Human α-galactosidase A is stimulated by folic acid supplementation – possible implications in Fabry disease management

Sabiha Khatoon; Mohammed A Junaid

doi:10.1371/journal.pone.0351438

. 2026 Jun 10;21(6):e0351438. doi: 10.1371/journal.pone.0351438

Human α-galactosidase A is stimulated by folic acid supplementation – possible implications in Fabry disease management

Sabiha Khatoon ¹, Mohammed A Junaid ^1,^*

Editor: Tatsuo Shimosawa²

PMCID: PMC13252739 PMID: 42268866

Abstract

Fabry disease (FD) in an inherited lysosomal storage disorder with severe lifelong issues if not therapeutically managed. The disorder results from mutation in the gene GLA causing the deficiency of lysosomal enzyme α-galactosidase A (AGLA) leading to accumulation of specific glycosphingolipids in several organs. Individuals suffering from FD are treated with either an enzyme replacement therapy providing injected recombinant enzyme or small molecule chaperone therapy through a specific inhibitor, 1-deoxygalactonojiromycin (DGJ), which allows partial folding of functional enzyme that is retained as misfolded protein consequent to mutations. These therapies suggest that any incremental increase in AGLA activity will be of benefit to individuals with FD. This study is aimed at providing evidence that the synthetic B-complex vitamin, folic acid (FA) necessary in preventing neural tube defects in babies, can significantly stimulate the expression and enzyme activity in human lymphoblastoid cells as well as recombinant AGLA, in a concentration dependent manner. The extent of FA mediated AGLA stimulation was similar in cells from male or female subjects. In the recombinant enzyme, the stimulation follows mixed type with increase in Vmax but without any effect on Km. We did not find any evidence of cytosine methylation in one CpG island in the GLA gene. FA also stimulated and protected AGLA activity that was inhibited with specific inhibitor, DGJ. FA was able to further stimulate DGJ mediated restoration of AGLA activity in lymphoblastoid cells from individual with FD. Such FA mediated stimulation of AGLA activity may offer benefit to individuals with FD.

Introduction

Fabry disease (FD) is an inherited disorder with severe lifelong manifestations due to accumulating glycosphingolipids in several tissues and organs [1]. FD is one of the lysosomal storage disorders marked by a severe deficiency of the lysosomal catabolic enzyme α-galactosidase A (AGLA) EC:3.2.1.22, arising from over 750 different mutations identified in the GLA gene so far [2,3]. This gene is located on the long arm of X-chromosome (chrX:101,393,273–101,408,012). Accumulation of specific lipids begins at birth in affected individuals, and continues throughout the lifespan, resulting in diverse signs and symptoms associated with the FD. Reduced life expectancy of males and females of 58.2 and 74.7 years respectively has been reported for people suffering from FD [4]. Earlier, a prevalence of FD was reported to be 1 in 40000–117000 worldwide, however, recent estimates based on largescale screening of neonates indicated prevalence of 1 in 3700 males in certain populations [5–7]. While genetic in nature, FD afflicts all racial and ethnic groups across the globe and is not concentrated in any specific community. Because GLA is located on X-chromosome and follows X-linked inheritance pattern, it often goes undetected in female population or is missed entirely [8]. There are two different types of FD recognized based upon the age of onset of the symptoms – a classic early onset displaying symptoms as early as two years of age, and a variant late onset with symptoms unnoticed sometimes until third decade of life [9,10]. A recent study has pointed out certain genetic variants not falling within this classification system and not displaying any blood accumulation of globotriaosylsphingosine [11].

GLA codes for the enzyme AGLA that functions as a homodimeric protein in lysosomes, where it catabolizes the hydrolysis of the terminal α-galactosyl residues from various glycosphingolipids [12]. Due to lack of AGLA activity in FD, specific glycosphingolipids, such as globotriaosylceramide (Gb3) accumulates in various cell types leading to clinical manifestation of the FD [13]. Primary symptoms of FD include renal insufficiency leading to kidney failure, cardiac involvement causing premature myocardial infarction and CNS pathology often leading to early stroke. Without proper treatment, invariably FD results in early death between the fourth and the fifth decade of an affected individual’s life [14].

Majority of GLA mutations are missense, affecting the structural integrity of the AGLA protein, and consequently the enzyme activity [15]. Residual enzyme activities with certain missense mutations are well correlated with the reduced severity of the clinical symptoms. To alleviate associated symptoms and delay disease progression, promising FDA approved treatments are available for FD patients depending on the type of mutation present in the GLA. Foremost being enzyme replacement therapy (ERT) that involves recombinant AGLA infused intravenously every two weeks to affected individuals [16]. This form of treatment is indicated for individuals with all types of mutations resulting in a lack of or severely diminished AGLA activity. Fabrazyme (agalsidase beta) and Elfabrio (pegunigalsidase alfa) are the two enzyme replacement medications available in the market. The other form of therapy is a small molecule oral chaperone therapy, that involves repairing a mutant AGLA protein that has misfolded because of missense mutations. A specific AGLA inhibitor, Migalastat also known as Galafold (1-deoxygalactonojiromycin) allows for a misfolded protein retained in the endoplasmic reticulum to undergo proper folding thereby regaining partial AGLA activity [17,18]. This type of treatment is restricted to those individuals who have a missense mutation leading to retained misfolded protein in the endoplasmic reticulum. Both types of treatment strategies suggest that any incremental increase in AGAL will substantially alter severity of disease progression allowing for improvement in the quality of life of affected individuals.

Aim of this study is to show evidence that synthetic folic acid (FA) supplementation substantially stimulates AGLA activity in human lymphoblastoid cells, as well as of pure recombinant human enzyme, in a concentration dependent manner. We further show that small molecule chaperone mediated rescue of AGLA in a patient’s cell line, is stimulated by FA, again in a concentration dependent manner. FA or vitamin B9, a water-soluble component of vitamin B complex, is important in nucleotide synthesis, DNA methylation and biological reactions of one-carbon metabolism, wherein its metabolites act as co-factor for several enzymes. It is routinely indicated in women of childbearing age to prevent occurrence of neural tube defects during gestational development.

Materials and methods

4-methylumbelliferone (4-MU), 4-methylumbelliferyl-α-D-galactopyranoside (4-MU-α-Gal), FA, N-acetyl-D-galactosamine (NAG) and routine chemicals were purchased from Sigma-Aldrich (St. Louis, MO). RPMI 1640 media, α-galactosidase A rabbit recombinant monoclonal antibody (MA5–35650) and Falcon tissue culture dishes were purchased from ThermoFisher Scientific (Grand Island, NY). Fetal bovine serum, and heat inactivated, dialyzed fetal bovine serum were bought from Atlanta Biologicals (Flowery Branch, GA). Recombinant α-galactosidase A bearing human sequence representing residues 1–429 (Accession # P06280) with a C-terminal 6-His tag, > 95% purity was purchased from R&D Systems (Minneapolis, MN). Deoxygalactonojirimycin hydrochloride (DGJ) was purchased from Santa Cruz Biotechnology (Dallas, TX). RT-PCR primer pairs HP200154 for GLA (NM_000169) and HP200179 for HPRT1 (NM_000194) were purchased from Origene (Rockville, MD).

Cell culture

Lymphoblastoid cells were obtained from the NIGMS Human Genetic Cell Repository at the Coriell Institute for Medical Research, Camden, NJ. Normal male and female lymphoblastoid cell lines GM7027 and GM7053, respectively, belonged to reference CEPH/UTAH Pedigree 1340. Cell line GM04391 also used in the current study was established from an individual diagnosed with FD. These three deidentified cells from the NIGMS Human Genetic Cell Repository at the Coriell Institute for Medical Research, Camden, NJ are publicly available to researchers to advance scientific research through Material Transfer Agreement. Written consents for use will be available with the repository. Authors have not obtained the original samples to establish cell lines.

The current study was conducted under the IRB protocol number NK12025−71, reviewed and approved by the Institutional Review Board of the Nathan Kline Institute for Psychiatric Research and Rockland Psychiatric Center, Orangeburg, NY.

Stock solution of sodium salt of FA was dissolved in water. It was diluted in either RPMI medium for cell exposure, or in citrate-phosphate buffer for recombinant enzyme assay. The maximum dilutions of FA we used in our study up to 500 ng/ml had no effect on fluorescence readout of 4MU. Fluorescent plate always had appropriate blanks; however, FA did not affect 4MU fluorescence.

These cell lines were grown in RPMI 1640 medium, supplemented with 15% fetal bovine serum, 2 mM glutamine, 1 mM sodium pyruvate and antibiotics (penicillin and streptomycin, 100 µg/ml each) as described earlier [19]. Prior to exposure to FA, cells were grown for 72 hours in RPMI 1640 FA free media containing 15% dialyzed and heat inactivated fetal bovine serum, 2 mM glutamine, 1 mM sodium pyruvate and antibiotics (penicillin and streptomycin, 100 µg/ml each). The same media (8 ml) was supplemented with FA at concentrations ranging from 0–500 ng/ml medium in 25 cm² Nunc EasYFlask™ cell culture flasks at a density of 8 x 10⁶ cells. Cells were grown in a humidified incubator maintained at 37 °C in an atmosphere comprising of 5% CO₂ in air. After three days of exposure to FA, cells were collected by centrifugation (800 x g for 5 min), rinsed twice with ice-cold normal saline, and stored frozen at −80 °C until further processed.

Nucleic acids extraction, cDNA synthesis

DNA, RNA and proteins were extracted from frozen lymphoblastoid cells by Qiagen AllPrep DNA/RNA/Protein isolation kit according to manufacturer’s stated procedure. Amounts and purity of DNA and RNA eluted were determined by SmartDrop by Accuris Edison, NJ. RNA was stored at −80 °C, whereas DNA was stored at −20 °C until further used. cDNA synthesis was performed with 100 ng RNA using Qiagen first strand cDNA kit as described earlier [20].

Quantitative PCR

Quantitative PCR was performed by using the BioRad CFX Opus 96 system (BioRad, Hercules, CA) in combination with the RT2 SYBRGreen PCR Master Mix (Qiagen) as described earlier [21]. Each reaction was run in duplicate and repeated three times from different batches of cDNA. HPRT1 was used as endogenous control for amplification. Relative gene expression was calculated by using the Pfaffl method of Ct values [22].

Cytosine methylation

Targeted region of interest (ROI) bisulfite sequencing was performed for a 573 bp fragment of GLA gene comprising of nucleotides chrX:101407790–101408363 at Zymo Research Corporation (Irvine, CA). This fragment comprises 34 CpG sites within a single CpG island.

Cell free extracts

Cell pellets were resuspended in 200 µl of 25 mM citrate-phosphate buffer pH 4.6 and extracts were prepared with Fisherbrand Sonifier FB505 (ThermoFisher Scientific) equipped with cup horn as described earlier [23]). Clear supernatant obtained after centrifugation at 14,500 rpm for 10 minutes was stored frozen at −20 °C until used. Protein concentrations were measured by the modified Folin phenol method using BSA as the standard [24].

AGLA activity

AGLA was measured in 96-well plates as described [25,26]. Briefly, 50 µl of extract in 25 mM citrate-phosphate buffer pH 4.6 was incubated with 50 µl of the substrate (2 mM 4-MU- α-Gal dissolved in citrate-phosphate buffer, pH 4.6) for up to 3 hours at 37 °C under shaking conditions. Reaction was inhibited by mixing with 100 µl of 0.1 M glycine-carbonate buffer, pH 11. To ensure measurement of specific AGLA activity in cell extracts, the assay was also determined in the presence of NAG as described [27]. Briefly, extract was incubated with 6 mM 4-MU-α-Gal and 90 mM NAG in 100 µl of 0.1M citrate-phosphate buffer pH 4.5 for up to 30 minutes. Reaction was terminated by mixing 100 µl of 0.2 M glycine-carbonate buffer, pH 10.5. Product formation was measured in Spectramax M3 plate reader (Molecular Devices, San Jose, CA) using excitation and emission wavelengths 365 nm and 450 nm, respectively. Florescence readings were converted to molarities using standard curve generated with defined concentrations of 4-MU in same chemical composition. A master mix with cell free extract was prepared when incubations were made with the FA.

Western blotting

Western blot analysis was done as described earlier [19]. Non-specific sites on the membranes were blocked for two hours with 5% nonfat dry milk in TBST, incubated with primary antibody (1:250) overnight at 4 °C, then incubated with horse radish peroxidase–conjugated secondary antibodies (1:2,000) at room temperature for two hours, and developed by using the SuperSignal West Pico chemiluminescent substrate (ThermoFisher, Rockford, IL). Images were captured on an iBright FL1500 Imaging System (ThermoFisher, Rockford, IL).

Statistics

Each experiment was performed in triplicates in three independent experiments. Values are presented as means ± SEM. Significance of the difference of AGLA activity in the presence or absence of FA at each concentration was determined by upaired t-tests; significance of overall effects was determined by ANOVAs. The increase in AGLA activity with logarithmically increasing FA concentration was tested with an OLS regression. A significance criteria of P < 0.05 was applied throughout.

Results

When lymphoblastoid cells in culture conditions were exposed to FA supplementation, it caused significant stimulation of the GLA transcript, protein, and AGLA enzyme activity, in a concentration dependent manner. Enzyme activity measurements in cell free extracts displayed that AGLA activity in lymphoblastoid cells was increased significantly with as low FA concentration as 31.25 ng/ml medium (Fig 1). Increased AGLA enzyme activity was measurable with the highest FA concentration tested at 250 ng/ml medium. At higher concentrations FA-mediated stimulation begins to diminish, and in fact it appears to inhibit AGLA activity. The stimulation of AGLA activity by FA was similar in extent regardless of whether the cell line was established from a male or a female subject (p = 0.67).

Fig 1 — Cell lines GM7027 (male) and GM7053 (female) were grown in FA free media for three days prior to incubating with the indicated FA concentrations in RPMI 1640 medium. After three days, cells were collected by centrifugation, rinsed with normal saline, and AGLA activity determined in presence of NAG. Values are means of three independent experiments and bars show SEM. AGLA values at each FA concentration was significantly different (P < 0.0001) from that at zero concentration.

The FA mediated increase in AGLA activity seen in lymphoblastoid cells appears highly specific, as it was determined in presence of NAG, and since enzyme activities of several other lysosomal enzymes tested remain unchanged upon incubation with similar FA concentrations. We tested enzyme activities of aryl sulfatase A (EC:3.1.6.8), aryl sulfatase B (EC:3.1.6.12), α-L-fucosidase (EC:3.2.1.51), β-D-galactosidase (EC:3.2.1.23), α-D-glucosidase (EC:3.2.1.20), β-glucoronidase (EC:3.2.1.31), α-D-mannosidase (EC:3.2.1.24), and tripeptidyl peptidase (EC: 3.4.14.9) in lymphoblastoid cells upon FA supplementation for 3-days, and found that at all concentrations these enzyme activities were unaffected (Supplementary Information S1 Table). The stimulation determined in the presence of NAG indicates that the effect is specific to AGLA and not to competing α-N-acetylgalactosaminidase (EC:3.2.1.49), which also cleaves the substrate used. NAG inclusion in assays with recombinant AGLA showed no effect on the stimulation as expected.

Quantitative RT-PCR data using validated primer set confirmed increased expression of GLA transcript in lymphoblastoid cells supplemented with FA (Fig 2A). The primer set utilized forward 5’GCAACCTTGACTGCCAGGAAGA3’ and reverse 5’ CTCATAACCTGCATCCTTCCAGC 3’ primers, respectively, which amplifies a ~ 107 bp fragment about 150 bp into the ORF. This primer pair amplifies isoforms 1, 3, 4 and 5. In our amplifications, a single peak was displayed in melting curve. Transcript levels at zero FA were compared with those at indicated concentrations. AGLA transcript values differed significantly by FA concentration (F (5,30) = 51.46 p < 0.001). At FA concentrations below 31.25 ng/ml AGLA expression was also higher but the effect was not statistically significant. The increase in AGLA expression with increasing FA concentration was strongly significant (p < 0.001). Western blot analysis using an anti-AGLA rabbit monoclonal antibody displayed that AGLA protein expression increased in lymphoid cells with increasing FA concentration in the medium. There is a basal level of expression of AGLA in the absence of FA, and thereafter the AGLA expression increased in a concentration dependent manner with increasing FA concentration (Fig 2B). The lowest concentration we have tested that showed increased expression is 31.25 ng FA/ml of RPMI 1640 medium. We used GAPDH for housekeeping gene, as expression of this gene remained unchanged with increasing FA concentrations [19].

Fig 2 — Cells were grown in FA free medium for three days prior to incubating with the indicated FA concentrations in RPMI 1640 medium. After three days, cells were collected by centrifugation, rinsed with normal saline, and RNA or proteins were prepared. **(A)** Transcript levels were measured by RT-PCR using primer pair HP200154 for *GLA* and HP200179 for *HPRT1*. Values are mean of three independent experiments and bars show the SEM. Differences among concentrations were significant (F (5,12) = 3.85, p < 0.026). **(B)** Western blot analysis of lymphoblastoid cells exposed to FA concentrations, (25 µg protein each) were probed with an anti-AGLA rabbit monoclonal antibody. Picture of a representative blot. **(C)** Densitometric measurement of blots using Image J, and expression of ratio with the housekeeping gene GAPDH. Differences among concentrations were extremely significant (F (5,12) = 19.81, p < 0.0001).

We tested whether enzyme activity of the purified AGLA protein is also stimulated with FA incubation. We used the recombinant human AGLA protein with a C-terminal 6-His tag, expressed in CHO cell line (R&D systems, 6146-GH) as the pure enzyme. As shown in Fig 3, AGLA activity is stimulated by in vitro incubation with FA, again in a concentration dependent manner showing a similar trend as lymphoblastoid cells with respect to FA concentrations. The difference in AGLA expression by FA concentration was quite significant (F (5,12) = 20.58, p < 0.0001). AGLA activity determined in the presence of NAG failed to show any inhibition even at the lowest FA concentration indicating that NAG, as expected, has no effect on the pure AGLA activity. Kinetic parameters evaluated of the AGLA activity at various concentrations of FA demonstrated that the stimulation of the enzyme activity is of mixed type with increasing Vmax but unchanged Km (Fig 4). Km was not statistically significant between zero and various FA concentrations (F (5,12) = 0.41, p = 0.85), whereas Vmax at FA higher than 62 ng/ml was significantly different (F (5,12) = 9.72, p < 0.0007). Vmax at 31.25 ng/ml FA showed upward trend but was not statistically significant.

Fig 3 — Recombinant AGLA (Accession # P06280) activity was determined in the presence of indicated FA concentration using 4-MU-α-Gal as the substrate. Release of 4-MU was determined fluorometrically. Values represent means with bars showing SEM for three independent measurements. AGLA activity was significantly different (P < 0.05) at all concentrations when measured against zero FA.

Fig 4 — AGLA activity was determined at various 4-MU-α-Gal concentrations at indicated FA concentration. Km (A) and Vmax (B) were determined from double reciprocal Lineweaver-Burk plots. Values are means and bars show SEM of three independent measurements.

We then tested whether recombinant AGLA activity inhibited by specific inhibitor, 1-deoxygalactonojirimycin (DGJ) (Migalastat or Galafold) is restored by FA incubation. As shown in Fig 5, FA incubation of AGLA activity inhibited by DGJ is significantly restored by FA incubation by over 50% at increasing FA concentrations. The order of preincubation of AGLA with either FA or the inhibitor displayed interesting results. When AGLA was preincubated with the inhibitor followed by addition of FA, this restored the AGLA activity by about 50%. On the other hand, preincubation of AGLA with FA for 15 minutes on ice, followed by addition of the inhibitor offered additional 15% protection of AGLA activity from being inhibited by the inhibitor (Table 1).

Fig 5 — Recombinant AGLA was incubated with or without the specific inhibitor DGJ, either in the presence or absence of FA at varying concentrations of the substrate, 4MU-Gal **(A)**. Fluorescence was measured after terminating the reaction with the stop solution. **(B)** Lineweaver-Burk plot of the data to determine type of enzyme mechanism.

Table 1. FA preincubation with AGLA is beneficial.

Condition	pmol. Min^-1
Enzyme alone	9.42 ± 0.4
Enzyme + DGJ (7 µM)	2.47 ± 0.2*
Enzyme + DGJ + FA	6.06 ± 0.5*
Enzyme + FA + DGJ	6.96 ± 0.5*

Open in a new tab

Recombinant AGLA was incubated with or without DGJ at 7 µM. AGLA activity was measured by incubating with FA that was added either along with DGJ, or 15 minutes prior to adding DGJ on ice. Values represent mean ± SEM of three independent experiments and * denotes significantly different from activity without DGJ (P < 0.05).

We also tested whether AGLA activity restored by small molecule chaperone DGJ therapy compound shows any effect upon incubation with FA. The AGLA activity in lymphoblastoid cells from an individual with FD was low (Fig 6). After incubation with 7 µM concentration of DGJ, the AGLA activity was increased by > 4-folds compared to cells incubated without DGJ. This AGLA activity, restored by DGJ in the lymphoblastoid cells, was further stimulated by incubation with FA again in a concentration dependent manner, with the FA even at 31.25 ng/ml level stimulating AGLA activity by a further 18% (a 1.2-fold increase over DGJ restored level). The restored AGLA activity continues to increase further with increasing FA concentration of 250 ng/ml. The overall effect was strongly significant (F (5,12) = 74.05, p < 0.0001).

Fig 6 — AGLA activity in the cell line GM04391 established from a FD individual was measured without or with DGJ (7 µM), at indicated concentrations of FA in the media. Values represent mean ± SEM of three independent experiments.

We performed targeted methylation sequence of one CpG island (573 bp) in GLA gene near the promoter region to see if FA mediated differential methylation of cytosine residues. The results indicated that none of the 34 cytosines in the dinucleotide CpG sites analyzed within this 573 bp fragment had higher methylation rate compared to cells incubated without FA (Supplementary Information, S1 Fig and S2 Table).

Together, the data from this study clearly demonstrates that FA supplementation increases AGLA mRNA and protein expression in the lymphoblastoid cells and further, the purified enzyme activity is also stimulated by FA incubation, in concentration dependent manner. Additionally, we provide convincing proof that AGLA activity restored by small molecule chaperone DGJ therapy is further augmented by incubation with increasing FA supplementation.

Discussion

FD is a debilitating inherited disability afflicting people of all ethnicities around the globe. The introduction of promising therapies in the form of enzyme replacement and chaperone therapies have alleviated suffering individuals’ difficulties and contributed significantly to improved lifestyles [28]. Successes of both therapies demonstrated that any incremental increase in the AGLA activity in affected individuals is of paramount importance in lessening the symptoms severity. Our current results indicated that both types of therapies may greatly benefit if FA supplementation is simultaneously included with these treatment modalities.

While screening beneficial and potentially detrimental epigenetic effects of the vitamin FA, we observed potential beneficial effects of FA supplementation through substantially augmenting the AGLA activity in human lymphoblastoid cells and the pure recombinant enzyme. Mandatory synthetic FA supplementations of breakfast cereals and grains was instituted to prevent neural tube defects (NTDs) in newborns [29]. This single dietary modification is credited with over 70% reduction in incidences of NTDs. Thus, there is widespread use of FA supplementation in the general population. The exact molecular mechanism involved in FA preventing NTDs are unknown, however, FA is cofactor in enzymes that participate in one-carbon metabolism, and it is expected that combinations of such metabolic activities apart from stimulated nucleic acid synthesis may be responsible.

Our current work clearly demonstrates that FA supplementation has hitherto unknown beneficial impact by stimulating AGLA through two separate but interconnected mechanisms involving production of AGLA at the gene expression level, and a possible direct interaction with the mature enzyme. First, FA supplementation of lymphoblastoid cells in culture stimulated AGLA mRNA and protein expression, which is demonstrated by increasing transcript and protein levels. This is happening at the level of augmented gene expression, which may be consequent to epigenetic effects of FA. However, we did not find any of the cytosine residues that we tested within a single CpG island showing any differential methylation status under FA supplementation to support that this particular CpG island participates in any direct epigenetic effect. These 34 CpG sites we tested in one CpG island are in the vicinity of the gene promoter. This suggests that FA is not exerting any direct epigenetic effect on the one CpG island tested, which argues that additional CpG sites may be present in the GLA gene, or FA may promote augmented AGLA expression through another yet unidentified gene that may regulate the GLA gene expression. This remains to be established.

Second, in vitro FA incubation also increases AGLA activity in a concentration dependent manner, which is reflected by stimulation of pure recombinant AGLA protein. Kinetic measurement indicated increase in Vmax but not Km of the enzyme. The binding sites for FA and substrates are expected to be different since enzyme activity stimulation was found to be of mixed type and without any impact on the Km. Thus, FA is also able to stimulate the AGLA enzyme activity as a direct modulator by interacting with a site not involving active site residues. In the past, glucose, melibiose and raffinose sugars were shown to stimulate AGLA activity, while trehalose treatment induced a marginal increase at much higher concentrations [30]. Thus, FA seems to be a more potent stimulator of AGLA activity both under in vivo and in vitro conditions.

Irrespective of the gender, the increase in AGLA activity was comparable in both male and female lymphoblastoid cell lines with all FA concentrations tested. This is important since GLA gene is localized on X-chromosome, and women do exhibit X-linked inheritance issues for GLA expression due to which they often experience delayed diagnosis for FD [31].

The FA mediated stimulation of AGLA was found to be highly specific for this lysosomal enzyme, since no such stimulation was observed with several other lysosomal enzymes tested. Stimulation in the presence of NAG also rules out effect of α-N-acetylgalactosaminidase (EC:3.2.1.49), the enzyme that also utilizes the substrate used. Also, of importance is β-galactosidase 1(EC:3.2.1.23) that acts on substrate showing only a change in glycosidic linkage orientation in comparison to AGLA [32]. Such specificity is expected, since both AGLA and beta-galactosidase 1 are separate proteins encoded by different genes. Thus, structurally, there may be motifs in AGLA that are amenable to binding FA and consequently stimulating the enzyme activity, and such motifs may be lacking in other lysosomal enzymes we tested. In a similar manner, DGJ specifically inhibits the AGLA activity while no such inhibition is observed with beta-galactosidase 1 [27]. Earlier reports had found that AGLA activity is stimulated by ammonium chloride possibly through change in microenvironment at the lysosomal level [33]. Sphingolipid activator protein B (saposin B) stimulates the degradation of the accumulated material globotriaosylceramide [34], presumably through micellar structure formation and recognition of the same by AGLA [35]. Quinovose (6-deoxy-D-glucose) was specifically shown to stimulate the induction of an extracellular AGLA from Talaromyces flavus [36]. Trehalose, a disaccharide made of two glucose units stimulates several lysosomal hydrolases including the AGLA through autophagy mediated mechanism [30]. Thus, our research has found a potent small molecule at low concentration, which is routinely consumed as a supplement, which can substantially stimulate AGLA activity.

The exact mechanism of how FA is stimulating pure AGLA is presently unclear. Whether FA is a cofactor for AGLA is unknown at this time, however, it will be worth investigating FA binding to AGLA and clarify such a role. FA does participate as cofactor in enzymes involved in one-carbon metabolism. It is possible that FA binds to AGLA and stabilizes the enzyme, which is reflected from added stimulation of AGLA upon prior FA incubation before inhibitor is added. Lowest concentration of FA shown in our experiments to increase the level of AGLA both at transcription as well as in vitro activity level is lower than what has been reported in the blood FA concentrations in the population following FA supplementation [37].

Our research also provides direct proof that FA can substantially stimulate small molecule chaperone DGJ mediated refolding of AGLA in both, the recombinant AGLA as well as in a cell line from a FD affected individual. DGJ stabilizes the misfolded protein and helps it refold in proper conformation resulting in partial restoration of enzyme function [28]. FA incubation further stimulates the refolded enzyme thereby augmenting AGLA enzymatic activity. According to the NIGMS Human Genetic Cell Repository at the Coriell Institute for Medical Research, Camden, NJ, the lymphoblastoid cell line tested was from an individual with confirmed FD diagnosis. This individual is a male and was 41 years old at the time of establishing the cell line. Genetic analysis revealed him to be hemizygous for an A > G transition in exon 5 of the GLA gene (codon AAT > AGT) resulting in Asn215Ser substitution in the protein. The individual had residual AGLA activity in fibroblasts and WBC and displayed mild clinical manifestations [38]. Because FA is stimulating the pure AGLA activity, its inclusion in small molecule chaperone DGJ-based therapy may also nullify any inhibition the AGLA may encounter by the presence of DGJ.

Our study is limited to a single cell line from an individual with FD. It needs to be replicated in FD individuals with other types of missense mutations with classic phenotypes. Another limitation is we also did not measure any disease relevant substrate in the cell lines in response to FA supplementation, that may provide conclusive evidence of the supplementation benefit.

Stimulation of AGLA by FA supplementation may offer benefits to individuals with FD on either ERT or chaperone therapy. Our current research has shown the potential that FD individuals with residual AGLA activity may be able to augment the enzyme activity further through FA supplementation with likely alleviation in the symptomology. Obviously this needs to be confirmed through clinical trials in individuals with FD. As a preliminary proof of concept, we have shown that FA supplementation further augments AGLA activity restored by the chaperone DGJ in lymphoblastoid cells from FD individual, and in pure recombinant enzyme.

Supporting information

S1 Table. Lysosomal enzymes tested in the current study with increasing FA concentration.

Enzyme activities were tested by methods described in the reference quoted.

(PDF)

pone.0351438.s001.pdf^{(138.2KB, pdf)}

S2 Table. CpG methylation status around GLA promoter region.

GLA CpG island unique sequence methylation status of the 34 CG sites. The ratio of all these sites is below zero, indicating lack of methylation at any of the sites.

(XLSX)

pone.0351438.s002.xlsx^{(27.1KB, xlsx)}

S3 Table. Data files.

Data used in the current study for figures generated.

(XLSX)

pone.0351438.s003.xlsx^{(17.5KB, xlsx)}

S1 Fig. GLA – CpG island.

GLA CpG island unique sequence; Dark Gray shade is sequencing amplicon, Light Gray shade is region of interest; CG is CG of interest.

(PDF)

pone.0351438.s004.pdf^{(71KB, pdf)}

S1 Raw Images. Original images of Western blot for AGLA staining used in Fig 2B upper and lower panels.

(PDF)

pone.0351438.s005.pdf^{(220KB, pdf)}

Acknowledgments

We gratefully acknowledge efforts of Michael Flory, Ph.D., of our Institute’s Research Design and Analysis Services for help with statistical analyses of this study.

Data Availability

All relevant data are within the manuscript and its Supporting information files.

Funding Statement

This study was supported by funds from the New York State Office for People With Developmental Disabilities given as laboratory budget (205). These funds provide salaries for both the investigators, laboratory budget and facility. NYSOPWDD had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The research reported in this article has been submitted to USPTO with provisional application number 63/774,855.

References

1.Kok K, Zwiers KC, Boot RG, Overkleeft HS, Aerts JMFG, Artola M. Fabry disease: molecular basis, pathophysiology, diagnostics and potential therapeutic directions. Biomolecules. 2021;11(2):271. doi: 10.3390/biom11020271 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Desnick RJ. Fabry Disease: α-Galactosidase A Deficiency. In: Rosenberg RN, Pascua JM, editors. Molecular and Genetic Basis of Neurological and Psychiatric Disease. 5th ed. New York: Academic Press; 2015. pp. 419–30. 10.1016/B978-0-12-410529-4.00038-3 [DOI] [Google Scholar]
3.Garman SC, Garboczi DN. The molecular defect leading to Fabry disease: structure of human alpha-galactosidase. J Mol Biol. 2004;337(2):319–35. doi: 10.1016/j.jmb.2004.01.035 [DOI] [PubMed] [Google Scholar]
4.Waldek S, Patel MR, Banikazemi M, Lemay R, Lee P. Life expectancy and cause of death in males and females with Fabry disease: findings from the Fabry Registry. Genet Med. 2009;11(11):790–6. doi: 10.1097/GIM.0b013e3181bb05bb [DOI] [PubMed] [Google Scholar]
5.Spada M, Pagliardini S, Yasuda M, Tukel T, Thiagarajan G, Sakuraba H, et al. High incidence of later-onset fabry disease revealed by newborn screening. Am J Hum Genet. 2006;79(1):31–40. doi: 10.1086/504601 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Chien Y-H, Lee N-C, Chiang S-C, Desnick RJ, Hwu W-L. Fabry disease: incidence of the common later-onset α-galactosidase A IVS4+919G→A mutation in Taiwanese newborns--superiority of DNA-based to enzyme-based newborn screening for common mutations. Mol Med. 2012;18(1):780–4. doi: 10.2119/molmed.2012.00002 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Wasserstein MP, Caggana M, Bailey SM, Desnick RJ, Edelmann L, Estrella L, et al. The New York pilot newborn screening program for lysosomal storage diseases: Report of the first 65,000 infants. Genet Med. 2019;21:631–40. doi: 10.1038/s41436-018-0129-y [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Viggiano E, Politano L. X chromosome inactivation in carriers of Fabry disease: review and meta-analysis. Int J Mol Sci. 2021;22(14):7663. doi: 10.3390/ijms22147663 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Arends M, Wanner C, Hughes D, Mehta A, Oder D, Watkinson OT, et al. Characterization of classical and nonclassical Fabry disease: a multicenter study. J Am Soc Nephrol. 2017;28(5):1631–41. doi: 10.1681/ASN.2016090964 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Doheny D, Srinivasan R, Pagant S, Chen B, Yasuda M, Desnick RJ. Fabry disease: prevalence of affected males and heterozygotes with pathogenic GLA mutations identified by screening renal, cardiac and stroke clinics, 1995-2017. J Med Genet. 2018;55(4):261–8. doi: 10.1136/jmedgenet-2017-105080 [DOI] [PubMed] [Google Scholar]
11.Duro G, Zizzo C, Cammarata G, Burlina A, Burlina A, Polo G, et al. Mutations in the GLA gene and LysoGb3: is it really Anderson-Fabry disease? Int J Mol Sci. 2018;19(12):3726. doi: 10.3390/ijms19123726 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Guce AI, Garman SC. The structure of human α-galactosidase A and implications for Fabry disease. In: Elstein D, Altarescu G, Beck M, editors. Fabry disease. New York: Springer; 2010. pp. 21–38. 10.1007/978-90-481-9033-1 [DOI] [Google Scholar]
13.Aerts JM, Groener JE, Kuiper S, Donker-Koopman WE, Strijland A, Ottenhoff R, et al. Elevated globotriaosylsphingosine is a hallmark of Fabry disease. Proc Natl Acad Sci U S A. 2008;105(8):2812–7. doi: 10.1073/pnas.0712309105 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Germain DP. Fabry disease. Orphanet J Rare Dis. 2010;5:30. doi: 10.1186/1750-1172-5-30 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Ishii S, Kase R, Okumiya T, Sakuraba H, Suzuki Y. Aggregation of the inactive form of human alpha-galactosidase in the endoplasmic reticulum. Biochem Biophys Res Commun. 1996;220(3):812–5. doi: 10.1006/bbrc.1996.0486 [DOI] [PubMed] [Google Scholar]
16.Desnick RJ. Enzyme replacement therapy for Fabry disease: lessons from two alpha-galactosidase A orphan products and one FDA approval. Expert Opin Biol Ther. 2004;4(7):1167–76. doi: 10.1517/14712598.4.7.1167 [DOI] [PubMed] [Google Scholar]
17.Fan JQ, Ishii S, Asano N, Suzuki Y. Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor. Nat Med. 1999;5(1):112–5. doi: 10.1038/4801 [DOI] [PubMed] [Google Scholar]
18.Lenders M, Stappers F, Brand E. In vitro and in vivo amenability to migalastat in Fabry Disease. Mol Ther Methods Clin Dev. 2020;19:24–34. doi: 10.1016/j.omtm.2020.08.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Junaid MA, Kuizon S, Cardona J, Azher T, Murakami N, Pullarkat RK, et al. Folic acid supplementation dysregulates gene expression in lymphoblastoid cells--implications in nutrition. Biochem Biophys Res Commun. 2011;412(4):688–92. doi: 10.1016/j.bbrc.2011.08.027 [DOI] [PubMed] [Google Scholar]
20.Barua S, Chadman KK, Kuizon S, Buenaventura D, Stapley NW, Ruocco F, et al. Increasing maternal or post-weaning folic acid alters gene expression and moderately changes behavior in the offspring. PLoS One. 2014;9(7):e101674. doi: 10.1371/journal.pone.0101674 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Barua S, Kuizon S, Chadman KK, Flory MJ, Brown WT, Junaid MA. Single-base resolution of mouse offspring brain methylome reveals epigenome modifications caused by gestational folic acid. Epigenetics Chromatin. 2014;7(1):3. doi: 10.1186/1756-8935-7-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Tichopad A, Dilger M, Schwarz G, Pfaffl MW. Standardized determination of real-time PCR efficiency from a single reaction set-up. Nucleic Acids Res. 2003;31(20):e122. doi: 10.1093/nar/gng122 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Gavin M, Khatoon S, Marchi EJ, Mevs CA, Bolton DC, Velinov MT, et al. Diagnosis of late-infantile neuronal ceroid lipofuscinosis using dried blood spot-based assay for TPPI enzyme activity: TPPI diagnostic assay from DBS. Clin Chim Acta. 2020;507:62–8. doi: 10.1016/j.cca.2020.04.010 [DOI] [PubMed] [Google Scholar]
24.Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193(1):265–75. doi: 10.1016/s0021-9258(19)52451-6 [DOI] [PubMed] [Google Scholar]
25.Desnick RJ, Allen KY, Desnick SJ, Raman MK, Bernlohr RW, Krivit W. Fabry’s disease: enzymatic diagnosis of hemizygotes and heterozygotes. Alpha-galactosidase activities in plasma, serum, urine, and leukocytes. J Lab Clin Med. 1973;81(2):157–71. [PubMed] [Google Scholar]
26.Hölzl MA, Gärtner M, Kovarik JJ, Hofer J, Bernheimer H, Sunder-Plassmann G, et al. Quantification of α-galactosidase activity in intact leukocytes. Clin Chim Acta. 2010;411(21–22):1666–70. doi: 10.1016/j.cca.2010.06.023 [DOI] [PubMed] [Google Scholar]
27.Asano N, Ishii S, Kizu H, Ikeda K, Yasuda K, Kato A, et al. In vitro inhibition and intracellular enhancement of lysosomal alpha-galactosidase A activity in Fabry lymphoblasts by 1-deoxygalactonojirimycin and its derivatives. Eur J Biochem. 2000;267(13):4179–86. doi: 10.1046/j.1432-1327.2000.01457.x [DOI] [PubMed] [Google Scholar]
28.Fan J-Q, Ishii S. Active-site-specific chaperone therapy for Fabry disease. Yin and Yang of enzyme inhibitors. FEBS J. 2007;274(19):4962–71. doi: 10.1111/j.1742-4658.2007.06041.x [DOI] [PubMed] [Google Scholar]
29.Molloy AM, Pangilinan F, Brody LC. Genetic risk factors for folate-responsive neural tube defects. Annu Rev Nutr. 2017;37:269–91. doi: 10.1146/annurev-nutr-071714-034235 [DOI] [PubMed] [Google Scholar]
30.Rusmini P, Cortese K, Crippa V, Cristofani R, Cicardi ME, Ferrari V, et al. Trehalose induces autophagy via lysosomal-mediated TFEB activation in models of motoneuron degeneration. Autophagy. 2019;15(4):631–51. doi: 10.1080/15548627.2018.1535292 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Linthorst GE, Poorthuis BJHM, Hollak CEM. Enzyme activity for determination of presence of Fabry disease in women results in 40% false-negative results. J Am Coll Cardiol. 2008;51(21). doi: 10.1016/j.jacc.2008.02.050 [DOI] [PubMed] [Google Scholar]
32.Yoshida K, Oshima A, Shimmoto M, Fukuhara Y, Sakuraba H, Yanagisawa N, et al. Human beta-galactosidase gene mutations in GM1-gangliosidosis: a common mutation among Japanese adult/chronic cases. Am J Hum Genet. 1991;49(2):435–42. [PMC free article] [PubMed] [Google Scholar]
33.Lemansky P, Bishop DF, Desnick RJ, Hasilik A, von Figura K. Synthesis and processing of alpha-galactosidase A in human fibroblasts. Evidence for different mutations in Fabry disease. J Biol Chem. 1987;262(5):2062–5. doi: 10.1016/s0021-9258(18)61618-7 [DOI] [PubMed] [Google Scholar]
34.Kase R, Bierfreund U, Klein A, Kolter T, Itoh K, Suzuki M, et al. Only sphingolipid activator protein B (SAP-B or saposin B) stimulates the degradation of globotriaosylceramide by recombinant human lysosomal alpha-galactosidase in a detergent-free liposomal system. FEBS Lett. 1996;393(1):74–6. doi: 10.1016/0014-5793(96)00863-0 [DOI] [PubMed] [Google Scholar]
35.Sawyer TK, Aral E, Staros JV, Bobst CE, Garman SC. Human saposin B ligand binding and presentation to α-Galactosidase A. bioRxiv. 2004;4. doi: 10.1101/2024.04.04.584535 [DOI] [Google Scholar]
36.Simerská P, Monti D, Cechová I, Pelantová H, Macková M, Bezouska K, et al. Induction and characterization of an unusual alpha-D-galactosidase from Talaromyces flavus. J Biotechnol. 2007;128(1):61–71. doi: 10.1016/j.jbiotec.2006.09.006 [DOI] [PubMed] [Google Scholar]
37.Choumenkovitch SF, Selhub J, Wilson PWF, Rader JI, Rosenberg IH, Jacques PF. Folic acid intake from fortification in United States exceeds predictions. J Nutr. 2002;132(9):2792–8. doi: 10.1093/jn/132.9.2792 [DOI] [PubMed] [Google Scholar]
38.Lamari F, Mauhin W, Koraichi F, Khrouf W, Bordet C, London J, et al. Strong increase of leukocyte apha-galactosidase A activity in two male patients with Fabry disease following oral chaperone therapy. Mol Genet Genomic Med. 2019;7(9):e894. doi: 10.1002/mgg3.894 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0351438.r001

Decision Letter 0

Tatsuo Shimosawa

8 Feb 2026

-->PONE-D-25-67348-->-->Human α-Galactosidase A is Stimulated by Folic Acid Supplementation – Possible Implications in Fabry Disease Management-->-->PLOS One

Dear Dr. Junaid,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

The current study is interesting and contribute largely in inventing new treatment for Fabry Disease, however, the methods and results are not sufficient to support the conclusion. Three experts raised several issues to be clarified. Please revise extensively to draw the conclusion.-->-->

Please submit your revised manuscript by Mar 25 2026 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:-->

A letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Tatsuo Shimosawa, M.D., Ph.D.

Academic Editor

PLOS One

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“This study was supported by funds from the New York State Office for People with Developmental Disabilities.”

We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“The author(s) received no specific funding for this work.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

4. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section

5. Thank you for stating the following financial disclosure:

“The author(s) received no specific funding for this work.”

At this time, please address the following queries:

a) Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution.

b) State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

c) If any authors received a salary from any of your funders, please state which authors and which funders.

d) If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

6. Please include your full ethics statement in the ‘Methods’ section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well.

7. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

8. We note that your Data Availability Statement is currently as follows: “All relevant data are within the manuscript and its Supporting Information files.”

Please confirm at this time whether or not your submission contains all raw data required to replicate the results of your study. Authors must share the “minimal data set” for their submission. PLOS defines the minimal data set to consist of the data required to replicate all study findings reported in the article, as well as related metadata and methods (https://journals.plos.org/plosone/s/data-availability#loc-minimal-data-set-definition).

For example, authors should submit the following data:

- The values behind the means, standard deviations and other measures reported;

- The values used to build graphs;

- The points extracted from images for analysis.

Authors do not need to submit their entire data set if only a portion of the data was used in the reported study.

If your submission does not contain these data, please either upload them as Supporting Information files or deposit them to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of recommended repositories, please see https://journals.plos.org/plosone/s/recommended-repositories.

If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent. If data are owned by a third party, please indicate how others may request data access.

9. If the reviewer comments include a recommendation to cite specific previously published works, please review and evaluate these publications to determine whether they are relevant and should be cited. There is no requirement to cite these works unless the editor has indicated otherwise.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

-->Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. -->

Reviewer #1: Partly

Reviewer #2: Yes

Reviewer #3: Partly

**********

-->2. Has the statistical analysis been performed appropriately and rigorously? -->

Reviewer #1: I Don't Know

Reviewer #2: I Don't Know

Reviewer #3: No

**********

-->3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.-->

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: No

**********

-->4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.-->

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

-->5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)-->

Reviewer #1: The manuscript describes a possible interesting effect of folic acid on alpha-galactosidase A expression and activity, which could be helpful for the treatment of Fabry Disease.

Numerous experiments were performed to support the conclusions, however some of them are not methodologically precise or not enough described, therefore these aspects have to be clarified, emended or at least some methodological deficiency has to be mentioned as a limitation.

In particular:

There is no mention to the fact that N-Acetyl-galactosamine was added as a reagent in the activity tests performed in all cell lysates. This compound is used to exclude the contribution of the alpha-gal isoform B (or alpha-N-Acetylgalactosaminidase Ec 3.2.1.49 encoded by NAGA) to the enzymatic activity, since the two enzyme are homoulogus in their sequence and share the same substrate. Ideally, lysate activity assays should be repeated in the presence of N-Acetyl-galactosamine, however, since the experiments on the purified alpha-Gal A activity also show an effect of folic acid, it is assumable that the effect on the cell lysates could also be genuinely due to folic acid action on the correct isoform, but the limitation of the assays performed in cell lysate should be mentioned.

As a consequence, the sentence in page 10 line 205, in which author says that data obtained in lymphoblasts are "highly specific", should be avoided because the effect of the most important isoform of the enzyme was not excluded, according to the draft.

Authors also state that they have performed similar experiments in other lysosomal enzyme with no effect on folic acid. These experiments are not included in the manuscript, presumibly to simplify the reading and center the attention on the relevant results, but these experiments could be included as supplementary figures for transparency.

Statistical analysis was performed and it was indicated in the text which are the significant values, however not all the graphs include significant data representation and, more importantly, there is no mention in the whole manuscript on which tests were applied to analyze statistical significance, therefore statistical analysis accuracy cannot be reviewed.

It should also be clearly indicated in the text, which region of the enzyme or which exons are amplified in the m-RNA expression analysis and confirm that the primers are specific for GLA expressed isoform.

Methylation analysis of GLA could also be included as supplementary figure.

The figure relative to Western Blot data includes bands intensity quantification, but panel C is not mentioned in the caption. According to Western blot data, the quantification was performed on the bases of the relative expression of GLA compared to house keeping gene GAPDH, however it cannot be excluded that level of expression of GAPDH are also affected by folic acid, therefore quantification of additional house keeping genes or quantification of GLA relative to total protein load could have been performed.

It should be made more clear in the discussion that the presented experiments appoint to a double mechanism of folic acid to stimulate alpha-Galactosidase A production at the expression level and also determine a possible direct interaction with the protein which apparently does not involve the active site of the protein.

Other important limitations of the manuscript are correctly described by the authors (luck of in vivo effect, luck of data to support a clear mechanism such as the identification of the binding site for folic acid or the mechanism that support the increase in GLA m-RNA production).

Reviewer #2: I read with interest the article Human α-Galactosidase A is Stimulated by Folic Acid Supplementation – Possible Implications in Fabry Disease Management by Sabiha Khatoon.

The study reports the effect of a FA supplementation in augmenting AGLA enzymatic activity in-vivo and in a patients with Fabry disease.

Even if the study represents a news and an innovative trial to find further material for FD treatment , I believe that the sample results scarcely representative. The application of the FA supplementation in a single cell-line in a single patients (besides with a late-onset phenotype) represents an important limitation. It could be more interesting if the authors investigate also patients with missense mutation and classic phenotype.

Moreover, the results should better specify the exact percentage or n.of fold of increased AGAL level (compared to the 1.2 fold, 3% of DGJ).

Reviewer #3: General Comments

This study analyses the effect of folic acid supplementation on GLA/α-galactosidase A expression and enzymatic activity, and explores whether FA may enhance DGJ (migalastat)-mediated rescue in a Fabry disease lymphoblastoid cell line. Although the topic is innovative and potentially translationally relevant, several methodological issues should be addressed.

Specific revision comments

1) In Introduction (line 57–60), this paragraph is misleading; FD classification should follow clinical history, GLA gene analysis, α-Gal A assay, and blood accumulation of LysoGb3. (reference: Int. J. Mol. Sci. 2018, 19, 3726; doi:10.3390/ijms19123726). Please discuss this point, adding the reference.

2) In Introduction (also in Abstract), the aims and type of study should be clearly stated at the end of this section (e.g., experimental design, models used, and primary endpoints).

3) In Introduction (line 93–104), the paragraph summarizes the results of the study; therefore, it is out of context and should be erased or moved to the Results/Discussion section.

4) In Methods, AGLA activity is quantified by 4-MU fluorescence after stopping the reaction at pH 11. Since FA is a chromophore and can alter optical readouts and/or quench/enhance fluorescence depending on conditions and may also affect micro-pH or ionic strength, please provide more details regarding this issue.

5) In Methods, the term “Quantitative RT-PCR” should be better defined, specifying quantification method (e.g., ΔΔCt), amplification chemistry, primer efficiencies, reference gene strategy, and whether the plotted metric is truly “fold change” (including how normalization was performed).

6) In Statistics, this section is not sufficient. Authors state: “Each experiment was performed in triplicates. Values are presented as means ± SEM.” However, multiple figure captions say values are medians of three independent experiments with SEM bars. Additionally: Are the “triplicates” technical replicates within one culture, or independent biological replicates? Why are medians used with SEM ? What statistical tests were used, given multiple FA concentrations compared to baseline? Please clarify n, define what is meant by “independent experiments,” adopt consistent summary statistics, and report the full statistical workflow.

7) In Results, Authors state several lysosomal enzymes are unaffected, referring to Table 1. However, Table 1 is only a list of enzymes, not the quantitative activities, variability, or statistical comparisons. Please provide enzyme activity values (or normalized activities) across FA doses with statistics, at least for the most relevant comparator enzymes.

8) In Results, please report disease-relevant substrates, such as Gb3 and/or lyso-Gb3, to support biological relevance beyond enzyme activity.

9) In Discussion, only one FD lymphoblastoid line is tested (male with the Asn215Ser variant and mild manifestations). Considering the wide spectrum of FD, these results cannot be generalized to all FD populations. Please acknowledge this limitation, nuancing the discussion and clearly delimiting the scope of inference.

10) In Conclusion (also in Abstract), Authors state no methylation differences in one CpG island. However, this is insufficient to support conclusions about epigenetic mechanisms. Please nuance the conclusions based on the actual scope of methylation analysis (single region interrogated) and avoid broader mechanistic claims unless additional data are provided.

11) In Competing Interest Statement, Authors state “no competing interest to declare” but also state “Patent Applied For” with a USPTO application number. In addition, the submission form text indicates “no specific funding,” while the Acknowledgments say the study “was supported by funds” from a state office. Please verify disclosures.

12) Figures, the quality should be improved.

**********

-->6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.-->

Reviewer #1: Yes: Saida Ortolano

Reviewer #2: No

Reviewer #3: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

To ensure your figures meet our technical requirements, please review our figure guidelines: https://journals.plos.org/plosone/s/figures

You may also use PLOS’s free figure tool, NAAS, to help you prepare publication quality figures: https://journals.plos.org/plosone/s/figures#loc-tools-for-figure-preparation.

NAAS will assess whether your figures meet our technical requirements by comparing each figure against our figure specifications.

PLoS One. 2026 Jun 10;21(6):e0351438. doi: 10.1371/journal.pone.0351438.r002

Author response to Decision Letter 1

27 Mar 2026

Responses to all reviewer comments are present in the file "Responses to Reviewers".

Responses to all editorial comments are present in the file "Cover letter_Revision".

Attachment

Submitted filename: Response to Reviewers.docx

pone.0351438.s006.docx^{(18.9KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0351438.r003

Decision Letter 1

Tatsuo Shimosawa

20 Apr 2026

-->PONE-D-25-67348R1-->-->Human α-galactosidase A is stimulated by folic acid supplementation – possible implications in Fabry disease management-->-->PLOS One

Dear Dr. Junaid,

Please submit your revised manuscript by Jun 04 2026 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:-->

A letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

-->

As the corresponding author, your ORCID iD is verified in the submission system and will appear in the published article. PLOS supports the use of ORCID, and we encourage all coauthors to register for an ORCID iD and use it as well. Please encourage your coauthors to verify their ORCID iD within the submission system before final acceptance, as unverified ORCID iDs will not appear in the published article. Only the individual author can complete the verification step; PLOS staff cannot verify ORCID iDs on behalf of authors.

We look forward to receiving your revised manuscript.

Kind regards,

Tatsuo Shimosawa, M.D., Ph.D.

Academic Editor

PLOS One

Journal Requirements:

If the reviewer comments include a recommendation to cite specific previously published works, please review and evaluate these publications to determine whether they are relevant and should be cited. There is no requirement to cite these works unless the editor has indicated otherwise.

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

Almost all the concerns were clarified, however, one expert has comments to be answered.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

-->Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.-->

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

-->2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: Yes

Reviewer #3: Yes

**********

-->3. Has the statistical analysis been performed appropriately and rigorously? -->

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

**********

-->4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

-->5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

-->6. Review Comments to the Author

Reviewer #1: I believe that the comments from the reviewers were well addressed and the manuscript improved considerably is quality, however in the statistical analysis author say that they have performed a student t-test, while the comparison of more than two conditions should be done by ANOVA, parametrics or non parametric test, depending on the case. This change won't change the general finding and will be more accurate.

Reviewer #2: the revised form of the article has reached almost of reviewer' suggestions and comments and is now suitable for publication

Reviewer #3: The authors have satisfactorily addressed all the concerns I had with the previous submission and made the necessary changes in the manuscript.

**********

-->7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.-->

Reviewer #1: Yes: Saida Ortolano

Reviewer #2: No

Reviewer #3: No

**********

To ensure your figures meet our technical requirements, please review our figure guidelines: https://journals.plos.org/plosone/s/figures

You may also use PLOS’s free figure tool, NAAS, to help you prepare publication quality figures: https://journals.plos.org/plosone/s/figures#loc-tools-for-figure-preparation.

NAAS will assess whether your figures meet our technical requirements by comparing each figure against our figure specifications.

-->

PLoS One. 2026 Jun 10;21(6):e0351438. doi: 10.1371/journal.pone.0351438.r004

Author response to Decision Letter 2

20 May 2026

We have performed ANOVA analyses as suggested by Reviewer 1, and have incorporated statements in the manuscript. As a result of this, Figures 1, 2 and 6 were slightly modified to remove asterisk and bar showing earlier t-test comparison. We have also included an acknowledgement statement to reflect help from Dr. Michael Flory, our Institute's Research Design and Analysis Services.

Attachment

Submitted filename: Response to Reviewer.docx

pone.0351438.s007.docx^{(13.3KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0351438.r005

Decision Letter 2

Tatsuo Shimosawa

28 May 2026

Human α-galactosidase A is stimulated by folic acid supplementation – possible implications in Fabry disease management

PONE-D-25-67348R2

Dear Dr. Junaid,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. For questions related to billing, please contact billing support.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Tatsuo Shimosawa, M.D., Ph.D.

Academic Editor

PLOS One

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

-->Comments to the Author

Reviewer #1: All comments have been addressed

**********

-->2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

**********

-->3. Has the statistical analysis been performed appropriately and rigorously? -->

Reviewer #1: Yes

**********

-->4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

**********

-->5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

**********

-->6. Review Comments to the Author

Reviewer #1: Authors applied all the suggested improvements to the submitted article. The statistical analysis was correctly modified.

**********

-->7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.-->

Reviewer #1: Yes: Saida Ortolano

**********

PLoS One. doi: 10.1371/journal.pone.0351438.r006

Acceptance letter

Tatsuo Shimosawa

PONE-D-25-67348R2

PLOS One

Dear Dr. Junaid,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS One. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

You will receive further instructions from the production team, including instructions on how to review your proof when it is ready. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few days to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

You will receive an invoice from PLOS for your publication fee after your manuscript has reached the completed accept phase. If you receive an email requesting payment before acceptance or for any other service, this may be a phishing scheme. Learn how to identify phishing emails and protect your accounts at https://explore.plos.org/phishing.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Prof. Tatsuo Shimosawa

Academic Editor

PLOS One

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Lysosomal enzymes tested in the current study with increasing FA concentration.

Enzyme activities were tested by methods described in the reference quoted.

(PDF)

pone.0351438.s001.pdf^{(138.2KB, pdf)}

S2 Table. CpG methylation status around GLA promoter region.

GLA CpG island unique sequence methylation status of the 34 CG sites. The ratio of all these sites is below zero, indicating lack of methylation at any of the sites.

(XLSX)

pone.0351438.s002.xlsx^{(27.1KB, xlsx)}

S3 Table. Data files.

Data used in the current study for figures generated.

(XLSX)

pone.0351438.s003.xlsx^{(17.5KB, xlsx)}

S1 Fig. GLA – CpG island.

GLA CpG island unique sequence; Dark Gray shade is sequencing amplicon, Light Gray shade is region of interest; CG is CG of interest.

(PDF)

pone.0351438.s004.pdf^{(71KB, pdf)}

S1 Raw Images. Original images of Western blot for AGLA staining used in Fig 2B upper and lower panels.

(PDF)

pone.0351438.s005.pdf^{(220KB, pdf)}

Attachment

Submitted filename: Response to Reviewers.docx

pone.0351438.s006.docx^{(18.9KB, docx)}

Attachment

Submitted filename: Response to Reviewer.docx

pone.0351438.s007.docx^{(13.3KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting information files.

[pone.0351438.ref001] 1.Kok K, Zwiers KC, Boot RG, Overkleeft HS, Aerts JMFG, Artola M. Fabry disease: molecular basis, pathophysiology, diagnostics and potential therapeutic directions. Biomolecules. 2021;11(2):271. doi: 10.3390/biom11020271 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref002] 2.Desnick RJ. Fabry Disease: α-Galactosidase A Deficiency. In: Rosenberg RN, Pascua JM, editors. Molecular and Genetic Basis of Neurological and Psychiatric Disease. 5th ed. New York: Academic Press; 2015. pp. 419–30. 10.1016/B978-0-12-410529-4.00038-3 [DOI] [Google Scholar]

[pone.0351438.ref003] 3.Garman SC, Garboczi DN. The molecular defect leading to Fabry disease: structure of human alpha-galactosidase. J Mol Biol. 2004;337(2):319–35. doi: 10.1016/j.jmb.2004.01.035 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref004] 4.Waldek S, Patel MR, Banikazemi M, Lemay R, Lee P. Life expectancy and cause of death in males and females with Fabry disease: findings from the Fabry Registry. Genet Med. 2009;11(11):790–6. doi: 10.1097/GIM.0b013e3181bb05bb [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref005] 5.Spada M, Pagliardini S, Yasuda M, Tukel T, Thiagarajan G, Sakuraba H, et al. High incidence of later-onset fabry disease revealed by newborn screening. Am J Hum Genet. 2006;79(1):31–40. doi: 10.1086/504601 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref006] 6.Chien Y-H, Lee N-C, Chiang S-C, Desnick RJ, Hwu W-L. Fabry disease: incidence of the common later-onset α-galactosidase A IVS4+919G→A mutation in Taiwanese newborns--superiority of DNA-based to enzyme-based newborn screening for common mutations. Mol Med. 2012;18(1):780–4. doi: 10.2119/molmed.2012.00002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref007] 7.Wasserstein MP, Caggana M, Bailey SM, Desnick RJ, Edelmann L, Estrella L, et al. The New York pilot newborn screening program for lysosomal storage diseases: Report of the first 65,000 infants. Genet Med. 2019;21:631–40. doi: 10.1038/s41436-018-0129-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref008] 8.Viggiano E, Politano L. X chromosome inactivation in carriers of Fabry disease: review and meta-analysis. Int J Mol Sci. 2021;22(14):7663. doi: 10.3390/ijms22147663 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref009] 9.Arends M, Wanner C, Hughes D, Mehta A, Oder D, Watkinson OT, et al. Characterization of classical and nonclassical Fabry disease: a multicenter study. J Am Soc Nephrol. 2017;28(5):1631–41. doi: 10.1681/ASN.2016090964 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref010] 10.Doheny D, Srinivasan R, Pagant S, Chen B, Yasuda M, Desnick RJ. Fabry disease: prevalence of affected males and heterozygotes with pathogenic GLA mutations identified by screening renal, cardiac and stroke clinics, 1995-2017. J Med Genet. 2018;55(4):261–8. doi: 10.1136/jmedgenet-2017-105080 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref011] 11.Duro G, Zizzo C, Cammarata G, Burlina A, Burlina A, Polo G, et al. Mutations in the GLA gene and LysoGb3: is it really Anderson-Fabry disease? Int J Mol Sci. 2018;19(12):3726. doi: 10.3390/ijms19123726 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref012] 12.Guce AI, Garman SC. The structure of human α-galactosidase A and implications for Fabry disease. In: Elstein D, Altarescu G, Beck M, editors. Fabry disease. New York: Springer; 2010. pp. 21–38. 10.1007/978-90-481-9033-1 [DOI] [Google Scholar]

[pone.0351438.ref013] 13.Aerts JM, Groener JE, Kuiper S, Donker-Koopman WE, Strijland A, Ottenhoff R, et al. Elevated globotriaosylsphingosine is a hallmark of Fabry disease. Proc Natl Acad Sci U S A. 2008;105(8):2812–7. doi: 10.1073/pnas.0712309105 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref014] 14.Germain DP. Fabry disease. Orphanet J Rare Dis. 2010;5:30. doi: 10.1186/1750-1172-5-30 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref015] 15.Ishii S, Kase R, Okumiya T, Sakuraba H, Suzuki Y. Aggregation of the inactive form of human alpha-galactosidase in the endoplasmic reticulum. Biochem Biophys Res Commun. 1996;220(3):812–5. doi: 10.1006/bbrc.1996.0486 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref016] 16.Desnick RJ. Enzyme replacement therapy for Fabry disease: lessons from two alpha-galactosidase A orphan products and one FDA approval. Expert Opin Biol Ther. 2004;4(7):1167–76. doi: 10.1517/14712598.4.7.1167 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref017] 17.Fan JQ, Ishii S, Asano N, Suzuki Y. Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor. Nat Med. 1999;5(1):112–5. doi: 10.1038/4801 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref018] 18.Lenders M, Stappers F, Brand E. In vitro and in vivo amenability to migalastat in Fabry Disease. Mol Ther Methods Clin Dev. 2020;19:24–34. doi: 10.1016/j.omtm.2020.08.012 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref019] 19.Junaid MA, Kuizon S, Cardona J, Azher T, Murakami N, Pullarkat RK, et al. Folic acid supplementation dysregulates gene expression in lymphoblastoid cells--implications in nutrition. Biochem Biophys Res Commun. 2011;412(4):688–92. doi: 10.1016/j.bbrc.2011.08.027 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref020] 20.Barua S, Chadman KK, Kuizon S, Buenaventura D, Stapley NW, Ruocco F, et al. Increasing maternal or post-weaning folic acid alters gene expression and moderately changes behavior in the offspring. PLoS One. 2014;9(7):e101674. doi: 10.1371/journal.pone.0101674 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref021] 21.Barua S, Kuizon S, Chadman KK, Flory MJ, Brown WT, Junaid MA. Single-base resolution of mouse offspring brain methylome reveals epigenome modifications caused by gestational folic acid. Epigenetics Chromatin. 2014;7(1):3. doi: 10.1186/1756-8935-7-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref022] 22.Tichopad A, Dilger M, Schwarz G, Pfaffl MW. Standardized determination of real-time PCR efficiency from a single reaction set-up. Nucleic Acids Res. 2003;31(20):e122. doi: 10.1093/nar/gng122 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref023] 23.Gavin M, Khatoon S, Marchi EJ, Mevs CA, Bolton DC, Velinov MT, et al. Diagnosis of late-infantile neuronal ceroid lipofuscinosis using dried blood spot-based assay for TPPI enzyme activity: TPPI diagnostic assay from DBS. Clin Chim Acta. 2020;507:62–8. doi: 10.1016/j.cca.2020.04.010 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref024] 24.Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193(1):265–75. doi: 10.1016/s0021-9258(19)52451-6 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref025] 25.Desnick RJ, Allen KY, Desnick SJ, Raman MK, Bernlohr RW, Krivit W. Fabry’s disease: enzymatic diagnosis of hemizygotes and heterozygotes. Alpha-galactosidase activities in plasma, serum, urine, and leukocytes. J Lab Clin Med. 1973;81(2):157–71. [PubMed] [Google Scholar]

[pone.0351438.ref026] 26.Hölzl MA, Gärtner M, Kovarik JJ, Hofer J, Bernheimer H, Sunder-Plassmann G, et al. Quantification of α-galactosidase activity in intact leukocytes. Clin Chim Acta. 2010;411(21–22):1666–70. doi: 10.1016/j.cca.2010.06.023 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref027] 27.Asano N, Ishii S, Kizu H, Ikeda K, Yasuda K, Kato A, et al. In vitro inhibition and intracellular enhancement of lysosomal alpha-galactosidase A activity in Fabry lymphoblasts by 1-deoxygalactonojirimycin and its derivatives. Eur J Biochem. 2000;267(13):4179–86. doi: 10.1046/j.1432-1327.2000.01457.x [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref028] 28.Fan J-Q, Ishii S. Active-site-specific chaperone therapy for Fabry disease. Yin and Yang of enzyme inhibitors. FEBS J. 2007;274(19):4962–71. doi: 10.1111/j.1742-4658.2007.06041.x [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref029] 29.Molloy AM, Pangilinan F, Brody LC. Genetic risk factors for folate-responsive neural tube defects. Annu Rev Nutr. 2017;37:269–91. doi: 10.1146/annurev-nutr-071714-034235 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref030] 30.Rusmini P, Cortese K, Crippa V, Cristofani R, Cicardi ME, Ferrari V, et al. Trehalose induces autophagy via lysosomal-mediated TFEB activation in models of motoneuron degeneration. Autophagy. 2019;15(4):631–51. doi: 10.1080/15548627.2018.1535292 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref031] 31.Linthorst GE, Poorthuis BJHM, Hollak CEM. Enzyme activity for determination of presence of Fabry disease in women results in 40% false-negative results. J Am Coll Cardiol. 2008;51(21). doi: 10.1016/j.jacc.2008.02.050 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref032] 32.Yoshida K, Oshima A, Shimmoto M, Fukuhara Y, Sakuraba H, Yanagisawa N, et al. Human beta-galactosidase gene mutations in GM1-gangliosidosis: a common mutation among Japanese adult/chronic cases. Am J Hum Genet. 1991;49(2):435–42. [PMC free article] [PubMed] [Google Scholar]

[pone.0351438.ref033] 33.Lemansky P, Bishop DF, Desnick RJ, Hasilik A, von Figura K. Synthesis and processing of alpha-galactosidase A in human fibroblasts. Evidence for different mutations in Fabry disease. J Biol Chem. 1987;262(5):2062–5. doi: 10.1016/s0021-9258(18)61618-7 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref034] 34.Kase R, Bierfreund U, Klein A, Kolter T, Itoh K, Suzuki M, et al. Only sphingolipid activator protein B (SAP-B or saposin B) stimulates the degradation of globotriaosylceramide by recombinant human lysosomal alpha-galactosidase in a detergent-free liposomal system. FEBS Lett. 1996;393(1):74–6. doi: 10.1016/0014-5793(96)00863-0 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref035] 35.Sawyer TK, Aral E, Staros JV, Bobst CE, Garman SC. Human saposin B ligand binding and presentation to α-Galactosidase A. bioRxiv. 2004;4. doi: 10.1101/2024.04.04.584535 [DOI] [Google Scholar]

[pone.0351438.ref036] 36.Simerská P, Monti D, Cechová I, Pelantová H, Macková M, Bezouska K, et al. Induction and characterization of an unusual alpha-D-galactosidase from Talaromyces flavus. J Biotechnol. 2007;128(1):61–71. doi: 10.1016/j.jbiotec.2006.09.006 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref037] 37.Choumenkovitch SF, Selhub J, Wilson PWF, Rader JI, Rosenberg IH, Jacques PF. Folic acid intake from fortification in United States exceeds predictions. J Nutr. 2002;132(9):2792–8. doi: 10.1093/jn/132.9.2792 [DOI] [PubMed] [Google Scholar]

[pone.0351438.ref038] 38.Lamari F, Mauhin W, Koraichi F, Khrouf W, Bordet C, London J, et al. Strong increase of leukocyte apha-galactosidase A activity in two male patients with Fabry disease following oral chaperone therapy. Mol Genet Genomic Med. 2019;7(9):e894. doi: 10.1002/mgg3.894 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Human α-galactosidase A is stimulated by folic acid supplementation – possible implications in Fabry disease management

Sabiha Khatoon

Mohammed A Junaid

Roles

Abstract

Introduction

Materials and methods

Cell culture

Nucleic acids extraction, cDNA synthesis

Quantitative PCR

Cytosine methylation

Cell free extracts

AGLA activity

Western blotting

Statistics

Results

Fig 1. AGLA activity in lymphoblastoid cells.

Fig 2. FA supplementation stimulates AGLA expression in lymphoblastoid cells at transcript and protein levels.

Fig 3. Stimulation of recombinant AGLA by FA.

Fig 4. Kinetic properties of recombinant AGLA in the presence of FA.

Fig 5. FA reverses DGJ induced inhibition of recombinant AGLA activity.

Table 1. FA preincubation with AGLA is beneficial.

Fig 6. FA stimulates DGJ mediated rescue of AGLA activity in lymphoblastoid cells from a FD individual.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Tatsuo Shimosawa

Roles

Author response to Decision Letter 1

Decision Letter 1

Tatsuo Shimosawa

Roles

Author response to Decision Letter 2

Decision Letter 2

Tatsuo Shimosawa

Roles

Acceptance letter

Tatsuo Shimosawa

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases