₂-PIP ( Fig. 5e) indicates characteristic peaks at 3405 cm^− 1 (broad peak associated with OH of C-H and Si-OH of aromatic ring), 2927 cm^− 1 (CH₂ stretching vibration for PIP), 2860 cm^− 1 (NCH₂ stretching vibration for PIP), 1627 cm^− 1 (distinct peak associated with PIP due to the overlap between C=O and C=C groups), 1446 cm^− 1 (CH₂ bending vibration due to PIP loading), 1069 cm^− 1 (sharp peak associated with Si–O and Si–O–Si in SiO₂ shell of NP) and 636 –446 cm^− 1 (sharp and broad peak associated with Fe-O in Fe₃O₄ core of NPs). Such peaks approved the successful loading of CUR at Fe₃O₄@SiO₂ NPs. In the FT-IR of Fe₃O₄@SiO₂-CUR/PIP NPs (Fig. 5f), the morphology of distinct peaks at 3427 cm^− 1 (OH) 2927 cm^− 1, 1453 cm^− 1 (CH of PIP and CUR), and 1626 cm^− 1 (overlap between C=O and C=C) groups was because of PIP and CUR) indicates the drug loading. Also, the peak at 1068 cm^− 1 associated with SiO₂ and 637 –452 cm^− 1 associated with Fe₃O₄ is related to core- shell magnetic NPs. As described, the interpretation of FT-IR spectra can be enhanced by accurately identifying key peaks and explaining their relationship to the surface generalization process and NPs structure. This will increase the resolution of the analysis and the validity of the results (Fig. 5).

Figure 6A compares the XRD patterns of Fe3O4@SiO2, Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP NPs. Diffraction peaks at about 30.40, 35.77, 43.46, 53.8, 57.43, and 63.08, associated respectively with the (220), (311), (400), (422), (511), and (440) can be identified from Fe₃O₄@SiO₂ NPs, XRD pattern (Fig. 6A(a). The identified diffraction peaks agree with the structure of Fe₃O₄ (1999 JCPDS file No. 19–692). The core-shell NPs’ silica sheath seemed in an amorph structure with no distinct sharp peak in the XRD pattern [71]. Also, Fe₃O₄ characteristic peaks were observed in the XRD patterns of Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP NPs, however, with lower intensity (Fig. 6A(b-d(), approving the effective Fe₃O₄@SiO₂ coating with PIP and CUR with no alterations or deformation in the crystal structure of base core-shell NPs.

Fig. 6.

A)XRD analysis of a Fe₃O₄@SiO_2, b Fe₃O₄@SiO₂-CUR, c Fe₃O₄@SiO₂-PIP, d Fe₃O₄@SiO₂-CUR/PIP NP_S and B)VSM analysis of a Fe₃O₄@SiO_2, b Fe₃O₄@SiO₂-CUR, c Fe₃O₄@SiO₂-PIP, d Fe₃O₄@SiO₂-CUR /PIP NP_S

The crystallite size of nanoparticles can be determined from X-ray diffraction (XRD) patterns based on the broadening of diffraction peaks. Using the Debye–Scherrer equation, the average crystallite size is calculated from D = Kλ/βcosθ, where D is the crystallite size, K is the Scherrer constant (≈ 0.9), λ is the X-ray wavelength, β is the full width at half maximum (FWHM) of the peak in radians, and θ is the diffraction angle. This method provides an effective estimation of crystallite size on the nanometer scale, although it reflects the size of coherent crystalline domains rather than the total particle size. The result of measuring the size of nanoparticles using the above method are as follows: Fe₃O₄@SiO₂ (123 nm), Fe₃O₄@SiO₂-CUR (165 nm), Fe₃O₄@SiO₂-PIP (179 nm) and Fe₃O₄@SiO₂-CUR/PIP (185 nm).

It is critical to note that XRD inherently calculates the size of coherent crystalline domains (crystallites), not necessarily the entire particle. While the XRD size is often smaller than the particle size (if particles are multi-crystalline aggregates), an inverse observation where D-XRD > D-SEM suggests that the recorded XRD peaks are narrow, or that internal lattice strain/defects are minimal, leading to an overestimation of the crystallite size via the Scherrer method.

Because of the importance of NPs’ magnetic effects in practical applications, like cancer trappy, we investigated the magnetic effects of CUR- and PIP-loaded NPs by VSM (field sweeping between − 20000 and + 20000 Oe, at ambient temperature).The magnetic curves of Fe₃O₄@SiO₂, Fe₃O₄@SiO₂-CUR, and Fe₃O₄@SiO₂-PIP NPs exhibit high magnetic saturation of about 60 emu/g (Fig. 6B (a-c(). Nonetheless, the magnetic saturation of Fe₃O₄@SiO₂-CUR/PIP NPs (Fig. 6B (d() is the lowest (54 emu/g) because of the high CUR and PIP loading with others. The obtained NPs demonstrated high permeability in magnetization enough for magnetic isolation using a conventional magnet. The superparamagnetic effects of NPs was found, thus, the novel NPs were not aggregated following the removal of the magnet device and can be applied in vivo with no aggregation issues.

The BET analysis offers an accurate, specific surface area measurement of materials using nitrogen multilayer adsorption determined as a relative pressure function by an automated analyzer. The BET analysis of the NPs indicated the surface area at p/p° = 0/30 in the amount of 50.36, 48.94, and 43.52 m²/gr for Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP NPs. The lower surface area of Fe₃O₄@SiO₂-CUR/PIP NPs is due to the high level of functionalization with the two drugs. However, it can be concluded that the obtained MNPs provide a large surface area for drug delivery applications.

Zeta–dynamic light scattering (DLS) determined the surface charge and hydrodynamic diameter of NPs to indicate the colloidal stability of nanocarriers. Zeta potential as the difference between the fluid stationary layer connected to the dispersed particle and the dispersion medium is related to electrokinetic potential in colloidal systems. The zeta particle size analyzer measures particle motion by determining a frequency shift because of movement due to the induced electric field. Our data showed that the zeta potential was − 55.5, -57.0, and − 46.5 mV for Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP respectively (Fig. 7a; Table 2). Based on the literature [38, 39], aggregation of NPs caused by Van der Waal interactions between particles with low zeta potentials and NPs with zeta potential of > + 25 mV or < − 25 mV indicate high levels of stability, so, results showed high stability for all synthesized NPs. According to Table 2, the stability of the NPs has increased compared to the Fe₃O₄ and Fe₃O₄@SiO₂ NPs, showing that silica-coating followed by drug loading led to a decrease in zeta potential value and particle stability. The Zeta potential of NPs increased following one day because of the detachment of the unreacted drug at the beginning of analysis however, the zeta potential of the synthesized NPs above − 30 mV in five days (Fig. 7b), approved the stability of the NPs. According to Fig. 7c, the colloidal stability of Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP was 88%, 91%, and 85%, respectively, after five days. Figure 7c showed that the average hydrodynamic diameter of the synthesized NPs did not change significantly, approving the strong functionalization of Fe₃O₄/SiO₂ with CUR and PIP.

Fig. 7.

a Zeta potential on the first day, b zeta potential stability, and c colloidal stability for synthesized NP_S at PBS solution, pH 7.4, and 25 °C

Table 2.

Zeta potential analysis of prepared NPs

	Curcumin	Fe3O4	Fe3O4@SiO2	Fe3O4@SiO2-curcumin	Fe3O4@SiO2-PIP	Fe3O4@SiO2-curcumin/PIP
Zeta potential (mv) ± SD	− 56.18	− 18.46	− 36.31	− 55.5 ± 0.04	− 57.0 ± 0.08	− 46.0 ± 0.04

Invitro drug release study

The amount of CUR and PIP on drug-loaded magnetic NPs was assessed using UV-Vis spectroscopy. CUR and PIP solutions of 5, 10, 15, 20, and 25 ppm were prepared; and then, absorbance was recorded respectively at 450 and 342 nm. We measured the internal standard peak area and standard peak area ratios, and the calibration curve was constructed as the peak area plot vs. concentration. Then, the loading efficiency (E) of drug was assessed using Eq. (2). The amount of CUR at Fe₃O₄@SiO₂-CUR and Fe₃O₄@SiO₂-CUR/PIP was 163 mg CUR per 1 g NPs and 160 mg CUR per 1 g NPs, with 97.7% and 96% drug-loading efficiencies, respectively. The amount of PIP at Fe₃O₄@SiO₂-PIP and Fe₃O₄@SiO₂-CUR/PIP was 270 mg PIP per 1 g NPs and 255 mg CUR per 1 g NPs, with 43.6% and 41% loading efficiency, respectively.

To assess drug release properties, the in vitro dissolution measurements of CUR and PIP from NPs were performed using the dissolution device. Figure 8a summarizes the drug release profile of CUR from Fe₃O₄@SiO₂-CUR and Fe₃O₄@SiO₂-CUR/PIP NPs. As well as Fig. 8b shows the drug release profile of PIP from Fe₃O₄@SiO₂-PIP and Fe₃O₄@SiO₂-CUR/PIP NPs. The results of the dissolution study (Fig. 8a, in PBS buffer solution with pH 7.4 at 37 °C) suggest a fast release of CUR within the first 2 h, about 3.2% and 3.1% from Fe₃O₄@SiO₂-CUR and Fe₃O₄@SiO₂-CUR/PIP NPs respectively. A quick release of PIP within the first 2 h was about 1.8% and 1.2% from Fe₃O₄@SiO₂-PIP and Fe₃O₄@SiO₂-CUR/PIP NPs, respectively. The burst release of drugs is followed by sustained and controlled release over 72 h. These burst releases might be because of the initial rapid dissolution of unreacted or poorly attached drugs to solvent. The low drug release percent of drugs might be due to the low solubility of drugs in water. As well as, the release rate of PIP from Fe₃O₄@SiO₂-PIP NPs was slower than the release of CUR from Fe₃O₄@SiO₂-CUR NPs which might be due to the lower solubility of PIP than CUR. After burst release, the decrease in release rate can be seen in the CUR diagram between 12 and 24 h (Fig. 8a). However, the release rate of PIP was constant between 12 and 72 h (Fig. 8b). These may be due to the stronger interaction of CUR than PIP with SiO₂ via the hydrogen bonding of hydroxyl groups in CUR.

Fig. 8.

Drug release of a CUR, b PIP

MTT Assye

To evaluate and compare the toxic effects of Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP, the MCF-7 cells of BC received various concentrations (5–25µM) of Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP at different time points for 24 h (Fig. 9a) and 48 h (Fig. 9b). The IC₅₀ of MCF-7 cells receiving Fe₃O₄@SiO₂-CUR at 24 and 48 h was 17.77 and 16.80, respectively, and IC₅₀ of MCF-7 cells receiving Fe₃O₄@SiO₂-PIP at 24 and 48 h were respectively 18.70 and 17.06. Nonetheless, IC₅₀ of treated MCF-7 cells with Fe₃O₄@SiO₂-CUR/PIP at 24 and 48 h was respectively 14.92 and 14.90 (Table 3).

Fig. 9.

Results of MTT assay for a 24 h and b 48 h. Cytotoxic impacts of various concentrations of Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, and Fe₃O₄@SiO₂-CUR/PIP on MCF-7 breast cancer cell line

Table 3.

IC₅₀ values of Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP and Fe₃O₄@SiO₂-CUR/PIP at different time points of incubation

IC50 values (µM) Mean ± SD
Incubation	Fe3O4@SiO2-CUR	Fe3O4@SiO2 −PIP	Fe3O4@SiO2-CUR/PIP
24 h	17.77 ± 1.15	18.70 ± 1.25	14.92 ± 1.14
48 h	16.80 ± 1.48	17.06 ± 1.63	14.90 ± 1.18

Flow cytometry and real-time PCR

The results of the Flow Cytometry test for Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂–PIP, and Fe₃O₄@SiO₂-CUR/PIP NPs at the IC₅₀ concentration and 48 h incubation were estimated according to Table 4; Fig. 10a–d which shows that the toxicity of each of the NPs at IC₅₀ concentration causes the apoptosis of almost half the cells.

Table 4.

Results of flow cytometry

Test (%)	Sample
	Untreated cells	Fe3O4@SiO2-CUR	Fe3O4@SiO2–PIP	Fe3O4@SiO2-CUR/PIP
Necrosis	1.14	11.3	8.56	3.24
Late apoptosis	0.008	55.7	47.5	63.3
Early apoptosis	0.039	7.55	13.6	12.2
Live cells	98.8	24.3	25.5	30.3
Unpaired T -test	Mean = 0.023	Mean = 31.62	Mean = 30.55	Mean = 37.75
Significant	P value < 0.001

Fig. 10.

Result of flow cytometry a untreated cell b treatment cell with Fe₃O₄@SiO₂-CUR c Fe₃O₄@SiO₂–PIP d Fe₃O₄@SiO₂-CUR/PIP at IC₅₀ concentrations and 48 h

Real-time PCR results for three groups Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂–PIP, and Fe₃O₄@SiO₂-CUR/PIP at IC₅₀ concentration and 48-hour treatment confirmed the synergistic effect of Fe₃O₄@SiO₂-CUR/PIP nanoparticles compared to Fe₃O₄@SiO₂.-CUR and Fe₃O₄@SiO₂–PIP in apoptotic induction. So that the comparison of the average expression of Bax and Bcl-2 genes in control cells and treated with Fe₃O₄@SiO₂-CUR showed approximately 2 time increase for Bax and 0.81 times decrease for Bcl-2. Also the comparison of the average expression of Bax and Bcl-2 genes in control cells and treated with Fe₃O₄@SiO₂-PIP showed approximately 1.7 time increase for Bax and 0.71 times decrease for Bcl-2. This is while, the comparison of the average expression of Bax and Bcl-2 genes in control cells and treated with Fe₃O₄@SiO₂-CUR/PIP showed approximately 2.7 time increase for Bax and 0.58 times decrease for Bcl-2. Therefore, Fe₃O₄@SiO₂-CUR/PIP nanoparticles confirmed the synergism effect compared to Fe₃O₄@SiO₂-CUR and Fe₃O₄@SiO₂-PIP nanoparticles in the induction of apoptosis. (Fig. 11).

Fig. 11.

Effects of Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂–PIP, and Fe₃O₄@SiO₂-CUR/PIP on the Bax and Bcl-2 gene expression in MCF-7 cells at IC₅₀ concentration (15 µM) and 48 h of treatment in comparison to the control. (*p ≤ 0.05)

Figure 12A shows the expression of Mir16-1 in breast cancer cells (UALCAN site). Real-time PCR results at IC₅₀ concentration and 48-hour treatment showed that when Fe₃O₄@SiO₂-CUR and Fe₃O₄@SiO₂–PIP nanoparticles were treated alone, they caused a slight decrease in Mir16-1 expression (0.81 and 0.71 times less than the control respectively), but when cells were treated with Fe₃O₄@SiO₂-CUR/PIP nanoparticles, they caused a significant decrease in expression. Mir16-1 and show the synergistic effect of PIP and CUR (0.58 times less than the control) (Fig. 12B).

Fig. 12.

a The expression of mir16-1 in breast cancer and b Effects of Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂–PIP, and Fe₃O₄@SiO₂-CUR/PIP on the Mir16-1 gene expression in MCF-7 cells at IC₅₀ concentration (15 µM) and 48 h of treatment in comparison to the control. (*p ≤ 0.05)

Discussion

The application of MNPs has recently gained significant attention within the fields of biology and medicine due to their capacity to target specific organs or cells and deliver therapeutic agents. Coating MNPs with inert and functional structures, such as silica facilitates the attachment of drug, chemicals, and antioxidants via hydrogen bonding [40, 41]. The primary objective in designing novel MNPs is to achieve superior drug performance and an optimized rate of release for the active drug agents within the delivery system. MNPs can target many drugs. Separately, CUR and PIP are dietary polyphenols obtained from turmeric and black pepper, respectively. They can cure many cancers. Also, they affect signaling pathways and are associated with inducing apoptosis [42, 43]. However, rapid decomposition, limited solubility, and short half-life limit their use. The introduction of CUR and PIP using iron oxide NPs has been proposed to overcome such limitations. In previous studies, CUR and PIP have been synthesized on MNPs alone, but their synthesis on silica-coated MNPs has not been reported. on the other hand, given the synergistic effect of CUR and PIP, we expect that when they are used together on MNPs, they will have a greater effect on cancer cells than when they are used alone. On the other hand, the simultaneous use of these two drugs leads to the stimulation of intracellular signaling pathways, especially the apoptosis pathway.

Studies indicate that a fundamental mechanism by which CUR and PIP induce apoptosis involves the modulation of miRNAs expression and mediators of the apoptotic pathway [44]. miRNAs are defined as a class of single-stranded, non-coding RNAs approximately 19–22 nucleotide in length. Mir16-1 was reported to be overexpressed in several human malignant tumors, including BC [27, 45].

Bcl-2 family members are main regulators of cell death or cell survival. Cancer cells routinely violate cellular checkpoints in normal cells that initiate cell death by triggering anti-apoptotic members of the Bcl-2 family of proteins. In contrast Bcl-2 family, proapoptotic members are actively involved in inducing cell death, such as Bax and Bak. Abnormal high expression of Bcl-2 protein promotes the growth of BC; Bcl-2 and Bax constitute the apoptotic switch in tumorigenesis and treatment [46, 47] On the other hand, the PTEN gene is one of the important targets of Mir16-1, and when Mir16-1 decreases, the PTEN gene leads to inhibition of the pathway PI3K/AKT and thus induces apoptosis [48] (Fig. 13).

Fig. 13.

A schematic representation of the mechanism explored in this study. nanoparticls induce apoptosis in MCF-7 cells by modulating the miR-16-1 and PTEN PI3K/AKT signaling pathways

As a brief review, Tabatabaei et al. used PLGA-PEG NPs as CUR carriers and assessed their cytotoxic effects on MCF-7 BC cells and calu-6 lung cancer cells. CUR-loaded NPs exerted more potent cytotoxic effects compared to free CUR [49]. Azandeh et al. evaluated how PC3 prostate cancer cell lines were influenced by CUR-loaded PLGA NPs and reported similar.

findings. The MTT findings indicated that CUR-loaded PLGA NPs showed heightened anti-tumor activity than free CUR [50]. Also, in another study, Nannan Li et al. showde OB effectively exerts anticancer effects by positively regulating the PTEN gene and then inactivating the PI3K/Akt signaling pathway through down-regulating the expression of the microRNA-221, thereby inducing apoptosis of liver cancer cells [48].

PIP-loaded NPs have high anti-tumor activity. As well as the combined effect of CUR and PIP was studied in some literature approved that combinational treatment of cells using CUR and PIP improved the anti-cancer effect of the compounds [51]. To the best of the authors’ knowledge, there are no studies on the synergistic and cytotoxic effects of CUR and PIP, individually or in combination, on silica-coated MNPs.

In this study, we prepared Fe₃O₄@SiO₂ NPs for more favorable performance of CUR and PIP. The reaction temperature was set at room temperature based on published reports because this temperature provides controlled growth of MNPs, resulting in uniform NPs size. Also, to optimize the deposition of iron oxide NPs and increase the surface functionalization with CUR-PIP, pH = 12 was used, which directly affects the loading efficiency and colloidal stability. Accordingly, we used the co-precipitation method of Fe(II) and Fe(III) at pH = 12 to obtain the smallest possible particle size. In addition, the high speed of the mechanical stirrer and continuous temperature control resulted in the finer size of the NPs [52, 53]. The reproducibility of the synthesized NPs was evaluated by preparing multiple batches under identical conditions for analysis. we charecterized the prepared Fe₃O₄@SiO_2, Fe₃O₄@SiO₂-CUR, Fe₃O₄@SiO₂-PIP, Fe₃O₄@SiO₂-CUR/PIP nanoparticles. FT-IR, XRD and VSM analyses confirm that the structural and morphological features were consistent across different batches. In addition, key physicochemical properties, including particle size, surface functionalization and loading efficiency of CUR and PIP, showed negligible variation between batches. Results indicate that the synthesis protocol is reliable and the NPs demonstrate good batch to batch consistency, supporting the robustness of the experimental procedure [54].

SEM images confirmed the NPs morphology (82 nm for Fe₃O₄@SiO₂-CUR, 80 nm for Fe₃O₄@SiO₂-PIP and 93 nm for Fe₃O₄@SiO₂-CUR/PIP). The average size below 100 nm indicates the success of the synthesis method for NPs. Because despite coating with silica and then functionalize it with two basic drugs, the size of NPs below 100 nm was achieved. This is due to the proper control of temperature, pH, and reaction time during synthesis. EDS and mapping analysis were done in order to elemental analysis of prepared NPs. Elemental analysis showed the presence of N element as well as Fe, O, Si, and C in drug loaded NPs. The appearance of N and C elements in iron oxide NPs is due to incorporation of drugs in Fe₃O₄@SiO₂ NPs.

XRD and FT-IR assays confirmed the CUR and PIP loading on Fe₃O₄@SiO₂ NPs and the structural stability of NPs, and drugs while loading.

The magnetic properties of the NPs were investigated using VSM analysis and super paramagnetic behavior was demonstrated by magnetic diagram without hysteresis loop with high magnetization. Also, reduced saturation magnetization in the synthesized NPs after drug loading is attributed to drug loading and successful functionalization. The decrease in the magnetic properties of NPs upon functionalization with CUR and PIP was very low, indicating the effectiveness of the synthesized NPs in targeted drug delivery. The results show a clear correlation between structural features, surface functionalization and observed magnetic behavior, confirming their suitability for drug delivery applications [55, 56].

However the promising results obtained in the present study, several limitation should be acknowledged. First, the synthesis of silica-coated magnetic iron oxide NPs was performed at a laboratory scale, and the scalability of this process for large-scale production remains a challenge. Factors such as batch-to-batch reproducibility, cost-effectiveness, and process optimization need to be addressed in future studies. In addition, the long-term physicochemical stability of the CUR and PIP loaded NPs was not evaluated over extended periods. Long-term storage stability, potential drug leakage and changes in magnetic and surface properties under physiological conditions warrant further investigation. Addressing these limitation will be essential for advancing the translational potential of the proposed nanocarrier system [57, 58].

CUR and PIP loaded Fe₃O₄@SiO₂ NPs were transferred to the MCF-7 BC cell with good synergistic effect. The MTT Assye findings showed, when Fe₃O₄@SiO₂-CUR and Fe₃O₄@SiO₂-PIP were applied alone on MCF-7 cancer cell lines induced a slight reduction in IC₅₀ cells, however in combination, they markedly decreased the IC₅₀ of cancer cell lines, which shows that CUR and PIP possess a synergistic effect on each other. Also the Real-time PCR results confirmed the synergistic effect of Fe₃O₄@SiO₂-CUR/PIP nanoparticles compared to Fe₃O₄@SiO₂-CUR and Fe₃O₄@SiO₂-PIP nanoparticles in inducing apoptosis. These NPs increase drug solubility and stability, providing conditions for re-assessing the therapeutic effect of drugs because of their significant magnetic effect to deliver CUR and PIP to cancer cells under the magnetic field. CUR and PIP loaded on Fe₃O₄@SiO₂ NPs are applicable to design novel magnetic-based drug delivery systems for treating BC. confirming the effectiveness of Fe₃O₄@SiO₂ NPs loaded with CUR and PIP in vivo studies, they are applicable in a clinical trial.

Conclusion

In this study, Fe₃O₄@SiO₂ Nannoparticles (NPs) loaded with Curcumin (CUR) and Piperine (PIP) were synthesized and characterized with FE-SEM, FT-IR, VSM, XRD, TEM, EDS, Mapping, BET, and zeta potential analysis. The analysis confirmed the effective loading of drugs on Fe₃O₄@SiO₂ core-shell NPs and demonstrated good magnetic activity of NPs. These magnetic NPs loaded with CUR and PIP indicated favorable inhibitory effects on the MCF-7 BC cell line. The combination of CUR and PIP, when loaded onto Fe₃O₄@SiO₂ NPs, exhibited significantly more potent inhibitory effects (resulting in lower drug release) than when the drugs were used alone. Furthermore, the Real-time PCR findings confirmed the synergism effect of Fe₃O₄@SiO₂-CUR/PIP nanoparticles compared to Fe₃O₄@SiO₂-CUR and Fe₃O₄@SiO₂-PIP nanoparticles in inducing apoptosis. These inhibitory effects are time - and dose-dependent. Therefore, using combined CUR- and PIP-loaded Fe₃O₄@SiO₂ NPs could represent an appropriate carrier system for treating BC within the field of magnetic drug delivery system.

Author contributions

**JR: ** Investigation, Writing- Original draft preparation **V: ** Methodology, Resources **ME: ** Supervision, Validation **HZ: ** Supervision, Conceptualization, Writing-Review & Editing **MH: ** project administration, Formal analysis.

Data availability

The nucleotide sequences used in this study were obtained from the NCBI database (https://www.ncbi.nlm.nih.gov/). The primers used for RT-PCR were designed by the authors based on the retrieved NCBI reference sequences.The datasets generated and analyzed during the current study, including raw RT-PCR data and other experimental results, are available from the corresponding author upon reasonable request (Email: mhashemi@iau.ac.ir or drmehashemi@gmail.com).No new sequence data were generated that require deposition in a public repository.

Declarations

Competing interests

The authors declare no competing interests.

Ethical approval

The present study was approved by the ethics committee of the Islamic Azad University, VARAMIN branch, with the code of ethics IR.IAU.VARAMIN.REC.1399.046.

Consent to participate

Not, applicable.

Consent to publish

Not applicable.