Targeting the CCL5/CCR5-PI3K-AKT axis suppresses hepatic stellate cell-induced breast cancer metastasis

Abstract

Background

Breast cancer liver metastasis is a major contributor to cancer-related death; however, the function of hepatic stellate cells (HSCs) in shaping the metastatic microenvironment remains poorly understood. This study investigates how HSC-secreted CCL5 activates the PI3K-AKT pathway via CCR5 to drive breast cancer invasion and metastasis.

Methods

In vitro co-culture models of HSCs with MDA-MB-231 and MCF-7 cells were employed, alongside Transwell migration/invasion assays. Conditioned medium (CM) from activated HSCs was used to assess tumor cell behavior. CCR5 and PI3K-AKT inhibitors (Maraviroc, BKM120) and siRNA-mediated gene silencing were applied to dissect molecular mechanisms. In vivo models, including liver metastasis assays and xenografts using CM-pretreated breast cancer cells, evaluated tumor colonization and growth. Bioinformatics analysis of TCGA data correlated CCL5 expression with clinical outcomes.

Results

Breast cancer cells induced the activation of HSCs, triggering the secretion of CCL5. This HSC-derived CCL5 significantly enhanced tumor cell growth, motility, invasiveness, and epithelial-mesenchymal transition (EMT) by binding to CCR5 and activating the PI3K-AKT pathway. Conversely, silencing CCL5 in HSCs or CCR5 in tumor cells suppressed these malignant behaviors and inhibited PI3K-AKT phosphorylation. In vivo, blocking this axis attenuated tumor growth and liver metastasis. Notably, the anti-tumor effects of CCR5 inhibition were reversed by the PI3K activator 740 Y-P, confirming mechanism specificity. Clinical analysis revealed that elevated CCL5 expression correlates with poor prognosis in breast cancer patients.

Conclusions

This study identifies a critical stromal-tumor signaling loop where the HSC-CCL5/CCR5 axis drives breast cancer metastasis via PI3K-AKT-dependent EMT. Targeting this crosstalk represents a promising therapeutic strategy for preventing liver metastasis.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12935-026-04295-2.

Introduction

Breast cancer (BC) is among the most prevalent malignancies affecting women worldwide and represents a major threat to global female health [1, 2]. Tumor invasion and metastasis remain the primary obstacles in BC management, as therapeutic efficacy is markedly reduced once cancer cells disseminate to adjacent tissues or distant organs [3, 4]. BC invasion and metastasis are characterized by strong invasive capacity, frequent recurrence, and resistance to conventional therapies, which collectively hinder effective disease management. Consequently, elucidating the molecular mechanisms underlying these processes to identify new therapeutic targets and strategies is of substantial clinical importance [5–7].

Hepatic stellate cells (HSCs) are a cell type in the liver that play various essential physiological roles [8]. Recent studies suggest that HSCs may interact with tumor cells by secreting specific cytokines, with CCL5 emerging as a significant regulatory factor of interest [9, 10]. CCL5 is a chemokine that can be secreted by both tumor cells and stromal cells, mediating intercellular interactions within the tumor microenvironment and promoting the invasion and metastasis of breast cancer cells [11, 12]. This study investigates the regulatory mechanisms by which HSC-derived CCL5 modulates BC cell invasion and metastasis, with the goal of elucidating how this newly identified signaling axis influences tumor behavior.

A series of comprehensive experimental methods were employed in this study to investigate the role of HSC-derived CCL5 in BC invasion and metastasis. This included in vitro cell experiments to simulate the growth and migration of BC cells, bioinformatics analysis to aid in interpreting large-scale data, and in vivo experiments to validate findings at the molecular biology level. Together, these experiments were designed to elucidate how the CCL5/CCR5 axis regulates PI3K–AKT signaling and to define its contribution to BC cell invasion and metastatic progression.

The results of this study are expected to provide novel insights into how CCL5 promotes BC cell invasion and metastasis through activation of the PI3K–AKT pathway. These findings will advance the understanding of BC cell behavior and establish a scientific foundation for the development and optimization of therapeutic strategies. Ultimately, this work may contribute to more precise and effective treatments for patients, thereby improving clinical outcomes.

The objective of this study is to systematically examine how HSC-derived CCL5 activates PI3K–AKT signaling via the CCL5/CCR5 axis and to define its role in BC invasion and metastasis. This work establishes a mechanistic foundation for the future development of targeted therapeutic strategies. By advancing the understanding of the molecular programs governing BC dissemination, this study provides important opportunities for improving therapeutic efficacy and patient prognosis.

Materials and methods

Ethical statement

This study strictly adhered to the ethical guidelines and regulations concerning animal experiments and received approval from the Institutional Animal Care and Use Committee (IACUC) of our institution to ensure the rationality and compliance of the experimental protocol (Approval no. 2023-KY-0157-002). All animal experimental procedures were conducted in accordance with humane principles, aiming to minimize animal suffering and distress. All animals were euthanized humanely by exposure to 100% CO₂ in a gradually filled chamber (flow rate: 20–30% of the chamber volume per minute), and maintained in the chamber for at least 1 min after respiration ceased, following the AVMA Guidelines for the Euthanasia of Animals (2020) [13, 14].

Cell culture

Human BC cell lines MCF-7 (HTB-22, ATCC, USA) and MDA-MB-231 (CRM-HTB-26, ATCC, USA; passages F1–F5), as well as the human hepatic stellate cell line LX-2 (Procell, CL-0560), were used in this study. MCF-7 and LX-2 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; R4130, Sigma-Aldrich, USA) supplemented with 10% fetal bovine serum (FBS; F8318, Sigma-Aldrich), 100 U/mL penicillin, and 100 µg/mL streptomycin (V900929, Sigma-Aldrich). MDA-MB-231 cells were maintained in RPMI-1640 medium containing the same supplements. All cell lines were maintained in a 37 °C, 5% CO₂ incubator (Heracell™ Vios 160i CR CO₂ incubator, 51033770, Thermo Scientific™, Germany).

To investigate the impact of the CCL5, CCR5, and PI3K-AKT signaling pathways on BC cells, during the cell culture process, cells were treated with 10 ng/ml CCL5 (MCE, HY-P7282), 100 nM CCR5 antagonist Maraviroc (MCE, HY-13004), and 500 nM of the PI3K inhibitor BKM120 (MCE, HY-70063) were added to the culture medium [15].

Lentivirus construction

A lentiviral short hairpin RNA (shRNA) interference vector (pSIH1-H1-copGFP; SH-, SI501A-1; System Biosciences, USA) was used to generate CCL5 knockdown constructs. Recombinant lentiviral particles were produced by co-transfecting HEK-293T cells (iCell-h237, Sino Biological, China) with the shRNA plasmids using a commercial lentiviral packaging system (A35684CN, Invitrogen, USA). After 48 h, culture supernatants containing lentiviral particles were harvested, filtered through 0.45-µm membranes, and viral titers were quantified using the Lenti-X™ p24 Rapid Titer Kit (Takara, 632200), yielding titers of approximately 1 × 10⁸ TU/mL. The shRNA target sequences for CCL5 were as follows: sh-NC sequence: ATTCGAGGCATCACTACAGAC; SH-CCL5-1: CGTCTTTGTCACCCGAAAGAA; SH-CCL5-2: CCACATCAAGGAGTATTTCTA; SH-CCL5-3 : GTATTTCTACACCAGTGGCAA [16].

For stable CCL5 knockdown, LX-2 or MDA-MB-231 cells were seeded to ~ 50% confluence and transduced with lentiviral particles (1 × 10⁸ IU/mL) at a multiplicity of infection (MOI) of 0.8. After 48 h, transduced cells were selected with puromycin (10 µg/mL; 540222, Sigma-Aldrich, USA) for 48 h and then maintained for at least one week to obtain stable cell populations. Cells were designated as sh-NC, sh-CCL5-1, sh-CCL5-2, or sh-CCL5-3 according to the corresponding lentiviral construct.

For CCR5 knockdown, MDA-MB-231 cells were similarly transduced with lentiviruses expressing CCR5-targeting shRNAs and selected with puromycin under identical conditions. The shRNA sequences were: sh-NC, ATTCGAGGCATCACTACAGAC; sh-CCR5-1, CCAGACATTAAAGATAGTCAT; sh-CCR5-2, GCTCCCTACAACATTGTCCTT; and sh-CCR5-3, GCTTCTGCAAATGCTGTTCTA [17].

Transwell co-culture

In each well of a 6-well plate, 1 × 10⁵ LX-2 cells were seeded alongside 5 × 10⁴ MDA-MB-231 or MCF-7 BC cells in Transwell chambers with a 0.4 μm pore size, placed in corresponding wells in a separate 6-well culture plate. The co-cultures were grouped into three categories: LX-2 monoculture, LX-2 co-cultured with MDA-MB-231 (LX-2 + MDA-MB-231), and LX-2 co-cultured with MCF-7 (LX-2 + MCF-7). Once cells adhered, the medium in both the 6-well plate and the Transwell chambers was discarded, followed by two washes with PBS. The upper and lower chambers were assembled, and a medium containing 0.2% FBS was added (1 ml in the upper chamber, 2 ml in the lower chamber). Co-cultures were maintained for an additional 48 h before collecting approximately 3 ml of the upper and lower chamber fluids, as well as cells from the lower chamber, for subsequent analyses [18].

Bioinformatics analysis

The mixed cell culture media (approximately 1 ml from the upper chamber and 2 ml from the lower chamber) from the Transwell co-culture system after 48 h of incubation were collected. Specifically, 3 ml of the mixed media were obtained from both the LX-2 + MDA-MB-231 (LX-2 + MDA-MB-231) and MDA-MB-231 (MDA-MB-231) monoculture groups, centrifuged, filtered, and set aside. An antibody array containing 80 cytokines was used to analyze cytokines in the two groups of mixed media, wherein factors with |log₂FC| > 1 & P.adj < 0.05 were identified as significantly upregulated.

The bioinformatics analyses were conducted using the Xiantao Academic Online Website. Differential analysis was performed on the BRCA dataset from TCGA (www.cancer.gov/ccg/research/genome-sequencing/tcga), considering |log₂FC| > 1 & P.adj < 0.05 as the criteria for differentially expressed genes (DEGs) selection. Tumor-related gene sets were obtained using the GeneCards database (www.genecards.org) with “Tumor” as the keyword. Venn diagrams, GO/KEGG enrichment analyses, and relevant tools from Xiantao Academic were employed to identify intersecting genes and conduct enrichment analyses.

The log₂FC values of the genes obtained from the differential analysis were subjected to GSEA, and the top five gene sets or pathways were visualized using mountain plots. Correlation analysis between CCL5 or CCR5 and immune infiltration matrices data was performed, and the results were visually presented using lollipop plots [19, 20].

Preparation of conditioned medium (CM)

LX-2 cells (2 × 10⁶) were seeded in 10-cm culture dishes and allowed to adhere overnight. The culture medium was then removed, and cells were gently washed once with serum-free medium. Fresh serum-free medium was subsequently added, and the cells were incubated for an additional 24 h. The conditioned supernatant was collected, centrifuged at 1,000 rpm at 4 °C for 10 min to remove cellular debris, and passed through a 0.22-µm sterile filter. The resulting CM was aliquoted and stored at − 80 °C until further use, as previously described [21].

CCK-8

Cell viability and proliferative capacity were assessed using a CCK-8 assay (CA1210, Solarbio, China). Cells in exponential growth were plated into 96-well plates at a density of 1 × 10⁴ cells per well and allowed to stabilize for 24 h. After experimental treatments or transfection for 48 h, CCK-8 working solution was added to each well, and the plates were incubated at 37 °C. Colorimetric measurements were obtained at 450 nm at 12, 24, 36, and 48 h using a microplate reader. The increase in optical density, reflecting metabolic activity of viable cells, was used to quantify proliferation and to construct growth curves for each experimental group.

Scratch assay experiment

Cells were plated into 12-well plates and cultured until a confluent monolayer was established. A 200 µL pipette tip was used to create a scratch in the middle of the cell layer. Detached cells were removed by gentle PBS rinsing, after which fresh complete medium was added. Phase-contrast images of the wounded areas were captured immediately after scratching (0 h) and again 24 h later at identical positions. The extent of wound closure was quantified to evaluate the migratory capacity of the cells, as previously described [22].

Transwell experiment

Cell invasive ability was evaluated using Matrigel-coated Transwell chambers. Matrigel (356234, Haoyang Biotechnology, China) was thawed at 4 °C and diluted 1:1 with serum-free medium on ice. The diluted matrix (50 µL) was added to the upper inserts and allowed to polymerize at 37 °C to form a reconstituted basement membrane. Cells were harvested, resuspended in serum-free medium, and seeded into the upper chambers, while the lower compartments were filled with medium containing 20% fetal bovine serum as a chemoattractant. After 24 h of incubation at 37 °C, non-invading cells on the upper surface of the membrane were gently removed. Cells that had penetrated to the lower surface were fixed with formaldehyde and stained with 0.1% crystal violet. Invaded cells were visualized and photographed under an inverted microscope, and cell numbers were quantified from at least four randomly selected fields per insert, as previously described [23].

RT-qPCR

Total RNA was isolated from cultured cells using TRIzol reagent (15596026, Thermo Fisher Scientific, USA). RNA integrity and concentration were evaluated spectrophotometrically. Complementary DNA (cDNA) was synthesized from purified RNA using a PrimeScript reverse transcription kit (RR047A, Takara, Japan). Gene-specific primers were designed and synthesized by Takara (Table S1). Quantitative PCR amplification was carried out on a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific) using a standard thermal cycling program. GAPDH served as an internal normalization control. Relative gene expression was calculated using the 2⁻^ΔΔCt method [24].

Western blot (WB)

Total protein was isolated from cells or tissues using RIPA buffer supplemented with protease inhibitor. Lysates were clarified by centrifugation at 4 °C, and protein concentrations were determined by BCA assay (23227, ThermoFisher, USA). Equal amounts of protein were resolved by SDS–PAGE and transferred onto PVDF membranes (Beyotime). Subsequently, the PVDF membrane was incubated overnight at 4 °C with primary antibodies against CCL5 (1:2000, ThermoFisher, 710001), CCR5 (1:500, Abclonal, A20261), α-SMA (1:1000, ab5694, Abcam), COL1A1 (1:1000, ab138492, Abcam), E-cadherin (1:1000, #3195, Cell Signaling Technology), N-cadherin (1:1000, #13116, Cell Signaling Technology), Vimentin (1:1000, #5741, Cell Signaling Technology), PI3K (1:2000, PA5-29220, ThermoFisher), p-PI3K (1:2000, PA5-104853, ThermoFisher), AKT (1:1000, 44609G, ThermoFisher), p-AKT (1:1000, 44621G, ThermoFisher), SNAIL (1:1000, 3879, Cell Signaling Technology), SLUG (1:1000, 9585, Cell Signaling Technology), ZEB1 (1:1000, 70512, Cell Signaling Technology), and GAPDH (ab9485, 1:2500, Abcam, Cambridge, UK) as the loading control. After three washes with TBST for 10 min each, the membrane was incubated with an HRP-conjugated goat anti-rabbit IgG H&L secondary antibody (ab97051, 1:2000, Abcam, Cambridge, UK) for 1 h. Following TBST washing, the membrane was placed on a clean glass plate. ECL fluorescence detection reagents from the Abs920 kit (Aibio, Shanghai, China) were mixed and added to the membrane in a dark room, followed by imaging with the Bio-Rad imaging system (Bio-Rad, USA). Band intensities were quantified using Quantity One software and normalized to GAPDH to determine relative protein expression levels.

Nude mouse BC models

Female BALB/c nude mice (6 weeks old, 16–20 g) were obtained from Vital River Laboratory Animal Technology (Beijing, China) and maintained under specific pathogen–free conditions with controlled temperature and humidity. After one week of acclimatization, all experimental procedures were conducted in accordance with institutional guidelines and approved by the Animal Ethics Committee.

To simulate the liver metastatic microenvironment, LX-2 hepatic stellate cells were combined with MDA-MB-231 BC cells at a 1:1 ratio and used to generate liver metastasis models via tail vein injection. To investigate the impact of soluble factors secreted by HSCs on tumor tumorigenicity, MDA-MB-231 cells were pretreated with LX-2 derived CM for 48 h prior to orthotopic implantation. Mice were assigned to the following experimental groups (n = 6 per group): (1) Independent implantation of MDA-MB-231 cells and co-implantation of LX-2 with MDA-MB-231 cells (LX-2 + MDA-MB-231); (2) Co-implantation of LX-2 cells infected with SH-NC lentivirus with MDA-MB-231 cells (SH-NC-L + M), co-implantation of LX-2 cells infected with SH-CCL5 lentivirus with MDA-MB-231 cells (SH-CCL5-L + M), and co-implantation of sh-NC–infected LX-2 cells with MDA-MB-231 cells combined with treatment using the PI3K pathway inhibitor BKM120 (SH-NC-L + M+BKM120). BKM120 was administered orally at a dose of 60 mg/kg/day [25]; (3) Co-implantation of LX-2 cells with MDA-MB-231 cells infected with SH-NC lentivirus (L + SH-NC-M), co-implantation of LX-2 cells with MDA-MB-231 cells infected with SH-CCR5 lentivirus (L + SH-CCR5-M), co-implantation of LX-2 cells with sh-NC–infected MDA-MB-231 cells combined with BKM120 treatment (L + SH-NC-M+BKM120), co-implantation of LX-2 cells with sh-NC–infected MDA-MB-231 cells combined with the PI3K pathway activator 740 Y-P (L + SH-NC-M + 740 Y-P), and co-implantation of LX-2 cells with sh-CCR5–infected MDA-MB-231 cells combined with 740 Y-P treatment (L + SH-CCR5-M + 740 Y-P). The PI3K activator 740 Y-P (MCE, HY-P0175) was administered intraperitoneally at 10 mg/kg/day [26].

For subcutaneous tumor formation, prepared cell mixtures were adjusted to 2 × 10⁷ cells/mL and 200 µL was inoculated into the axillary region of nude mice. Animals were maintained under SPF conditions, and tumors were harvested on day 36 after implantation for evaluation of tumor burden and lymphatic dissemination following CO₂ euthanasia.

For orthotopic tumor establishment, 200 µL of cell suspension containing 2 × 10⁷ cells, or BC cells pretreated with CM for 48 h, were injected into the mammary tissue of nude mice. Tumor growth and dissemination were evaluated four weeks after implantation using an IVIS Lumina XR in vivo imaging system (PerkinElmer, USA).

For the experimental metastasis model, 0.2 mL of cell suspension (2 × 10⁷ cells) from each group was administered via tail vein injection. Mice were euthanized 36 days later by CO₂ asphyxiation, and the liver, lungs, bones, and lymph nodes were excised. Hematoxylin and eosin (H&E) staining was performed to quantify the average number of metastatic lesions [27].

H&E staining

Liver specimens from the nude mouse metastasis model were fixed in 10% neutral buffered formalin, dehydrated through graded ethanol, cleared, paraffin-embedded, and sectioned. Histological staining was performed using an H&E staining kit (PT001, Bogu Bio-Technology, Shanghai, China). Tissue sections were stained with hematoxylin for 10 min, differentiated in 1% acid alcohol for 30 s, and blued in water for 5 min before counterstaining with eosin for 1 min. Slides were sequentially dehydrated in 70%, 80%, 90%, 95%, and 100% ethanol for 1 min each, followed by clearing in xylene and mounting with neutral resin. Histopathological alterations in liver tissues were examined and photographed using an Olympus BX50 optical microscope (Olympus, Tokyo, Japan) [28].

Statistical analysis

All statistical analyses were performed using SPSS software (version 21.0; IBM, USA). Quantitative data are expressed as mean ± standard deviation (SD). For normally distributed variables, comparisons between two groups were carried out using the unpaired Student’s t test, whereas comparisons among three or more groups were conducted by one-way analysis of variance (ANOVA) followed by Tukey’s multiple-comparison test. When data did not conform to a normal distribution, the Mann–Whitney U test or the Kruskal–Wallis H test was applied as appropriate. Overall survival was evaluated by the Kaplan–Meier method, and differences between survival curves were determined using the log-rank test. Correlations between variables were assessed using Spearman’s rank correlation coefficient. All statistical tests were two-sided, and a P-value < 0.05 was considered to indicate statistical significance.

Results

BC cells activate HSCs LX-2 and promote their phenotypic transformation

Using human hepatic stellate cells (LX-2) and BC cell lines (MDA-MB-231 and MCF-7), we established a Transwell-based co-culture system to examine tumor–stromal interactions. Notably, co-culture with BC cells induced pronounced morphological alterations in LX-2 cells (Fig. 1A). Additionally, the mRNA and protein expression levels of activation markers α-SMA and COL1A1 in LX-2 cells significantly increased (Fig. 1B-C).

Fig. 1.

Activation of LX-2 Cells after Co-Culture with Breast Cancer Cells. Note: (A) Morphological changes of LX-2 cells after 48 h of co-culture with breast cancer cells, characterized by increased cell dispersion and elongated protrusions, indicative of an activated phenotype (scale bar: 50 μm), LX-2 represents the group of LX-2 cells cultured alone; (B) Changes in mRNA expression of activation markers α-SMA and COL1A1 in LX-2 cells; (C) Changes in protein expression of activation markers α-SMA and COL1A1 in LX-2 cells along with statistical analysis. * P < 0.05; all cell experiments were repeated three times

The results demonstrate that BC cells can activate HSCs LX-2, leading to their phenotypic transformation into MFB-like cells.

Activated LX-2 cells facilitate the proliferation, migration, and invasion of BC cells, inducing EMT

To assess how activated LX-2 cells influence BC behavior, CM derived from activated LX-2 cultures was applied to MDA-MB-231 and MCF-7 cells. Exposure to LX-2–derived CM markedly increased tumor cell growth, as determined by CCK-8 analysis (Fig. 2A). In parallel, wound-healing assays showed accelerated motility of both cell lines in CM-treated conditions (Fig. 2B–C). Consistently, Transwell assays revealed a pronounced rise in invasive activity in response to CM stimulation (Fig. 2D).

Fig. 2.

Activated LX-2 Cells Influence Proliferation, Migration, Invasion, and EMT of Breast Cancer Cells. Note: (A) CCK-8 experiment to assess the proliferation capacity of breast cancer cell lines MDA-MB-231 and MCF-7; 100 µL of conditioned medium (CM) per well; (B-C) Scratch assay to evaluate the migration ability of cells in each group with statistical representation (scale bar: 100 μm); 2 mL of CM per well; (D) Transwell assay to measure the invasion ability of cells in each group (scale bar: 50 μm); 200 µL of CM per well; (E) Morphological changes of cells in each group after culture in 2 mL of CM, showing a transition from an epithelial-like to a mesenchymal-like phenotype (scale bar: 50 μm); (F) WB analysis to detect the expression changes of EMT marker proteins E-cadherin, N-cadherin, and Vimentin; 2 mL of CM per well. CM: condition medium. *P < 0.05, and all cell experiments were performed in triplicate

EMT is a critical driver of BC dissemination and disease progression, profoundly affecting patient survival [29]. Under CM medium conditions, morphological changes were observed in MDA-MB-231 and MCF-7 cells, accompanied by a significant decrease in E-cadherin protein expression and a notable increase in N-cadherin and Vimentin protein expression (Fig. 2E-F). These EMT-associated changes were reproducible in MDA-MB-231 subclones at both early (F1) and late (F5) passages, where CM exposure similarly suppressed E-cadherin while increasing N-cadherin and vimentin expression, indicating that LX-2–mediated EMT induction is stable across distinct tumor cell populations (Figure S1A). In addition, WB analysis further revealed that CM stimulation significantly upregulated the EMT-driving transcription factors ZEB1, SLUG, and SNAIL, further supporting activation of an EMT program in BC cells (Figure S1B).

In summary, activated LX-2 cells promote BC growth, migration, invasion, and EMT.

In vivo experiments confirmed that LX-2 cells promote the tumorigenesis of BC cells

To determine the in vivo relevance of LX-2–mediated effects, subcutaneous, orthotopic, and liver metastasis mouse models were generated. Mice receiving co-implants of MDA-MB-231 and LX-2 cells at a 1:1 ratio constituted the experimental cohort, whereas animals injected with MDA-MB-231 cells alone served as controls.

To evaluate the effect of HSC-secreted factors on tumorigenicity, MDA-MB-231 cells were pretreated with LX-2 CM and implanted orthotopically. The CM-pretreated group exhibited a markedly increased tumor burden compared to controls, as indicated by bioluminescence imaging signal intensity (Fig. 3A). Furthermore, analysis of metastatic dissemination in the tail-vein model revealed a pronounced increase in axillary lymph node and liver metastases in mice bearing LX-2–MDA-MB-231 co-implants relative to controls (Fig. 3B-D). Simultaneously, co-implantation with LX-2 cells markedly accelerated tumor expansion in both subcutaneous and orthotopic models (Figure S2A-B). In addition, metastatic burden in other common target organs, including the lung, bone, and lymph nodes, was significantly elevated in the LX-2 + MDA group (Figure S2C). Together, these findings demonstrate that LX-2 cells strongly enhance BC tumor growth and metastatic spread in vivo.

Fig. 3.

LX-2 Cells Promote Tumorigenesis of Breast Cancer Cells In Vivo. Note: (A) Representative bioluminescence images (left) and quantification of average bioluminescent signal (right) of orthotopic xenografts in nude mice implanted with MDA-MB-231 cells pretreated with conditioned medium (CM) or control medium; (B) Statistics on the number of axillary lymph node metastases in nude mice in each group, LN=Lymph node; (C) Statistical analysis of average liver metastases in each group of nude mice; (D) Detection of liver metastases in nude mice in each group using H&E staining(scale bar: 200 μm), black arrows indicate the liver metastasis area. *P < 0.05, with 6 nude mice in each group

CCL5 is a major stromal-derived factor in the LX-2–BC co-culture system

To identify soluble mediators responsible for LX-2–induced malignant phenotypes, conditioned media were collected from Transwell co-cultures of LX-2 and MDA-MB-231 cells after 48 h, while media from MDA-MB-231 monocultures served as controls. Cytokine profiling using an 80-plex antibody array revealed that multiple factors, including RANTES (CCL5), IGFBP-6, TNF-β, MIP-1α, IL-7, PDGF-AA, IL-13, EGFR, and MCP-1, were significantly elevated in the co-culture system. Among these, CCL5 exhibited the most prominent increase (Table 1). To further determine the cellular source of the elevated CCL5 in the culture medium, three shRNAs targeting CCL5 were designed, and stable CCL5-knockdown LX-2 and MDA cell lines were generated via lentiviral infection. RT-qPCR and WB analyses demonstrated that sh-CCL5-1 exhibited the highest knockdown efficiency at both the mRNA and protein levels (Figure S3). Therefore, sh-CCL5-1 was selected for subsequent experiments. The samples were then divided into two groups. In one group, LX-2 cells before and after CCL5 knockdown were co-cultured with MDA cells (shCCL5-LX-2 + MDA and shNC-LX-2 + MDA). In the other group, MDA cells before and after CCL5 knockdown were co-cultured with LX-2 cells (LX-2 + shCCL5-MDA and LX-2 + shNC-MDA). The levels of CCL5 in the culture medium were measured accordingly. The results showed that only knockdown of CCL5 in LX-2 cells significantly reduced the CCL5 level in the culture medium (Tables 2 and 3), indicating that CCL5 was predominantly derived from LX-2 cells.

Table 1.

LX-2 + MDA co-culture system compared to MDA alone culture system upregulates cytokines

Cytokine	Cytokine concentration (pg/ml) (mean)		Ratio	P-value
	MDA	LX-2 + MDA
RANTES (CCL5)	195.57	2187.99	11.18	0.01
IGFBP-6	394.75	2075.42	5.26	0.02
TNF-β	8.20	57.80	7.05	0.02
MIP-1α	0.69	2.09	3.03	0.02
IL-7	13.26	30.21	2.28	0.00
PDGF-AA	171.20	382.29	2.23	0.00
IL-13	28.74	48.02	1.67	0.01
EGF R	93.74	139.77	1.49	0.01
MCP-1	488.75	686.74	1.41	0.00

Table 2.

shCCL5-LX-2 + MDA co-culture system compared to shNC-LX-2 + MDA culture system

Cytokine	Cytokine concentration (pg/ml) (mean)		Ratio	P-value
	shCCL5-LX-2 + MDA	shNC-LX-2 + MDA
RANTES (CCL5)	50.68	2251.89	44.43	0.003

Table 3.

LX-2 + shCCL5-MDA co-culture system compared to LX-2 + shNC-MDA culture system

Cytokine	Cytokine concentration (pg/ml) (mean)		Ratio	P-value
	LX-2 + shCCL5-MDA	LX-2 + shNC-MDA
RANTES (CCL5)	2355.99	2509.59	1.07	ns

The cytokines identified as differentially expressed in the antibody array were further analyzed by Gene Ontology and KEGG pathway enrichment using DAVID Bioinformatics Resources 6.8. Functional annotation revealed that these upregulated factors were predominantly associated with cytokine–cytokine receptor interaction networks (Figure S4A–C) and were strongly linked to activation of the PI3K–AKT signaling cascade (Figure S4D).

Next, transcriptome data of breast cancer (BRCA) from the TCGA database were obtained through the online platform Xiantao Academic. Patients were stratified into CCL5-high (n = 557) and CCL5-low (n = 556) groups according to CCL5 expression in tumor tissues. Differential expression analysis identified 1,685 upregulated and 3,984 downregulated genes between the two groups (Fig. 4 A). Subsequently, gene set enrichment analysis (GSEA) further demonstrated that tumors with elevated CCL5 expression were significantly enriched for multiple oncogenic signaling pathways, prominently including the PI3K–AKT cascade (Fig. 4B). Clinically, high CCL5 levels were associated with unfavorable outcomes, as patients in the CCL5-high cohort exhibited significantly reduced overall survival (OS), disease-specific survival (DSS), and progression-free interval (PFI) (Fig. 4 C). Further analysis revealed that CCL5 expression was significantly higher in progesterone receptor (PR)-negative and estrogen receptor (ER)-negative BC patients. Moreover, CCL5 expression was highest in the more immunogenic and aggressive HER2-enriched and Basal subtypes, and lowest in the Luminal A subtype (Fig. 4D). These data indicate that elevated CCL5 expression correlates with a more invasive and biologically aggressive BC phenotype.

Fig. 4.

Bioinformatics Analysis of Public Breast Cancer Datasets based on CCL5 Expression Levels. Note: (A) Volcano plot of differential gene expression analysis of breast cancer transcriptomic data from the TCGA database, stratified by high and low CCL5 expression levels (Low = 556, High = 557); (B) Gene set enrichment analysis (GSEA) of signaling pathways based on high versus low CCL5 expression; (C) Survival analysis of breast cancer patients stratified by CCL5 expression levels; (D) CCL5 expression levels in breast cancer according to ER/PR status and molecular subtypes. **P < 0.01, ***P < 0.001

In addition, differential expression analysis between normal and tumor samples was performed using the criteria of |log₂FC| > 1 and adjusted P < 0.05, resulting in the identification of 5,065 DEGs, including 3,146 significantly upregulated and 1,919 significantly downregulated genes (Figure S5A). Using the keyword “Tumor” and retrieving genes with a Relevance score > 10 from the Gene Cards database, a Venn diagram analysis was conducted to identify 248 DEGs related to tumors (Figure S5B). GO/KEGG enrichment analysis of these 248 DEGs revealed enrichment in cellular proliferation-related biological processes such as gland development, epithelial cell proliferation, and regulation of epithelial cell proliferation, as well as in membrane-related cellular components like membrane raft, membrane microdomain, and external side of plasma membrane. Moreover, functions related to transmembrane receptor proteins and pathways such as Transcriptional misregulation in cancer, Proteoglycans in cancer, and PI3K-Akt signaling pathway were enriched (Figure S5C-D).

GSEA enrichment analysis of all genes and their log2FC values in the dataset showed that cell cycle- and proliferation-related gene sets or pathways such as ASSEMBLY_OF_THE_ORC_COMPLEX_AT_THE_ORIGIN_OF_REPLICATION, SIRT1_NEGATIVELY_REGULATES_RRNA_EXPRESSION, DNA_DAMAGE_TELOMERE_STRESS_INDUCED_SENESCENCE, DNA_METHYLATION, and CONDENSATION_OF_PROPHASE_CHROMOSOMES were enriched in the Tumor group (Figure S5E). Both unpaired and matched tumor–normal comparisons demonstrated a significant elevation of CCL5 expression in BC tissues (Figure S5F-G). Additionally, immune infiltration analysis revealed a strong correlation between CCL5 and most immune cells (Figure S5H).

Based on these observations, we propose that CCL5 represents a key stromal-derived mediator through which LX-2 cells modulate BC malignancy, with PI3K–AKT signaling functioning as a central downstream pathway in this regulatory network.

LX-2–derived CCL5 drives BC cell proliferation, migration, and invasion

To determine whether CCL5 mediates the tumor-promoting effects of LX-2 cells, BC cells were exposed to conditioned media derived from LX-2 cells transduced with control or CCL5-targeting lentiviral constructs (Fig. 5A). Suppression of CCL5 in LX-2 cells markedly attenuated the proliferative capacity of both MDA-MB-231 and MCF-7 cells, whereas supplementation with recombinant CCL5 restored cell growth (Fig. 5B). Consistent with these findings, wound-healing assays showed that LX-2–derived CCL5 depletion significantly impaired BC cell motility, while exogenous CCL5 enhanced migratory activity (Fig. 5C). Similarly, Transwell analysis revealed a substantial reduction in invasion in the sh-CCL5 condition, which was reversed by CCL5 treatment (Fig. 5D). At the molecular level, knockdown of CCL5 in LX-2 cells resulted in increased E-cadherin and decreased N-cadherin and vimentin expression, accompanied by reduced phosphorylation of PI3K and AKT. These alterations were largely abrogated following CCL5 supplementation (Fig. 4E).

Fig. 5.

Influence of LX-2 Cells on MDA-MB-231 Cells through CCL5. Note: (A) Schematic representation of the cell experiment process; (B) CCK-8 experiment assessing changes in cell proliferation in each group; 100 µL of conditioned medium (CM) per well; (C) Scratch assay examining cell migration ability in each group with statistical analysis (scale bar: 100 μm); 2 mL of CM per well; (D) Transwell assay measuring cell invasion ability in each group (scale bar: 50 μm); 200 µL of CM per well; (E) WB analysis of EMT marker proteins E-cadherin, N-cadherin, and Vimentin, and PI3K-AKT pathway protein expression changes; 2 mL of CM per well. CM: condition medium.*P < 0.05, with all cell experiments repeated three times

In summary, the above findings suggest that LX-2–derived CCL5 promotes BC aggressiveness through the PI3K–AKT pathway.

CCR5 and PI3K–AKT signaling are essential for BC cell proliferation and invasion

The high-affinity receptor CCR5 for CCL5 belongs to the family of 7-transmembrane proteins linked to G-proteins. Upon binding of CCL5 to CCR5, G-proteins are activated, leading to the subsequent activation of protein kinase C, triggering downstream signaling cascades [30]. Accumulating evidence indicates that the CCL5/CCR5 signaling axis plays a critical role in tumor progression. Activation of CCR5 by its ligand CCL5 stimulates the PI3K–AKT pathway, thereby enhancing tumor cell proliferation and facilitating invasive and metastatic behavior [31]. Notably, although CCR5 is expressed by only a fraction of BC cells in primary tumors, its prevalence increases dramatically at metastatic sites, where CCR5-positive cells are enriched by approximately eightfold [32]. This phenomenon may be linked to the microenvironment of metastatic sites and the heightened invasiveness of tumor cells undergoing metastasis.

Analysis of non-paired and paired differential expression of CCR5 in the samples consistently demonstrated significant upregulation of CCR5 in tumor samples, similar to CCL5 (Figure S6A-B). Furthermore, immune infiltration profiling showed that CCR5 levels were strongly associated with the abundance of multiple immune cell populations (Figure S6C).

To interrogate the functional contribution of CCR5 and PI3K–AKT signaling to CCL5-driven malignancy, BC cells were exposed to recombinant CCL5 in the presence of either the CCR5 antagonist Maraviroc or the PI3K inhibitor BKM120. Blockade of CCR5 or PI3K–AKT signaling markedly suppressed tumor cell proliferation, as assessed by CCK-8 analysis (Fig. 6A). Consistently, inhibition of either CCR5 or PI3K significantly impaired BC cell motility and invasive capacity, as shown by wound-healing and Transwell assays (Fig. 6B). At the molecular level, pharmacological blockade resulted in restoration of epithelial characteristics, with increased E-cadherin and reduced N-cadherin and vimentin expression. Notably, CCR5 inhibition also attenuated PI3K–AKT pathway activation, indicating that CCR5 functions upstream of PI3K–AKT in mediating CCL5 signaling (Fig. 6D).

Fig. 6.

Impact of CCR5 and PI3K-AKT Pathway Inhibition on MDA-MB-231 Cells. Note: (A) CCK-8 experiment evaluating changes in cell proliferation in each group; (B) Scratch assay assessing cell migration ability in each group with statistical representation (scale bar: 100 μm); (C) Transwell assay measuring cell invasion ability in each group (scale bar: 50 μm); (D) WB analysis of EMT marker proteins E-cadherin, N-cadherin, and Vimentin, and PI3K-AKT pathway protein expression changes. *P < 0.05, with all cell experiments repeated three times

In summary, the above results suggest that CCL5-dependent CCR5 signaling activates PI3K–AKT to enhance BC cell growth and motility.

Targeting the CCL5/CCR5 axis suppresses liver metastasis and tumor growth in an HSC-rich microenvironment

To evaluate the in vivo role of the CCL5/CCR5 axis in BC progression, particularly in the context of liver colonization where tumor cells interact with hepatic stellate cells, we established liver metastasis models. Additionally, to mechanistically dissect the interaction between LX-2 cells and MDA-MB-231 cells in a controlled in vivo setting, subcutaneous and orthotopic co-implantation models were utilized. Tumors were generated by co-implanting LX-2 cells and MDA-MB-231 cells at a 1:1 ratio. Mice were assigned to receive CCL5-silenced LX-2 cells together with MDA-MB-231 cells (SH-CCL5-L + M group), or control LX-2 cells combined with MDA-MB-231 cells and treatment with the PI3K inhibitor BKM120 (SH-NC-L + M+BKM120 group). Animals implanted with sh-NC-infected LX-2 cells together with MDA-MB-231 cells served as the control cohort (SH-NC-L + M group).

Crucially, in the experimental metastasis model which physiologically reflects the interaction between breast cancer cells and the liver stroma, a notable decrease in metastatic occurrences in the SH-CCL5-L + M and SH-NC-L + M+BKM120 groups compared to the SH-NC-L + M group (Fig. 7A). Consistent with these metastatic findings, in the co-implantation models designed to mimic the stromal-tumor signaling loop, tumor growth was significantly reduced in the SH-CCL5-L + M and SH-NC-L + M+BKM120 groups compared with the SH-NC-L + M control group (Fig. 7D). WB results indicated a reduction in the phosphorylation levels of PI3K and AKT following CCL5 silencing (Fig. 7F).

Fig. 7.

Targeting the CCL5/CCR5 Axis Inhibits HSC-Induced Breast Cancer Liver Metastasis and Tumor Growth. Note: (A-B) Statistics on the number of axillary lymph node metastases (A) and liver metastatic foci (B) in nude mice from the CCL5-silencing experiment; (C) H&E staining of liver tissues to assess metastatic lesions in the CCL5-silencing experiment (scale bar: 200 μm), black arrows indicate metastatic areas; (D) Representative images (left) and volume analysis (right) of subcutaneous xenograft tumors in the CCL5-silencing experiment; (E) Representative bioluminescence images (left) and average signal intensity (right) of orthotopic xenografts in the CCL5-silencing experiment; (F) Western blot analysis of PI3K and AKT phosphorylation levels in tumor tissues from the CCL5-silencing experiment; (G-H) Statistics on the number of axillary lymph node metastases (G) and liver metastatic foci (H) in nude mice from the CCR5-silencing experiment; (I) H&E staining of liver tissues to assess metastatic lesions in the CCR5-silencing experiment (scale bar: 200 μm), black arrows indicate metastatic areas; (J) Representative images (left) and volume analysis (right) of subcutaneous xenograft tumors in the CCR5-silencing experiment; (K) Representative bioluminescence images (left) and average signal intensity (right) of orthotopic xenografts in the CCR5-silencing experiment; (L) Western blot analysis of PI3K and AKT phosphorylation levels in tumor tissues from the CCR5-silencing experiment. * P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, with 6 nude mice in each group

Similarly, a stable CCR5-silenced MDA-MB-231 cell line was established using lentivirus, and the most efficient silencing, SH-CCR5-1, was selected for subsequent experiments after validation through RT-qPCR and WB analysis (Figure S7A-C). Nude mouse models were then established by co-implanting LX-2 cells with CCR5-knockdown MDA-MB-231 cells (L + SH-CCR5-M group), or by co-implanting LX-2 cells with sh-NC–infected MDA-MB-231 cells combined with treatment using the PI3K pathway inhibitor BKM120 (L + SH-NC-M+BKM120 group). LX-2 cells and MDA-MB-231 cells were mixed at a 1:1 ratio for implantation, and mice co-implanted with LX-2 cells and sh-NC-infected MDA-MB-231 cells served as the control group (L + SH-NC-M group).

Relative to the L + SH-NC-M group, liver metastatic burdens were significantly reduced in the L + SH-CCR5-M group (Fig. 7G). Furthermore, both subcutaneous and orthotopic tumor growth were markedly suppressed in the L + SH-CCR5-M group (Fig. 7J), supporting the critical role of CCR5 in mediating stromal-dependent tumor expansion. WB results showed decreased PI3K and AKT phosphorylation in tumors from the L + SH-CCR5-M group, indicating inhibition of PI3K–AKT signaling following CCR5 silencing (Fig. 7L).

To determine whether CCR5 regulates tumor growth through PI3K–AKT signaling, subcutaneous and orthotopic xenograft assays were conducted in CCR5-silenced MDA-MB-231 cells in the presence or absence of the PI3K–AKT activator 740 Y-P. Reactivation of PI3K–AKT signaling by 740 Y-P largely rescued the impaired tumorigenic capacity of CCR5-depleted cells (Figure S8), demonstrating that CCR5 drives BC growth through PI3K–AKT pathway activation.

In conclusion, the experiments highlight that LX-2 cells impact BC growth and metastasis by activating the CCL5/CCR5 axis, influencing the PI3K-AKT signaling pathway.

Discussion

BC is one of the most prevalent malignancies in women, and its invasive and metastatic behavior is the primary cause of cancer-related death [33–35]. Within the tumor microenvironment, cell interactions and molecular signaling pathways play pivotal roles in the development of BC [36–38]. HSCs represent a crucial component in the liver, and recent studies indicate their significant regulatory role in tumor progression [39, 40]. Using integrated in vitro and in vivo models together with bioinformatic analyses, we dissected how hepatic stellate cell–derived CCL5 regulates BC invasion and metastasis (Fig. 8). Our data reveal that activated hepatic stellate cells markedly stimulate BC cell proliferation, motility, and invasiveness through a CCL5-driven activation of PI3K–AKT signaling. Pharmacological blockade of CCR5 or PI3K–AKT effectively abolished these pro-tumorigenic effects, underscoring the functional importance of this signaling axis. These conclusions were further supported by in vivo evidence, where elevated CCL5 expression and enhanced PI3K–AKT activity were associated with accelerated tumor growth and metastatic dissemination.

Fig. 8.

CCL5 Derived from HSCs Activates the PI3K-AKT Pathway through the CCL5/CCR5 Axis to Promote the Invasion and Metastasis of Breast Cancer Cells

This study integrates in vitro and in vivo experimental systems with comprehensive bioinformatic analyses to define the role of hepatic stellate cell–derived CCL5 in BC invasion and metastasis. Through systematic multi-omics analyses and experimental validations, we have extensively researched this crucial mechanism, providing a solid foundation for future in-depth explorations. In the experimental design phase, a series of in vitro and in vivo experiments were carefully arranged to simulate the growth and migration processes of BC cells while utilizing bioinformatics tools for data analysis and integration. This comprehensive research strategy has enabled us to fully comprehend the mechanisms by which HSC-derived CCL5 promotes BC cell invasion and metastasis, shedding light on the relevant signaling pathways and regulatory mechanisms. By leveraging integrated multi-omics analyses, we delineated the role of CCL5 in regulating BC cell proliferation, motility, and invasiveness, while simultaneously confirming activation of key pathways such as PI3K–AKT. These results provide strong evidence that HSC-derived CCL5 is a critical driver of BC progression and establish a solid foundation for future mechanistic and translational studies.

In cell-based assays, CCL5 was found to markedly enhance BC cell proliferation, migration, and invasion, accompanied by activation of the PI3K–AKT signaling pathway. These observations are consistent with prior reports and further underscore the pivotal role of CCL5 in driving BC invasion and metastasis, while also highlighting new avenues for investigating its downstream signaling networks.

Using co-implantation models of LX-2 cells and BC cells, our in vivo studies further confirmed that activation of the CCL5/CCR5 axis drives tumor growth and metastatic dissemination through PI3K–AKT signaling. These findings mirror our in vitro observations and highlight the therapeutic potential of targeting this pathway to restrain BC progression.

Our study reveals a novel mechanism whereby HSC-derived CCL5 activates the PI3K-AKT pathway through the CCL5/CCR5 axis, promoting BC cell invasion and metastasis. This discovery is crucial for devising more effective targeted treatment strategies and opening up new avenues for personalized therapy in BC. Furthermore, our research findings offer new directions and hope for the field of BC treatment and clinical practice.

Despite the strengths of this study, several limitations should be acknowledged. First and foremost, while we utilized co-implantation models to investigate the interaction between HSCs and BC cells, it is important to note that HSCs are liver-resident cells. Therefore, their direct interaction with breast cancer cells primarily occurs in the context of liver metastasis, rather than in the primary mammary tumor. Consequently, our findings regarding primary orthotopic tumor growth should be interpreted as a mechanistic exploration of stromal support via soluble factors (validated by our CM-pretreatment assays) rather than a physiological recapitulation of the primary breast microenvironment. In addition, although both in vitro and in vivo models were employed to simulate interactions between BC cells and hepatic stellate cells, these systems cannot fully capture the complexity of the human tumor microenvironment. Continued efforts using more physiologically relevant models will be essential to refine these findings and facilitate their translational application. The roles of the CCL5/CCR5 axis and PI3K-AKT pathway in various cell types and biological processes suggest a potentially more intricate mechanism in BC metastasis than currently understood. While identifying potential therapeutic targets, the clinical efficacy and safety of CCR5 antagonists and PI3K-AKT pathway inhibitors still require further investigation. In addition, the mechanisms by which BC cells activate HSCs remain to be further elucidated. According to existing literature, tumor cells can modulate HSC activity through exosome-encapsulated noncoding RNAs that they secrete [41]. Tumor cells may also influence HSC activity indirectly via signaling proteins displayed on the surface of tumor-derived exosomes that interact with corresponding receptors on HSCs [42]. Moreover, tumor cells secrete a variety of cytokines that may act on HSCs and thereby affect their activation status. Finally, we acknowledge the importance of employing immunocompetent mouse models to more faithfully recapitulate the physiological tumor microenvironment and immune–tumor interactions. However, owing to experimental constraints, such models were not included in the present study. Future investigations will incorporate immunocompetent models to further validate and extend our findings.

In summary, by integrating in vitro and in vivo experiments with bioinformatic analyses, this study reveals a critical role for HSC-derived CCL5 in driving BC metastasis and delineates the underlying CCL5/CCR5–PI3K–AKT signaling mechanism. These findings highlight the therapeutic potential of targeting this axis and warrant further investigation to validate its clinical relevance and translational applicability in BC management.

Author contributions

H.H. conceived and designed the study; performed the experiments; analyzed the data; drafted and revised the manuscript; supervised the study; reviewed and approved the final version of the manuscript.

Funding

This study was supported by Henan Science and Technology Project 232102311100.

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

This study strictly adhered to the ethical guidelines and regulations concerning animal experiments and received approval from the Institutional Animal Care and Use Committee (IACUC) of Affiliated Cancer Hospital of Zhengzhou University to ensure the rationality and compliance of the experimental protocol (Approval no. 2023-KY-0157-002). Clinical trial number: not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.