DNA barcoding and phylogenetic insights into the selected endemic flora of the Western Himalayas

Shakila Umer; Khushi Muhammad; Sajjad Sajjad; Latifa AlHusnain; Muneera D F AlKahtani; Abdul Majid; Hamid Ali; Irfan Ullah; Aqib Zeb; Sajad Ali; Azizullah Khalili; Seung Hwan Yang; Sajid Fiaz; Kotb A Attia

doi:10.1038/s41598-026-52399-6

. 2026 Jun 10;16:18009. doi: 10.1038/s41598-026-52399-6

DNA barcoding and phylogenetic insights into the selected endemic flora of the Western Himalayas

Shakila Umer ^1,^#, Khushi Muhammad ^1,^#, Sajjad Sajjad ^1,^✉, Latifa AlHusnain ², Muneera D F AlKahtani ², Abdul Majid ³, Hamid Ali ¹, Irfan Ullah ¹, Aqib Zeb ⁴, Sajad Ali ^5,^✉, Azizullah Khalili ^6,^✉, Seung Hwan Yang ⁷, Sajid Fiaz ^8,^9,^✉, Kotb A Attia ¹⁰

PMCID: PMC13253813 PMID: 42270853

Abstract

The Himalayan region is recognized as one of the world’s major biodiversity hotspots due to its remarkable altitudinal variation, high species richness, and exceptional endemism. Despite its ecological significance, the endemic flora of the western Himalayas remains insufficiently explored at the molecular level. This study aimed to evaluate the performance of multiple nuclear and chloroplast DNA barcode loci (ITS2, rbcL, trnH-psbA, trnA, trnV, rpoB, ycf3, and rbcLa) for the identification and phylogenetic assessment of 32 endemic and threatened plant species representing 31 genera and 24 families from the western Himalayan region of Pakistan, such as Thalictrum secundum Edgew. Aquilegia pubiflora Wall. ex Royle, Anemone obtusiloba D.Don and Delphinium cashmerianum Royle of family (Ranunculaceae), Pimpinella stewartii (C.B. Clarke) Nasir (Umbeliferaceae), Bistorta amplexicaulis (D.Don) Greene, and Bistorta affinis (D.Don) Greene (Polygonaceae) Abelia triflora R.Br. ex Wall. And Lonicera japonica Thunb. (Caprifoliaceae), Aesculus indica (Wall. ex Cambess.) Hook. (Sapindaceae), Arisaema utile Nakai (Araceae), Coriaria nepalensis Wall. (Coriaraceae), Desmodium elegans DC (Papilionacea), Daphne papyracea Wall. ex Steud. (Thymelaceae), Epimedium elatum C.Morren. (Berberidaceae), Galium tetraphyllum. Nazim. & Ehrend. (Rubiaceae), Bupleurum lanceolatum Wall. ex August. and Heracleum polyadenum Franchet (Apiaceae), Impatiens edgeworthii Hook.f. (Balsaminaceae), Incarvillea emodi Chatterjee (Bignoniaceae), Potentilla erecta (L.) Raeusch., Cotoneaster frigidus var. affinis (Lindl.) Wenz., and Spiraea hazarica R.Parker (Rosaceae), Phytolacca latbenia (Moq.) H.Walter. (Phytolaccaceae), Rhamnus parvifolius Bunge. (Rhamnaceae), Thymus linearis Benth. (Lamiaceae), Jasminum leptophyllum Wall. ex G.Don (Oleaceae), Rhododendron lepidotum Wall. ex Hook.f. (Ericaceae), Swertia ciliata Roxb. ex Fleming. (Gentianaceae), Zanthoxylum armatum DC. (Rutaceae), Dioscorea balcanica Kosanin (Dioscoreaceae), and Deutzia staminea R.Br. ex Wall. (Hydrangeaceae). Among the tested markers, rbcL showed the highest PCR amplification (100%) and sequencing success (96%), followed by trnH-psbA (100% amplification, 80% sequencing success), whereas ITS2 exhibited comparatively lower sequencing efficiency (52%). BLAST analysis demonstrated ≥ 97% sequence identity for most taxa, and best Match/Best Close Match analysis indicated higher discrimination efficiency for rbcL and trnH-psbA compared with other loci. Multilocus phylogenetic analysis further confirmed taxonomic placement at the family, genus, and species levels. Overall, this study demonstrates that a multilocus DNA barcoding approach provides reliable species authentication and phylogenetic resolution for endemic Himalayan flora, contributing valuable molecular reference data to global databases and supporting conservation and taxonomic efforts in this biodiversity-rich yet understudied region.

Keywords: DNA barcoding, Biodiversity hotspot, Western Himalayan Pakistan, Biodiversity hotspot, Endemism, Molecular markers, Phylogeny

Subject terms: Ecology, Ecology, Plant sciences, Zoology

Introduction

The Himalayan “Him and Alaya” means “abodes of snow” mountain system, extending over approximately 2400 km across South and Central Asia. It constitutes one of the most significant global biodiversity hotspots¹. Its vast altitudinal gradient, ranging from subtropical foothills to nival zones above 7000 m, generates an extraordinary diversity of ecological niches and microhabitats². The western Himalayan region, encompassing northern Pakistan, northwestern India, and parts of western Nepal, is distinguished by its complex orogeny, varied edaphic conditions, and pronounced climatic heterogeneity³. These factors have facilitated high levels of speciation and endemism, rendering the region a repository of unique genetic resources and an invaluable center of plant diversity⁴.

Floral diversity in the western Himalaya area is the basis of ecosystem stability and is the source of abundant ecosystem services⁵. A large number of species are used as a source of medicine, fragrance, decoration, and food supplements, which are the main ingredients of traditional ethnobotanical knowledge and are the source of rural livelihoods^6,7. In fact, endemic taxa are mainly examples of unique evolutionary lineages which are irreplaceable⁸. Often, they have acquired specialized adaptations for very narrow ecological niches⁹. They have very limited distribution ranges and are thus very susceptible to environmental changes, including human-induced habitat degradation, overharvesting, invasion by alien species, and climate change-driven shrinking of their ranges¹⁰. Their extinction would not only erode global biodiversity but also diminish future opportunities for biotechnological, pharmaceutical, and ecological applications¹¹.

Despite the vast botanical importance of the region, there still exists a major taxonomic and molecular knowledge gap. Historically, conventional plant identification in the western Himalaya has been based on morphological taxonomy that, although being the basis, has limitations such as phenotypic plasticity, developmental variation, seasonal morphology, and the presence of cryptic or closely allied species^12,13. In addition, herbarium collections and floristic inventories for most of the endemic taxa are incomplete or have not been updated, whereas molecular reference sequences for these species are lacking or not at all available in public databases¹⁴. As a result, a great number of plant species in the area were misidentified, undocumented, or totally unrecognized in global biodiversity assessments, thereby hindering the conservation prioritization process¹⁵.

In this context, DNA barcoding is noted as a giant leap for plant systematics and biodiversity research¹⁶. This molecular diagnostic tool takes the use of short, standardized genetic loci typically chloroplast regions such as matK and rbcL, and nuclear regions such as ITS1 and ITS2 to produce repeatable sequence signatures for species-level identification¹⁷. DNA barcoding has several advantages over traditional approaches, such as morphological, physiological, and anatomical. It can provide the correct identification of a sample even if it is a minute or fragmentary material, it can distinguish morphologically similar or cryptic taxa and it also allows integration of regional biodiversity data into global repositories such as the Barcode of Life Data System (BOLD), and GenBank^18–20. Moreover, when combined with phylogenetic analysis, DNA barcoding can elucidate evolutionary relationships, assess genetic distinctiveness, and detect novel previously unreported taxa²¹.

Given the limited molecular characterization of endemic flora from the western Himalayan region, there is a critical need to integrate DNA based approaches for accurate species identification and phylogenetic assessment. Therefore, the main objective of this study was to authenticate selected endemic and rare plant species from the western Himalayas using a multi-locus DNA barcoding strategy and to evaluate their phylogenetic relationships. This study generated and analyzed sequence data from chloroplast and nuclear barcode markers to confirm taxonomic identity, assess genetic relatedness among species, and provide reliable molecular reference records for regionally important endemic taxa. The outcome of this research aims to strengthen molecular taxonomic knowledge of western Himalayan flora and support biodiversity conservation and future genetic resource management in this ecologically sensitive region.

Materials and methods

Introduction to the study area

The current study was carried out in the Himalayan region of Pakistan. The Western Himalayan region in Pakistan, part of the broader Himalayan system, is a key biodiversity hotspot that extends across the northern areas and Azad Jammu and Kashmir, covering approximately 50,916 km²²². It stretches approximately 320 km into Pakistan and is bordered by Himachal Pradesh in India. This region includes three major ranges: Ladakh, Pir Panjal, and Zaskar²³. The area is known for its diverse habitats, primarily broadleaf and coniferous forests, which support a wide range of plant biodiversity, including many medicinal species²⁴. Protected areas such as Ayubia National Park, Gol National Park, Chitral, and Machiara National Park preserve these ecosystems²⁵. Despite its ecological importance, the region remains underexplored due to its remoteness, harsh terrain, and challenging climate. As a result, plant species distribution and diversity are poorly documented²⁶. Comprehensive research is needed to fill these gaps and support conservation efforts. The current study was conducted to explore and document the rich but understudied flora of this significant region (Fig. 1).

Field visit and sample collection

Multiple field visits were conducted across various sites in the Western Himalayan region to document and collect endemic plant species (Fig. 1). All plant material used in this study was collected under a permit issued by the Wildlife Department. Collection, handling, and experimental procedures complied with relevant institutional, national, and international guidelines and legislation for research involving plants. Species were identified based on literature and the Flora of Pakistan, focusing on those with restricted distributions and specific habitat requirements, and their reported locations were verified before fieldwork. During field visits, herbaceous plants were carefully uprooted, while branches with leaves were collected from trees, ensuring the collection of flowers, fruits, leaves, and, when necessary, roots for accurate morphological identification. Collected plant tissues were preserved in plastic bags to maintain specimen quality during transport. The plant samples were collected from the Himalayan region of Pakistan and deposited in the Herbarium of Hazara University for future reference. The voucher identification numbers listed in Table 1 were obtained with the permission of the relevant institutional ethical research cmmittee. Although species identifications are available in online floras with corresponding references, all specimens included in the present study were formally identified and authenticated by Dr. Abdul Majid, Department of Botany, Hazara University, Mansehra, who also provided the voucher specimens (Table 1).

Table 1.

A descriptive table showing the collection site, GPS coordinates, and family details.

Herbarium voucher ID	Family	Species	GPS point	Date of collection	References
6257	Apiaceae	Heracleum polyadenum Franchet	N 34.20 E 73.52 1210 m	14/08/2017	²⁷
6278		Bupleurum lanceolatum Wall. ex August.	N 34.05 E 73.47 3044 m	21/08/2017	²⁸
6312	Araceae	Arisaema utile Nakai	N 34.05 E 73.416 2500 m	23/09/2017	²⁹
6298	Balsaminaceae	Impatiens edgeworthii Hook.f.	N 33.998 E 73.591 1979 m	23/09/2017	²⁹
6299	Berberidaceae	Epimedium elatum C. Morren	N 34.05 E 73.41 1613 m	23/09/2017	³⁰
4626	Bignoniaceae	Incarvillea emodi Chatterjee	N 33.99 E 73.59 1615 m	08/08/2017	²⁹
6240	Caprifoliaceae	Lonicera japonica Thunb.	N 34.340 E 73.738 1945 m	07/12/2018	³¹
6243		Abelia triflora R. Br. ex Wall.	N 34.90 E 73.6 1356 m	23/07/2012	³²
6283	Coriaraceae	Coriaria nepalensis Wall	N 34.239 E 73.20 1486 m	21/08/2017	³³
6244	Papilionacea	Desmodium elegans DC.	N 34.605 E 73.210 2350 m	23/09/2017	³⁴
6272	Rubiaceae	Galium tetraphyllum. Nazim. & Ehrend.	N 34.045 E 73.392 2235 m	20/08/2017	³⁵
6313	Spindaceae	Aesculus indica (Wall.ex Camb.) Hook. f.	N 34.045 E 73.486 2235 m	23/09/201s7	³⁶
6303	Labiateae	Thymus linearis Benth	N 33.88 E 73.36 3338 m	23/09/2017	³⁷
6309	Oleaceae	Jasminum leptophylum Wall. ex G.Don	N 35.60 E 73.09 2345 m	12/10/2012	³⁸
6374	Gentianaceae	Swertia ciliata Roxb. ex Fleming	N 34.170 E 73.640 2336 m	12/10/2012	³⁸
6310	Hydrangeaceae	Deutzia staminea R. Br. ex. Wall.	N 34.100 E 73.35 2350 m	23/09/2017	³²
6266	Polygonaceae	Bistorta amplexicaulis (D. Don) Greene	N 34.078 E 73.740 2236 m	19/08/2017	³⁸
6269		Bistorta affinis (D. Don) Greene	N 33.588 E 73.46 1675 m	21/08/2017	³⁹
6291	Ranunculaceae	Thalictrum secundum Edgew	N 34.045 E 73.392 2235 m	21/8/127	³⁸
6230		Anemone obtusiloba D.Don	N 33.870 E 73.713 1603 m	8/17/2018	³⁸
6233		Delphinium cashmerianum Royle	N 34.639 E 73.468 2067 m	16/10/2017	³⁷
4627		Aquilegia pubiflora Wall. ex Royle	N 34.25 E 73.32 2031 m	17/08/2017	³⁷
6371	Umbeliferaceae	Pimpinella stewartii (C.B. Clarke) Nasir	N 34.29 E 73.34 2041 m	19/10/2017	³⁷
6264	Rhamnaceae	Rhamnus parvifolius Bunge	N 34.20 E 73.02 1231 m	17/08/2017	³⁸
6267	Rosaceae	Spiraea hazarica R.N.parker	N 34.18 E 73.38	23/10/2012	³⁸
6270		Potentilla erecta (L.) Raeusch	N 34.62 E 73.53	23/10/2012	⁴⁰
6268		Cotoneaster frigidus var. affinis (Lindl.) Wenz	N 34.55 E 73.50 1820 m	19/08/2017	⁴¹
6255	Rutaceae	Zanthoxylum armatum DC.	N 34.20 E 73.52 1210 m	12/08/2017	⁴²
6259	Thymelaceae	Daphne papyracea Wall. ex Steud.	N 34.830 E 73.310 4170 m	14/08/2017	⁴³
6292	Dioscoreaceae	Dioscorea balcanica Kosanin	N 34.120 E 73.39 1371 m	23/09/2017	²⁹
6239	Ericaceae	Rhododendron lepidotum Wall. ex Hook.f.	N 34.340 E 73.738 1945 m	10/09/2017	³¹
4628	Phytolaccaceae	Phytolacca latbenia (Moq.) H.Walter.	N 34.25 E 73.45 1315 m	21/09/2016	⁴¹

Open in a new tab

DNA extraction and gel documentation

The CTAB (Cetyl trimethyl ammonium bromide) method was used to extract total genomic DNA with some modifications⁴⁴. A fine powder of the weighed samples was made by grinding in a mortar and pestle. For each 100 mg of ground tissue, 800 µL of pre-warmed CTAB Extraction Buffer was used at 65 °C. The mixture was vortexed thoroughly. The homogenate was then incubated for 2 h at 65 °C. After incubation, 600 µl of PCI was added, and the homogenate was centrifuged for about 20 min at 13,000 rpm. The supernatant, along with 500 µL of ice cold iso-propanol, was frozen overnight⁴⁵. The samples were again centrifuged for 20 min at 13,000 rpm, and then isopropanol was added. 500 µL of 70% ethanol was added, and the samples were centrifuged for 10 min at 13,000 rpm. The tubes were inverted for drying to remove ethanol completely⁴⁶. To dilute the dried sample, 60–80 µL of ddH₂O was added. The concentration and quality of extracted DNA were checked on 1% agarose gel electrophoresis. Added 1 gram of agarose powder in combination with 2 ml TAE in 98 ml dH2O. Preheated the solution in a microwave oven till solution became transparent. 20 uL ethidium bromide was added to the mixture, shaken well, poured into the gel tray, and combs were fitted for well production. The gel was transferred into the gel tank, and the DNA sample of 2 uL was loaded with the addition of 2ul loading dye, connected the power supply, and ran the sample for 20 min. The gel product was confirmed by UV Trans-illuminator⁴⁷.

Primer selection and PCR amplification

The most-studied and well-known primers for the nuclear and chloroplast genomes of plants were selected, as shown in Table 2. The selected primers were amplified according to the prescribed conditions. The volume of 25 µL of PCR reaction mixture was prepared in a 200 µL PCR tube, and each tube contained approximately 14 µl ddH2O, 2 µl of DNA template, 2.5 µl of 10× PCR buffer, 2 µl MgCl2, 2 µl of dNTPs 0.5 units of Taq Polymerase kit (Catalog no. K0171), and 2 µl of each forward primer and reverse primer. Amplification was performed on an Applied Biosystems 2720 Thermal Cycler. The initial step for 5 min at 94 °C was followed by 35 cycles of 30 s at 94 °C, 40 s at 52 °C, 35 s at 72 °C, and 1 cycle at 72 °C for 10 min. The amplified products were electrophoresed on 1% TAE agarose gel.

Table 2.

Detailed description of selected DNA barcoding marker, along with forward and reverse primer sequences and PCR conditions.

Name of barcodes	Sequences (5ʹ to 3ʹ)	References	PCR conditions
ITS2 F ITS2 R	5′GGAAGTAAAAGTCGTAACAAGG3′ 5′TCCTCCGCTTATTGATATGC3′	^48,49	37 cycles, 95°c 20s, 55°c 01 min, 72°c 2 min,, 72°c 10 min, Hold 4°c
RbcL IF RbcL 1351	5′ATGTCACCACAAACAGAGACTAAAG3′ 5′GCAGCAGCTAGTTCCGGGCTCCA3′	^50,51	35 cycles, 94°c 45s, 53°c 30s, 72º 01 min,, 72°c 10 min, Hold 4°c
trnH-psbA F trnH-psbA R	5′GTTATGCATGAATGCTC3′ 5′CGCGCATGGTGGATTCACAATCC3′	^52,53	35 cycles, 94°c 45s, 53°c 30s, 72º 01 min,, 72°c 10 min, Hold 4°c
matK-F matK -R	5′ATTTYTGGARGAYAGAYTDCC3′ 5′CGTRGTATATATCTCRATYTACGC3′	^50,54	30 cycles, 94°c 30s, 50°c 30s 72°c 1.5 min,, 72°c 10 min, Hold 4°c
rbcLa-F rbcLa-R	5′ATGTCCACAAACAGAGACTAAAGC3′ 5′GTAAAATCAAGTCCACCCACG3′	^55,56	40 cycles, 94°c 4 min, 94°c 30s, 55°c 30s, 72°c 30s, 72°c 10 min, Hold 4°c
rpoB-F rpoB-R	5′ATGCAACGTCAAGCAGTTCC3′ 5′GATCCCAGCATCACAATTCC3′	⁵⁷	40 cycles, 94°c 5 min, 94°c 30s, 51°c 30s,, 72°c 10 min, Hold 4°c
trnA-F trnA-R	5′GGTTCAAGTCCCTCTATCCC3′ 5′ATTTGAACTGGTGACACGAG3′	^58,59	40 cycles, 94°c 4 min, 94°c 30s, 52°c 30s, 72°c 30s, 72°c 10 min, Hold 4°c
trnV-F trnV-R	5′GTAGAGCACCTCGTTTACAC3′ 5′CTCGAACCGTAGACCTTCTC3′	^60,61	40 cycles, 94°c 5 min, 94°c 30s, 54°c 30s, 72°c 30s, 72°c 10 min, Hold 4°c.
Ycf3-F Ycf3-R	5′AGAACCGTACTTGAGAGTTTCC3′ 5′CTGTCATTACGTGCGRCTATCT3′	^62,63	40 cycles, 94°c 5 min, 94°c 30s, 54°c 30s, 72°c 30s, 72°c 10 min, Hold 4°c
matK-F matK-R	5′CCCTATTCTATTCAYCCNGA3′ 5′CGTATCGTGCTTTTRTGYTT3′	⁶⁴	40 cycles, 94°c 5 min, 94°c 30s, 50°c 30s, 72°c 30s, 72°c 10 min, Hold 4°c

Open in a new tab

Nucleotide sequencing and analysis

The PCR-amplified products were sequenced using the Sanger method at Macrogn Inc., South Korea. And after successful sequencing, to ensure the resulting sequences accuracy and to recover numerous defined sequences, the BLAST analysis in GenBank was performed to retrieve the most similar sequences based on Max score, total aligned sequence length, query cover, E. Value, and species identity success (https://blast.ncbi.nlm.nih.gov/Blast.cgi)⁶⁵. Sequences of composed data were arranged via Bio Edit (https://bioedit.software.informer.com/7.2/) and multiple sequence alignment (MUSCLE) software (https://www.ebi.ac.uk/jdispatcher/msa/muscle) aligned by ClustalW (https://www.genome.jp/tools-bin/clustalw)^66–68. The resultant data was processed to compute the Kimura-2-parameter (K2P) distances for each region by MEGA software (https://www.megasoftware.net)⁶⁹.

Results

PCR amplification and sequencing success of DNA barcode regions

Initially, 9 different primers targeting the nuclear and chloroplast genomes were used to amplify and sequence 32 species from 21 families to assess amplification, sequencing, and species identification success rates. Among them, the rbcL region showed 100% PCR amplification and 96% sequencing success rates. The matK region showed a 92% amplification rate, with a lower sequencing success rate of 56.5%. The trnH-psbA primer demonstrated 100% amplification and 80% sequencing success, whereas the ITS region showed lower rates: 80.8% amplification and 52.4% sequencing success. Additionally, five barcode regions (trnV, trnA, rbcLa, rpoB, and ycf3) were tested on six endemic species. For rbcLa, amplification success was 100% with 66.6% sequencing success. The ycf3 region showed 66.6% amplification and 75% sequencing rates, while rpoB achieved 83.3% amplification and 60% sequencing success. The trnA and trnV regions showed 83.3% amplification success, with sequencing rates of 66.6% and 83%, respectively. Overall, the highest sequence recovery was observed for rbcL, followed by trnH-psbA and matK, while ITS had the lowest amplification and sequencing success among the tested regions (Table 3).

Table 3.

The amplification and sequencing success rate of the candidate’s barcoding region in the desired species.

DNA barcode region	rbcL	matK	trnH_psbA	ITS	trnA	trnV	rpoB	Ycf3	rbcLa
Total number of species, and amplification success rate in %	26/26 (100)	24/26 (92)	26/26 (100)	21/26 (81)	06/06 (100)	05/06 (83)	05/06 (83)	04/06 (67)	06/06 (100)
Number of species, and sequences success rate in %	25/26 (96)	13/23 (57)	21/26 (80)	10/20 (52)	04/06 (67)	04/06 (67)	03/05 (60)	03/04 (75)	04/05 (66.6)

Open in a new tab

Sequencing success at the family level showed a 100% success rate in Oleaceae, Rhamnaceae, and Balsaminaceae, while several families exhibited moderate to low success rates (Table 3). Among the tested markers, rbcL demonstrated the highest sequencing success rate, with 21 families (91%) successfully sequenced, followed by trnH-psbA, with 13 families. The matK marker showed a 50% success rate in 12 families, while ITS2 had the lowest efficiency, with a 26% success rate across six families. Additionally, trnA, trnV, and rbcLa showed an 80% success rate at the identification level, whereas ITS2 consistently exhibited the lowest performance among the tested barcode regions (Table 4). The obtained nucleotide sequences were further submitted to the online GenBank NCBI database https://www.ncbi.nlm.nih.gov/genbank/ (Table 5).

Table 4.

The descriptive table showing the sequencing success rate of the barcode regions at the family level.

Families	Barcode regions									Overall family success rate %
Families	rbcL	matK	trnH-	ITS	trnA	trnV	Ycf3	rpoB	rbcLa	Overall family success rate %
Ranunculaceae	√	=	√	√	=	√	=	=	√	55
Umbeliferaceae	√	=	=	=	*	*	*	*	*	25
Polygonaceae	√	√	√	=	√	=	=	=	=	45
Caprifoliaceae	√	=	=	=	√	√	=	=	√	45
Araceae	√	√	=	=	*	*	*	*	*	50
Coriaraceae	√	=	=	=	*	*	*	*	*	25
Papilionacea	√	=	=	=	*	*	*	*	*	25
Thymelaceae	√	=	√	=	*	*	*	*	*	50
Berberidaceae	√	=	√	√	*	*	*	*	*	75
Rubiaceae	=	√	=	=	*	*	*	*	*	25
Labiateae	√	√	√	=	*	*	*	*	*	75
Apiaceae	√	√	=	=	*	*	*	*	*	50
Balsaminaceae	√	√	√	√	*	*	*	*	*	100
Bignoniaceae	√	=	=	=	*	*	*	*	*	25
Rosaceae	=	√	√	=	√	√	√	√	√	78
Phytolaccaceae	√	√	=	√	*	*	*	*	*	75
Rhamnaceae	√	√	√	√	*	*	*	*	*	100
Gentianaceae	√	=	√	=	*	*	*	*	*	50
Oleaceae	*	*	*	*	√	√	√	√	√	100
Ericaceae	√	√	√	=	*	*	*	*	*	75
Gentianaceae	√	√	√	=	*	*	*	*	*	75
Rutaceae	√	=	√	√	*	*	*	*	*	75
Dioscoreaceae	=	√	=	=	*	*	*	*	*	25
Hydrangeaceae	√	√	=	=	*	*	*	*	*	50

Open in a new tab

Note: * not used barcode, √ showed success, = showed no results.

Table 5.

Detailed description of the obtained DNA barcode sequences submitted to the online GenBank NCBI database.

Species	Barcode region	GenBank NCBI accession IDs of submitted sequences
Aesculus indica (Wall. ex Cambess.) Hook.	rbcL	LC516689 https://www.ncbi.nlm.nih.gov/nuccore/LC516689
Aesculus indica (Wall. ex Cambess.) Hook.	trnH-psbA	LC516690 https://www.ncbi.nlm.nih.gov/nuccore/LC516690
Anemone obtusiloba D.Don	ITS2	LC511740 https://www.ncbi.nlm.nih.gov/nuccore/LC511740
	rbcL	LC511741 https://www.ncbi.nlm.nih.gov/nuccore/LC5117401
	trnH-psbA	LC511742 https://www.ncbi.nlm.nih.gov/nuccore/LC511742
Arisaema utile Nakai	rbcL	LC521896 https://www.ncbi.nlm.nih.gov/nuccore/LC521896
Bistorta amplexicaulis (D.Don) Greene	matK	LC521897 https://www.ncbi.nlm.nih.gov/nuccore/LC521897
	trnH-psbA	LC521898 https://www.ncbi.nlm.nih.gov/nuccore/LC521898
	rbcL	LC521899 https://www.ncbi.nlm.nih.gov/nuccore/LC51899
Bupleurum lanceolatum Wall. ex August	matK	LC521900 https://www.ncbi.nlm.nih.gov/nuccore/LC521900
Bupleurum lanceolatum Wall. ex August	rbcL	LC521901 https://www.ncbi.nlm.nih.gov/nuccore/LC5219001
Coriaria nepalensis Wall.	rbcL	LC521902 https://www.ncbi.nlm.nih.gov/nuccore/LC521902
Delphinium cashmerianum Royle	rbcL	LC527402 https://www.ncbi.nlm.nih.gov/nuccore/LC527402
Delphinium cashmerianum Royle	trnH-psbA	LC527403 https://www.ncbi.nlm.nih.gov/nuccore/LC527403
Daphne papyracea Wall. ex Steud.	rbcL	LC527404 https://www.ncbi.nlm.nih.gov/nuccore/LC527404
Daphne papyracea Wall. ex Steud.	ITS2	LC527405 https://www.ncbi.nlm.nih.gov/nuccore/LC527405
Epimedium elatum C.Morren.	ITS2	LC510370 https://www.ncbi.nlm.nih.gov/nuccore/LC510370
	rbcL	LC511738 https://www.ncbi.nlm.nih.gov/nuccore/LC511738
	trnH-psbA	LC511739 https://www.ncbi.nlm.nih.gov/nuccore/LC511739
Desmodium elegans DC	rbcL	LC527406 https://www.ncbi.nlm.nih.gov/nuccore/LC527406
Deutzia staminea R.Br. ex Wall.	matK	LC527407 https://www.ncbi.nlm.nih.gov/nuccore/LC527407
Deutzia staminea R.Br. ex Wall.	rbcL	LC527408 https://www.ncbi.nlm.nih.gov/nuccore/LC527408
Dioscorea balcanica Kosanin	matK	LC527409 https://www.ncbi.nlm.nih.gov/nuccore/LC527409
Galium tetraphyllum Nazim. & Ehrend	matK	LC527447 https://www.ncbi.nlm.nih.gov/nuccore/LC527447
Heracleum polyadenum Franchet	rbcL	LC527448 https://www.ncbi.nlm.nih.gov/nuccore/LC527448
Impatiens edgeworthii Hook.f.	ITS2	LC527449 https://www.ncbi.nlm.nih.gov/nuccore/LC527449
	rbcL	LC527450 https://www.ncbi.nlm.nih.gov/nuccore/LC527450
	matK	LC527451 https://www.ncbi.nlm.nih.gov/nuccore/LC527451
Incarvillea emodi Chatterjee	rbcL	LC527452 https://www.ncbi.nlm.nih.gov/nuccore/LC527452
Lonicera japonica Thunb.	rbcL	LC527453 https://www.ncbi.nlm.nih.gov/nuccore/LC527453
Phytolacca latbenia (Moq.) H.Walter.	matK	LC527454 https://www.ncbi.nlm.nih.gov/nuccore/LC527454
	rbcL	LC527455 https://www.ncbi.nlm.nih.gov/nuccore/LC527455
	ITS2	LC527456 https://www.ncbi.nlm.nih.gov/nuccore/LC527456
Rhamnus parvifolius Bunge.	trnH-psbA	LC528220 https://www.ncbi.nlm.nih.gov/nuccore/LC528220
	ITS2	LC528221 https://www.ncbi.nlm.nih.gov/nuccore/LC528221
	matK	LC528222 https://www.ncbi.nlm.nih.gov/nuccore/LC528222
	rbcL	LC528223 https://www.ncbi.nlm.nih.gov/nuccore/LC528223
Rhododendron lepidotum Wall. ex Hook.f.	trnH-psbA	LC528224 https://www.ncbi.nlm.nih.gov/nuccore/LC528224
	matK	LC528225 https://www.ncbi.nlm.nih.gov/nuccore/LC528225
	rbcL	LC528386 https://www.ncbi.nlm.nih.gov/nuccore/LC528386
Swertia ciliata Roxb. ex Fleming.	trnH-psbA	LC528387 https://www.ncbi.nlm.nih.gov/nuccore/LC528387
Thalictrum secundum Edgew.	rbcL	LC528388 https://www.ncbi.nlm.nih.gov/nuccore/LC528388
Thymus linearis Benth.	trnH-psbA	LC528389 https://www.ncbi.nlm.nih.gov/nuccore/LC528389
Thymus linearis Benth.	rbcL	LC528390 https://www.ncbi.nlm.nih.gov/nuccore/LC528390
Potentilla erecta (L) Raeusch	matK	LC528137 https://www.ncbi.nlm.nih.gov/nuccore/LC528137
Pimpinella stewartii (C.B. Clarke) Nasir	rbcL	LC527457 https://www.ncbi.nlm.nih.gov/nuccore/LC527457
Cotoneaster frigidus var. affinis (Lindl.) Wenz.	Ycf3	LC598715 https://www.ncbi.nlm.nih.gov/nuccore/LC598715
Cotoneaster frigidus var. affinis (Lindl.) Wenz.	RpoB	LC598891 https://www.ncbi.nlm.nih.gov/nuccore/LC598891
Zanthoxylum armatum DC	ITS2	LC532160 https://www.ncbi.nlm.nih.gov/nuccore/LC532160

Open in a new tab

Authentication based on BLAST method

BLAST, a similarity-based algorithm, was used to authenticate species by matching query sequences to reference databases, with identification considered successful at ≥ 97% sequence identity and query coverage. The BLAST results helped refine morphological identifications, with our samples showing at least 98% similarity to reference sequences. In this study, newly generated ITS2, rbcL, trnH-psbA, trnA, and rpoB sequences demonstrated 100% query coverage, confirming high accuracy in species identification (Table 6).

Table 6.

The result of BLAST identification of candidate barcode regions.

Species	Barcode region	Max. score	Total score	Query coverage%	E. value	Identity %
Aquilegia pubiflora Wall. ex Royle.	rbcLa	525	525	63	8e-115	97
	rpoB	876	876	100	00	100
	trnV	1038	1038	99	00	100
	Ycf3	1179	1179	99	00	99.24
Abelia triflora R.Br. ex Wall.	trnA	676	676	100	00	100
	rbcLa	968	968	99	00	100
	trnV	911	911	100	00	99.91
Spiraea hazarica R.Parker	trnA	582	582	100	3e_162	99.69
	trnV	1018	1018	100	00	100
	rbcLa	968	968	99	00	99.62
Cotoneaster frigidus var. affinis (Lindl.) Wenz.	Ycf3	896	896	99	00	93
Cotoneaster frigidus var. affinis (Lindl.) Wenz.	rpoB	685	685	100	00	99.60
Bistorta affinis (D.Don) Greene	trnA	496	496	99	4e-136	100
Jasminum leptophyllum Wall. ex G.Don	matK	1168	1168	100	00	94.92
	rbcLa	924	924	100	00	99.
	rpoB	721	721	100	00	97
	trnA	579	579	99	00	98
	trnV	961	961	100	00	98
	Ycf3	1103	1103	100	00	98.71
Anemone obtusiloba D.Don	trnH-psbA	719	719	99	00	100
	ITS2	1133	1133	100	00	100
	rbcL	2289	2289	100	00	100
Thalictrum secundum Edgew.	rbcL	1369	1369	88	00	100
Bupleurum lanceolatum Wall. ex August.	rbcL	1498	1498	99	00	100
Bupleurum lanceolatum Wall. ex August.	matK	278	278	80	00	86
Coriaria nepalensis Wall.	rbcL	1927	1927	94	00	100
Delphinium cashmerianum Royle	rbcL	931	931	81	00	99
Delphinium cashmerianum Royle	trnH-psbA	412	412	70	9e-111	89
Daphne papyracea Wall. ex Steud.	rbcL	1214	1214	84	00	100
Daphne papyracea Wall. ex Steud.	trnH-psbA	1038	1038	100	00	100
Desmodium elegans DC	rbcL	1914	1914	91	00	96.94
Deutzia staminea R.Br. ex Wall.	rbcL	2281	2281	100	00	99.84
Deutzia staminea R.Br. ex Wall.	matK	1833	1833	88	00	92
Dioscorea balcanica Kosanin	matK	1509	1509	100	00	99.52
Epimedium elatum C.Morren.	trnH-psbA	931	931	100	00	98.49
	ITS2	1188	1188	100	00	100
	rbcL	1526	1526	100	00	97.96
Galium tetraphyllum. Nazim. & Ehrend.	rbcL	1834	1834	91	00	92
	trnH-psbA	1295	1295	99	00	100
	matK	534	534	83	2e-147	85
Heracleum polyadenum Franchet	rbcL	1118	1118	100	00	100
Impatiens edgeworthii Hook.f.	ITS2	1868	1868	76	00	99.84
	rbcL	1118	1118	92	00	95.65
	trnH-psbA	580	580	90	00	93.38
	matK	675	675	72	00	82.40
Incarvillea emodi Chatterjee	rbcL	2200	2200	100	00	99.76
Lonicera japonica Thunb.	rbcL	1755	1755	100	00	99
Phytolacca latbenia (Moq.) H.Walter.	matK	1395	1395	99	00	98
	rbcL	2244	2244	100	00	100
	ITS2	1149	1149	100	00	99
Pimpinella stewartii (C.B. Clarke) Nasir	rbcL	1519	1519	100	00	100
Aesculus indica (Wall. ex Cambess.) Hook.	trnH-psbA	817	817	100	00	98.70
Aesculus indica (Wall. ex Cambess.) Hook.	rbcL	1964	1964	100	00	99
Thymus linearis Benth.	trnH-psbA	599	599	98	00	94
Thymus linearis Benth.	rbcL	1544	1544	98	00	95
Swertia ciliata Roxb. ex Fleming.	matK	1325	1325	96	00	99
	rbcL	826	826	100	00	99.59
	trnH-psbA	625	625	93	8e-175	94.47
Rhododendron lepidotum Wall. ex Hook.f.	trnH-psbA	579	579	73	6e-161	98.64
	matK	1162	1162	98	00	95.78
	rbcL	1044	1044	100	00	99.82
Potentilla erecta (L.) Raeusch.	matK	1225	1225	99	00	97.24
Potentilla erecta (L.) Raeusch.	trnH-psbA	486	486	89	4e-133	89.97
Rhamnus parvifolius Bunge.	trnH-psbA	556	556	100	3e-154	90.97
	ITS2	1014	1014	93	00	96
	matK	1273	1273	99	00	99
	rbcL	941	941	62	00	97.48
Arisaema utile Nakai	rbcL	1496	1496	100	00	100
Arisaema utile Nakai	matK	606	606	89	00	99
Bistorta amplexicaulis (D.Don) Greene	matK	900	900	100	00	100
	trnH-psbA	811	811	99	00	100
	rbcL	1864	1864	100	00	99.90
Zanthoxylum armatum DC.	Rbcl	1124	1124	100	00	100
	trnH-psbA	450	450	100	00	95.62
	ITS2	1059	1059	97		100

Open in a new tab

Species discrimination based on Taxon DNA

Species discrimination and identification success were further assessed using the Best Match (BM) and Best Close Match (BCM) functions in Taxon DNA (Species Identifier 1.7.7), based on sequence similarity across all recovered barcode regions. Results showed that rbcL and trnH-psbA provided the highest correct recognition rates, with BM values of 84.6% and 75.0%, respectively (Table 7).

Table 7.

Comparative success rate of used species based on best-match, best-close match of DNA Barcode analyses by using species identifier 1.7.7.

Species	DNA barcode region	Best-Match			Best-close-match			All species barcode
Species	DNA barcode region	Correct %	Incorrect %	Ambiguous %	Correct %	Incorrect %	Ambiguous %	Correct %	Incorrect %	Ambiguous %
Anemone obtusiloba D.Don	trnH-psbA	44	30	25	80	13	1	30	58	12
	ITS2	20	78	3	40	22	30	21	00	79
	rbcL	60	31	6	48	43	00	00	00	43
Arisaema utile Nakai	matK	32	10	58	00	50	50	00	30	80
Arisaema utile Nakai	rbcL	80	20	00	20	30	50	50	10	40
Bistorta amplexicaulis (D.Don) Greene	matK	60	30	10	40	55	26	33	67	50
Bistorta amplexicaulis (D.Don) Greene	trnH-psbA	75	25	00	00	63	36	32	46	24
Bupleurum lanceolatum Wall. ex August.	rbcL	82	9	10	30	70	00	46	00	70
Coriaria nepalensis Wall.	rbcL	78	00	00	80	17	31	00	00	80
Delphinium cashmerianum Royle	rbcL	85	9	16	61	44	69	29	35	44
Delphinium cashmerianum Royle	trnH-psbA	60	49	15	00	54	15	00	00	62
Desmodium elegans DC	rbcL	78	13	35	00	25	00	00	00	25
Daphne papyracea Wall. ex Steud.	rbcL	82	41	00	56	00	00	00	00	00
Deutzia staminea R.Br. ex Wall.	matK	33	27	73	00	27	64	00	00	91
Deutzia staminea R.Br. ex Wall.	rbcL	40	51	00	00	33	00	45	00	33
Dioscorea balcanica Kosanin	matK	27	67	7	27	13	00	00	13	27
Epimedium elatum C.Morren.	ITS2	30	25	75	00	00	75	00	00	75
	trnH-psbA	10	86	14	00	57	14	11	00	71
	rbcL	39	50	21	39	18	48	00	00	00
Galium tetraphyllum. Nazim. & Ehrend.	rbcL	44	13	00	00	77	00	00	00	77
	matK	00	9	00	00	22	00	00	11	11
	trnH-psbA	56	00	44	00	22	11	00	33	00
Heracleum polyadenum Franchet	rbcL	40	60	40	00	40	00	00	40	00
Impatiens edgeworthii Hook.f.	ITS2	34	15	51	00	00	00	00	00	00
	matK	20	80	00	00	22	00	00	00	22
	rbcL	41	67	33	00	50	00	00	00	34
Incarvillea emodi Chatterjee	Rbcl	68	41	00	00	00	00	00	00	00
Lonicera japonica Thunb.	rbcL	83	00	17	00	00	00	00	00	00
Phytolacca latbenia (Moq.) H.Walter.	ITS2	00	92	8	00	23	00	00	23	00
	matK	36	40	00	00	40	00	00	00	60
	rbcL	41	00	00	50	10	40	41	00	00
Pimpinella stewartii (C.B. Clarke) Nasir	rbcL	58	00	42	40	00	00	40	30	31
Potentilla erecta (L.) Raeusch.	matK	10	90	00	00	20	00	00	00	2
Potentilla erecta (L.) Raeusch.	trnH-psbA	44	20	00	44	20	00	00	00	00
Aesculus indica (Wall. ex Cambess.) Hook.	rbcL	55	00	49	40	00	50	55	00	50
Rhamnus parvifolius Bunge.	rbcL	33	67	00	33	00	00	00	00	33
Rhamnus parvifolius Bunge.	ITS2	00	12	00	00	75	00	00	00	75
Rhododendron lepidotum Wall. ex Hook.f.	ITS2	55	00	46	00	30	20	00	50	50
	rbcL	65	20	15	65	00	35	50	00	50
	trnH-psbA	50	31	20	50	31	20	60	40	00
	matK	42	50	10	30	40	30	50	50	00
Swertia ciliata Roxb. ex Fleming.	matK	37	50	3	50	50	00	00	00	00
	rbcL	57	15	4	61	9	00	34	63	7
	trnH-psbA	36	1	2	36	00	00	23	50	21
Thalictrum secundum Edgew.,	rbcL	66	2	00	62	12	4	23	76	00
Thymus linearis Benth.	trnH-psbA	49	28	00	49	28	00	31	67	00
Thymus linearis Benth.	rbcL	50	30	20	50	2	00	42	57	00
Jasminum leptophyllum Wall. ex G.Don	rbcLa	26	50	31	20	40	39	00	70	30
	Ycf3	32	50	20	00	00	100	30	70	00
	rpoB	00	25	75	00	37	25	00	79	00
	trnV	00	00	100	00	100	00	00	00	00
	trnA	20	60	20	00	70	30	00	50	50
Abelia triflora R.Br. ex Wall.	trnV	10	00	00	00	00	00	00	00	00
	trnA	10	10	90	00	100	00	10	21	50
	rbcLa	36	62	00	36	62	00	80	5	00
Spiraea hazarica R.Parker	trnV	17	50	00	27	00	00	00	00	100
	trnA	9	00	00	00	00	00	00	00	98
	rbcLa	51	40	10	51	00	00	00	00	61
Cotoneaster frigidus var. affinis (Lindl.) Wenz.	Ycf3	63	8	00	44	00	00	11	00	21
Cotoneaster frigidus var. affinis (Lindl.) Wenz.	rpoB	33	00	00	15	00	00	00	00	00
Aquilegia pubiflora Wall. ex Royle	trnV	24	16	50	20	00	00	36	00	00
	rpoB	43	65	7	44	13	00	65	00	2
	rbcLa	44	66	00	62	00	00	39	00	00
	Ycf3	10	00	00	15	4	20	31	00	17
	trnV	37	26	00	42	19	00	4	00	00
Bistorta affinis (D.Don) Greene	trnA	30	50	13	00	100	00	61	00	13
Zanthoxylum armatum DC.	rbcL	33	00	00	00	00	00	00	00	00
	trnH-psbA	61	3	00	21	00	00	00	00	00
	ITS2	00	50	00	00	00	00	00	00	00

Open in a new tab

Genetic divergence of candidate barcode regions

The interspecific and intraspecific distances were calculated for distance-based analysis by using ExcaliBar software. DNA barcoding is considered efficient when there is a significant difference between interspecific and intraspecific divergence, and it is also known as the barcoding gap. The barcoding gap occurs when the maximum intraspecific distance is higher than the minimum interspecific distance. In the present study, a clear barcoding gap was found in trnH-psbA, followed by matK and rbcLa (Table 8).

Table 8.

Descriptive table showing Inter and intraspecific distances on the basis of Kimura 2 parameter.

Genetic distance	rbcL	matK	trnH-psbA	ITS2	trnV	trnA	rpoB	Ycf3	rbcLa
Max. Intraspecific distance	0.69	0.39	0.71	0.04	0.31	0.01	0.00	000	0.06
Min. intraspecific distance	0.000	0.00	0.34	00	0.11	0.06	0.00	000	00
Max. interspecific distance	0.748	0.11	0.71	0.57	0.461	0.71	0.71	0.66	0.70
Min. interspecific distance	0.21	0.41	0.90	0.16	0.06	0.03	0.00	0.01	0.11

Open in a new tab

Phylogenetic analysis

For phylogenetic analysis, some reported reference sequences were retrieved from the GenBank database (http://www.ncbi.nlm.nih.gov/genbank/). The phylogenetic analysis was performed using the Neighbour-joining method in MEGA 6. Overall, the phylogenetic tree based on various tested barcode regions showed strong node support and had a powerful resolution between species to differentiate the relationship. In the Neighbour joining tree method, all the candidate barcodes had different degrees of resolution power, but some had similar topology. Among all tested barcode regions, the ITS2 showed slightly low level of resolution power. In some cases, the tested barcode regions showed strong discrimination power but failed to delineate true species boundaries. Some species within the same genus were found in clusters, while others fell outside and occurred in a dispersed form, representing the studied species as an outgroup. The Pairwise Genetic Distance Matrix represented the Evolutionary divergence of the targeted species and the NCBI retrieved species.

Phylogeny of query species based on ITS2 sequence

The ITS2 sequence based phylogeny showed the relationship of query species with reference database sequences, among (LC511740.1-Anemone obtusiloba) clustered with (LC554188.1-Anemone obtusiloba) with bootstrap of 89, (LC510570.1-Epimedium elatum) with (JN010975.1-Epimedium elatum), (LC527449.1-Impatiens edgeworthii) with (JX524787.1-Impatiens glandulifera), (LC527456.1-Phytolacca latbenia) with (OL824848.1-Phytolacca latbenia Walter), (LC528221.1- Rhamnus parvifolius) with (AY626439.1-Rhamnus purpurea), and (LC532160.1 zanthoxylum armatum) with (MH016484.1-zanthoxylum armatum) with a strong bootstrap support of 69, 75, 82, 86, and 87 showed in Fig. 2.

Fig. 2 — Cladogram showing the phylogenetic or evolutionary relationships of endemic flora with database sequences based on the ITS2 primer, which confirms the identification at family, genus, and species levels with strong bootstrap support.

Phylogeny of query species based on matK sequence

The matK based phylogeny showed the relationship of (LC521897.1-Bistorta amplexicaulis) with (KP172064.1-Rydingia limbata), (LC521900.1- Bupleurum lanceolatum) with (MF694831.1-Bupleurum falcatum), and (MK926096.1-Bupleurum rotundifolium), (LC527407.1-Deutzia staminea) with (MH659280.1-Deutzia parviflora), (LC527409.1-Dioscorea balcanica) with (LC327678.1-Dioscorea bulbifera), (LC527451.1-Impatiens edgeworthii) with (KX677366.1-Impatiens glandulifera), (LC527454.1-Phytolacca latbenia) with (MH659547.1-Phytolacca acinosa), and (LC528225.1-Rhododendron lepidotum) with (JF956003.1-Rhododendron lepidotum), while (LC527447.1-Galium tetraphyllum), and (LC528137.1-Potentilla erecta) with the member of genus Rhamnus with bootstraps of 44, 57, 96, 98, 99, and 100 showed in Fig. 3.

Fig. 3 — Cladogram showing the phylogenetic or evolutionary relationships and genetic diversity of the endemic flora, with database sequences based on the chloroplast *mat*K primer, confirming a high identification success rate at the family, genus, and species levels with strong bootstrap support.

Phylogeny of query species based on trnH-psbA sequence

Similarly, phylogeny based on trnH-psbA sequences, the query sequences of (LC511742.1-Anemone obtusiloba) share clade with (LC554187.1-Anemone obtusiloba), (LC516690.1-Aesculus indica) with the member of genus Aesculus, (LC521898.1-Bistorta amplexicaulis) with (EF633739.1-Bistorta amplexicaulis), (LC527403.1-Delphinium cashmerianum) with (OK148444.1-Delphinium montanum), (LC511739.1-Epimedium elatum) with Epimedium spp, (LC528220.1-Rhamnus parvifolius) with (KP299593.1-Rhamnus sphaerosperma), (LC528224.1-Rhododendron lepidotum) with (JN046857.1-Rhododendron lepidotum), (LC528387.1-Swertia ciliata) with Swertia spp, and (LC528389.1-Thymus linearis) with bootstrap of 84 to 100 showed in Fig. 4.

Fig. 4 — Cladogram showing the phylogenetic or evolutionary relationships and genetic diversity of the endemic flora, based on database sequences generated with the chloroplast trnH-psbA primer, confirming a high identification success rate at the family, genus, and species levels with strong bootstrap support.

Phylogeny of query species based on the rbcL sequence

In phylogeny based on rbcL sequence of query sequences showed relationship of (LC516689.1-Asculus indica) with (PP809764.1-Asculus polyneura) with bootstrap of 84, (LC521896.1-Arisaema utile) with (NC064687.1-Arisaema decipiens) and (KJ773277.1-Arisaema dracobtium) with bootstrap of 60, (LC521899.1-Bistorta amplexicaulis) with (EF653765.1-Bistorta amplexicaulis), and (FM883606.1-Bistorta amplexicaulis) with bootstrap of 64, (LC521901.1-Bupleurum lanceolatum) with (OR508826.1-Bupleurum marginatum) with bootstrap of 83, (LC527402.1-Delphinium cashmerianum) with (OK148444.1-Delphinium montanum) with bootstrap of 11, (LC527404.1-Dephne papyracea) with (MG833726.1-Dephne bholua) with bootstrap of 72, (LC527408.1-Deutzia staminea) with (NC057286.1-Deutzia glabrata) with bootstrap of 09, (LC511738.1-Epimedium elatum) with (MW483094.1-Epimedium elatum) with bootstrap of 11, (LC527448.1-Heracleum polyadenum) with (HK518827.1-Heracleum maximum) with bootstrap of 53, (LC527450.1-Impatiens edgeworthii) with (AB043532.1-Impatiens amplexicaulis) with bootstrap of 34, (LC527452.1-Incarvillea emodi) with (JQ933368.1-Incarvillea emodi) with bootstrap of 53, (LC527453.1-Lonicera japonica) with (OP388439.1-Lonicera angustifolia) with bootstrap of 45, (LC527455.1-Phytolacca latbenia) with (NC041113.1-Phytolacca insularis) with bootstrap of 44, (LC528323.1-Rhamnus parvifolius) with (AM235104.1-Rhamnus prinoides) and (ON009012.1- Rhamnus globose) with bootstrap of 57, (LC528386.1-Rhododendron lepidotum) with Rhododendron spp, (LC527457.1-Swertia cilita) with Swertia spp, (LC528388.1-Thalictrum rochebruneanum) with (JX258372.1-Thalictrum macrocarpum) with bootstrap of 56, (LC528390.1-Thymus linearis) with Thymus spp, and (LC527406.1-Ototropis elegans) with (MN267864.1-Semenovia transiliensis) and (NC064353.1-Tordyliopsis brunonis) with bootstraps of 32 showed in Fig. 5.

Fig. 5 — Neighbour-Joining tree showing the phylogenetic or evolutionary relationship and genetic diversity of endemic flora with database sequences based on chloroplast *rbc*L primer, which confirm the identification success rate at family, genus and species.

Discussion

The present study represents the first comprehensive multilocus DNA barcoding effort targeting endemic plant species of the Western Himalayan biodiversity hotspot in Pakistan. This region, although floristically rich, is highly vulnerable to climate change, glacier melting, soil erosion, landslides, habitat fragmentation, and anthropogenic pressure^70,71. Endemic flora are particularly susceptible due to their restricted geographic distribution, medicinal exploitation, and limited conservation management⁷². In this context, accurate molecular identification is essential for documenting and safeguarding regional plant diversity⁷³.

In the current study, a total of 32 endemic species of 31 genera belonging to 24 families were molecularly characterized to establish a reference DNA barcode library. DNA barcoding provides a rapid and standardized approach for species authentication using short genomic rather than whole genomes⁷⁴. This technique has proved to be a rapid, cost effective, and accurate method for species identification⁷⁵. This technique was initially applied in biodiversity records, molecular systematics, and wildlife forensic^76,77.

Barcode performance

Nine loci (trnH-psbA, rbcL, matK, ITS2, rbcLa, trnA, trnV, ycf3, and rpoB) were evaluated amplification efficiency, sequencing success, and discriminatory power. Among these, rbcL and trnH-psbA showed the highest amplification and sequencing success rates, followed by matK. ITS2 showed comparatively lower sequencing efficiency, consistent with challenges commonly reported for nuclear ribosomal in plants.

Potential DNA barcode selection based on amplification, sequencing, and resolving the taxonomic uncertainties is a crucial step in accurate species identification⁷⁸. Quantitative species discrimination analysis demonstrated that rbcL and trnH-psbA achieved the highest identification success under Best Match (BM) and Best Close Match (BCM) criteria. The combined loci e.g., rbcL + matK improved species resolution compared to single markers, supporting the CBOL recommendation of rbcL + matK as core barcode^79,80.

The non-coding intergenic sequence trnH-psbA has widely used in phylogenetic analysis because of its high substitution rate⁸¹. In the present study, trnH-psbA was observed to be an effective marker after rbcL for amplification and sequencing, as well as for sequence recovery. Similarly, trnH-psbA showed 100% success in amplification and sequencing compared with the ITS and matK gene regions⁸². Similarly, in previous studies, the trnH-psbA revealed 97.05% amplification success rate and 92.02% the sequencing success rate⁸³.

Analysis of Kimura 2-parameter (K2P) distances revealed clear interspecific divergence exceeding intraspecific variation in most taxa, indicating the presence of barcode gap for the majority of species. However, a few closely related congeners exhibited overlapping intra-and interspecific distances, explaining cases of reduced resolution⁸⁴.

Taxonomic resolution and clarification of problematic taxa

The molecular data helped clarify identification in several morphologically similar taxa within families such as Ranunculaceae, Apiaceae, Rosaceae, and Caprifoliaceae. In certain cases, preliminary morphology-based identification required re-evaluation after BLAST and phylogenetic analysis indicated alternative placements consistent with reference sequences.

For example, closely related taxa within Apiaceae and Rosaceae that exhibit overlapping vegetative characters were more reliably separated using multilocus data. Instances of low interspecific divergence suggest possible recent speciation events or the need for additional markers in specific genera. No strong evidence of deep cryptic divergence was detected, although a few taxa warrant further population-level study.

These finding demonstrate how DNA barcoding reduces misapplied names, strengthens herbarium voucher authentication, and refines species boundaries in morphologically complex Himalayan taxa.

Phylogenetic reconstruction

Phylogenetic analysis conducted using Neighbour-Joining method through Mega software version 11⁸⁵, with appropriate substitution models and bootstrap support values, confirmed clustering patterns largely consistent with current taxonomic classification at family and genus level. Nodes with bootstrap support > 50% were retained for interpretation, and several clades showed strong statistical support. However, the plastid loci rbcL and trnH-psbA provided stable backbone resolution, while ITS2 contributed additional variation at lower taxonomic levels when successfully amplified. A concatenated multilocus dataset improved overall tree resolution compared to single-locus trees⁸⁶.

DNA barcoding is a widely accepted method to evaluate a suitable barcode region⁸⁷. However, in Best Match, Best Close Match, and species barcode, the highest rate was observed for rbcL and trnH-psbA, followed by matK and rbcLa. The rbcL was the most suitable DNA barcode region at genus level identification, followed by trnH-psbA in species identification, while other barcode regions showed moderate results in identification, consistent with the previous study of⁸⁸.

Species discrimination

A total of 32 endemic plants of 31 genera belonging to 24 families were molecularly characterized and identified at genus, species, and family-level through DNA barcoding, such as Thalictrum secundum, Aquilegia pubiflora, Anemone obtusiloba, and Delphinium cashmerianum of family (Ranunculaceae), Pimpinella stewartii (Umbeliferaceae⁸⁹, Bistorta amplexicualis (Polygonaceae)⁹⁰. Abelia triflora and Lonicera japonica (Caprifoliaceae)⁹¹, Aesculus indica of family (Spindaceae), Arisaema utile of (Arecaceae)⁹², Coriaria and Coriari nepalensis (Coriaracea), Desmodium elegans (Papilionacea), Dephni papyraceae of family (Thymelaceae)⁹³, , Epimedium elatum (Berberidaceae)⁹⁴, Galium tetraphyllum (Rubiaceae)⁹⁵. Bupleurum lanceolatum and Heracleum polyadenum (Apiaceae)⁹⁶, Impatiens edgeworthii, (Balsiminaceae), Incarvelea emodi (Bigononiacea). Potentilla erecta, Cotoneaster Cotoneaster frigidus var. affinis and Spirae hazarica from family (Rosaceae)⁹⁷, Phytolaca latbenia, (Phytolacacea), Rhamnus parvifolius (Rhamnaceae)⁹⁸, Thymus linearis (Labiateae)⁹⁹, Jasminum leptophyllum (Oleaceae)¹⁰⁰, Rhododendron lepidotum (Ericacea)¹⁰¹, Swertia ciliata (Gentianaceae)¹⁰², Zanthoxylum armatum (Rutaceae)¹⁰³, Dioscorea balcanica (Dioscoreaceae)¹⁰⁴, and Deutzia staminea (Hydrangeaceae)¹⁰⁵.

Conservation implications

Accurate species identification is fundamental for conservation planning. Misidentification of endemic or threatened plants can lead to flawed red list assessments, inappropriate conservation priorities, and ineffective protected-area management. By establishing a validated barcode reference library for 32 endemic species, this contributes molecular tools for (i) verification of threatened taxa in Red List evaluations, (ii) Monitoring of medicinal plant trade and prevention of adulteration, (iii) supporting protected-area biodiversity inventories, and (iv) detecting taxonomic ambiguities before conservation decisions. In a biodiversity hotspot such as the western Himalaya, integrating molecular authentication with traditional taxonomy enhances long-term conservation strategies and strengthens evidence-based biodiversity management.

Conclusion

In conclusion, the current study is the first molecular systematic investigation of the endemic flora of the western Himalayan region of Pakistan. Thirty two species were investigated, and different multi-locus markers such as ITS2, matK, rbcL, rpoB, trnA, trnV, trnH-psbA, and ycf3 were applied to check the basic criterion of amplification, sequencing, and species discrimination. Among the tested candidate barcode rbcL showed the highest success rate in amplification and sequencing, followed by trnH-psbA, and matK. At the same time, the remaining primers showed amplification rates greater than 60% in amplification, sequencing, and identification. Overall, DNA barcoding has demonstrated the taxonomic uncertainties in the available flora at the family, genus, and species levels.

Acknowledgements

The authors extend her appreciation to the Deanship of Scientific Research at Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2026R20), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia. The authors gratefully acknowledge the Higher Education Commission (HEC) of Pakistan for financial support under project NRPU-5711, “Identification and Screening of DNA Barcodes of Plant Species Endemic to the Western Himalayas of Pakistan,” and for providing technical assistance and experimental support.

Author contributions

Conceptualization, S.U. and K.M.; methodology, S.U., K.M. and S.S.; software, S.S. and I.U.; validation, K.M., S.S. and H.A.; formal analysis, H.A. and I.U.; investigation, S.U. and I.U.; resources, K.M.; data curation, S.S. and H.A.; writing—original draft preparation, S.U. K.M. and S.S.; writing—review and editing, K.M., S.S., H.A. and I.U.; visualization, S.S. and H.A.; supervision, K.M.; project administration K.M. funding acquisition, Review, Editing, Proof-reading and Technical expertise L.H., M.D.F.A., S.A., A.K., S.H.Y., K.A.A., A.K. and S.F. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Deanship of Scientific Research, Vice Presidency for Graduate Studies and Scientific Research, King Faisal University, Saudi Arabia (KFU262390). This work was also supported by Deanship of Scientific Research at Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2026R20), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.

Data availability

The generated sequencing data has been deposited in NCBI GenBank (https://www.ncbi.nlm.nih.gov/genbank/) with the following accession numbers LC511740, LC511741, LC511742 and others mentioned in Table 5.

Declarations

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Shakila Umer and Khushi Muhammad contributed equally to this work.

Contributor Information

Sajjad Sajjad, Email: Sajjad.pk43@gmail.com.

Sajad Ali, Email: sabhat@kfu.edu.sa.

Azizullah Khalili, Email: azizullah.2010@gmail.com.

Sajid Fiaz, Email: sajidfiaz50@yahoo.com.

References

1.Singh, M. et al. An Overview of Geography and Biodiversity in the Himalayan Region. J. Indian Fisheries Association. 51, 2 (2024). [Google Scholar]
2.Poornima, R. et al. Climate change implications in the Himalayas. The Himalayas in the Anthropocene: Environment and development p. 237–277 (Springer, 2024).
3.Apollo, M. et al. Himalayan nature-based tourism. Potential, regional diversity, nature conservation and touristic load. Int. J. Conserv. Sci.12 (4), 1527–1546 (2021). [Google Scholar]
4.Tiwari, C. & Rani, M. Where the Wild Things Are: Identifying the Factors Behind and Mitigation Measures for Biodiversity Conservation Crisis in Himalayas. People Mountain Environments: Interconnectedness Sustainable Dev. Himalayas. 247, 86 (2025). [Google Scholar]
5.Hussain, S., Sharma, S., Bhatti, R. C. & Singh, A. N. Sustainability in the Indian Himalayan Region: understandings the ecosystem services, climate change impacts, land use shifts and their threats. The Himalayas in the Anthropocene: Environment and Development p. 33–57 (Springer, 2024).
6.Shukla, G., Bhat, J. A., Das, A. P. & Chakravarty, S. Bioprospecting of Ethnomedicinal Plant Resources: Sustainable Utilization and Restoration (CRC, 2024).
7.Shukla, S. et al. Medicinal and aromatic plant cultivation, improvement and conservation for sustainable development. Industrial Crops Improvement: Biotechnological Approaches for Sustainable Agricultural Development p. 183–204 (Springer, 2025).
8.Vargas, P. Exploring ‘endangered living fossils’(ELFs) among monotypic genera of plants and animals of the world. Front. Ecol. Evol.11, 1100503 (2023). [Google Scholar]
9.Veron, S. et al. High evolutionary and functional distinctiveness of endemic monocots in world islands. Biodivers. Conserv.30 (12), 3697–3715 (2021). [Google Scholar]
10.Stys, B. et al. Climate change impacts on Florida’s biodiversity and ecology. Florida’s climate: changes, variations, & impacts. (2017).
11.Halder, M. & Jha, S. The current status of population extinction and biodiversity crisis of medicinal plants. Medicinal Plants: Biodiversity, Biotechnology and Conservation p. 3–38 (Springer, 2023).
12.Muellner-Riehl, A. N. Mountains as evolutionary arenas: patterns, emerging approaches, paradigm shifts, and their implications for plant phylogeographic research in the Tibeto-Himalayan region. Front. Plant Sci.10, 195 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Zaman, W., Ayaz, A. & Park, S. Integrating morphological and molecular data in plant taxonomy. Pak J. Bot.57 (4), 1453–1466 (2025). [Google Scholar]
14.Singh, D. & Pusalkar, P. Floristic diversity of the Indian Himalaya. Biodiversity of the Himalaya: Jammu and Kashmir State p. 93–126 (Springer, 2020).
15.Shweta, S., Dwivedi, A., Subramaniam, B., Kaushik, S. & Sahu, N. Herbaria: a valuable resource of the time treasured historic plant specimens with boundless research potential for environmental sustainability. Environ. Dev. Sustain. 1–41. (2024).
16.Mahadani, P., Dasgupta, M., Vijayan, J., Kar, C. S. & Ray, S. DNA barcoding in plants: past, present, and future p. 331–350 (Springer, 2022). Plant genomics for sustainable agriculture.
17.Erickson, D. L., Spouge, J., Resch, A., Weigt, L. A. & Kress, J. W. DNA barcoding in land plants: developing standards to quantify and maximize success. Taxon57 (4), 1304–1316 (2008). [PMC free article] [PubMed] [Google Scholar]
18.Hubert, N. & Hanner, R. DNA barcoding, species delineation and taxonomy: a historical perspective. DNA Barcodes3(1). (2015).
19.Kowalska, Z., Pniewski, F. & Latała, A. DNA barcoding–A new device in phycologist’s toolbox. Ecohydrol. Hydrobiol.19 (3), 417–427 (2019). [Google Scholar]
20.Jakoby, G. et al. Tree Forensics: Modern DNA barcoding and traditional anatomy identify roots threatening an ancient necropolis. Plants People Planet.3 (2), 211–219 (2021). [Google Scholar]
21.Miralles, A., Puillandre, N. & Vences, M. DNA barcoding in species delimitation: from genetic distances to integrative taxonomy. DNA barcoding: methods and protocols p. 77–104 (Springer, 2024). [DOI] [PubMed]
22.Shaheen, H. et al. From biodiversity hotspot to conservation hotspot: assessing distribution, population structure, associated flora and habitat geography of threatened Himalayan Yew in temperate forest ecosystems of Kashmir. Biodivers. Conserv.33 (2), 553–577 (2024). [Google Scholar]
23.Dar, G. H. & Khuroo, A. A. An introduction to biodiversity of the Himalaya: Jammu and Kashmir state. Biodiversity of the Himalaya: Jammu and Kashmir state p. 3–26 (Springer, 2020).
24.Awan, M. N., Kabir, M., Ahmad, S. & Huettmann, F. The Future of biodiversity in the changing watersheds of Kashmir Himalaya, Pakistan: Conservation challenges and opportunities. In Hindu Kush-Himalaya Watersheds Downhill: Landscape Ecology and Conservation Perspectives. 113 – 33. (2020).
25.Khan, Z. I. Protected areas in Pakistan: Management and issues. J. Natl. Sci. Foundation Sri Lanka. 31, 1–2 (2003). [Google Scholar]
26.Wang, L., Diao, C. & Lu, Y. The role of remote sensing in species distribution models: a review. Int. J. Remote Sens.46 (2), 661–685 (2025). [Google Scholar]
27.Qureshi, H. & Arshad, M. Assumptions for successful plant invasion and Pakistan’s stance regarding biological pollution. Adv. Biology Earth Sci.2 (2), 143–151 (2017). [Google Scholar]
28.Wagay, N. 6. ETHNOBOTANY FROM NORTH KASHMIR-A REVIEW by NA WAGAY. Life Sci. leaflets. 80, 38 (2016). to 60 – 38 to 60. [Google Scholar]
29.Khan, K. R. et al. Comparative study on floristic diversity of protected and unprotected Forests of Sathan Gali, District Mansehra, KP, Pakistan. Acta Ecol. Sin.39 (4), 273–279 (2019). [Google Scholar]
30.Lone, S. A. et al. Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromatic Plants. 5, 72–81 (2017). [Google Scholar]
31.Pathak, M. L., Idrees, M., Poudel, H. R., Nagarkoti, A. B. & Shrestha, A. Nepalese medicinal plants which can develop immune and inhibit viral growth. (2021).
32.Haq, F., Ahmad, H., Ullah, R. & Iqbal, Z. Species diversity and ethno botanical classes of the flora of Allai valley district Battagram Pakistan. Int. J. Plant. Res.2 (4), 111–123 (2012). [Google Scholar]
33.Prakash, P. et al. Documentation of commonly used ethnoveterinary medicines from wild plants of the high mountains in Shimla District, Himachal Pradesh, India. Horticulturae7 (10), 351 (2021). [Google Scholar]
34.Samant, S., Devi, K., Puri, S. & Singh, A. Diversity, distribution pattern and traditional knowledge of sacred plants in Kanawar Wildlife Sanctuary (KWLS), Himachal Pradesh, Northwestern Himalaya. Indian J. Traditional Knowl. (IJTK). 19 (3), 642–651 (2020). [Google Scholar]
35.Kumar, R. R., Chandola, V., Chauhan, J., Prasad, P. & Purohit, V. Medicinal importance swertia speciosa (WALL D. DON): A Review. (2019).
36.Faiz, A. A. H. & Fakhar, I. Utilization and conservation status of plant resources of mountanious range of Pir Punjal of Azad Kashmir, Pakistan. Bangladesh J. Bot.48 (3), 437–447 (2019). [Google Scholar]
37.Chandola, V., Nautiyal, A., Chandra, S. & Ranjan, R. A review on prioritizing conservation of Himalayan medicinal plant species: case of Trillium govanianum (Wall. ex. D. Don) Kunth. J. Med. Plants Stud.7 (5), 23–27 (2019). [Google Scholar]
38.Majid, A. et al. Exploring threatened traditional knowledge; ethnomedicinal studies of rare endemic flora from Lesser Himalayan region of Pakistan. Revista Brasileira de Farmacognosia. 29, 785–792 (2020). [Google Scholar]
39.Ali, A., Badshah, L., Hussain, F. & Shinwari, Z. K. Floristic composition and ecological characteristics of plants of chail valley, district Swat, Pakistan. Pak J. Bot.48 (3), 1013–1026 (2016). [Google Scholar]
40.Haq, S. M., Rashid, I., Malik, A. H., Waheed, M. & Khuroo, A. A. Floristic composition, natural history traits and habitat affiliation in vegetation of major forest types in Jammu and Kashmir, western Himalaya. Nord. J. Bot.2024 (11), e04129 (2024). [Google Scholar]
41.Colomer, J., Pérez-Haase, A., Carrillo, E., Ventura, M. & Ninot, J. M. Fine‐scale vegetation mosaics in Pyrenean mires are driven by complex hydrological regimes and threatened by extreme weather events. Ecohydrology12 (2), e2070 (2019). [Google Scholar]
42.Purohit, S., Joshi, K., Rawat, V., Bhatt, I. D. & Nandi, S. K. Efficient plant regeneration through callus in Zanthoxylum armatum DC: an endangered medicinal plant of the Indian Himalayan region. Plant. Biosystems-An Int. J. Dealing all Aspects Plant. Biology. 154 (3), 288–294 (2020). [Google Scholar]
43.Han, Z. et al. Sulfate conjugation of daphnetin by the human cytosolic sulfotransferases. J. Ethnopharmacol.189, 250–252 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Attitalla, I. H. Modified CTAB method for high quality genomic DNA extraction from medicinal plants. Pak J. Biol. Sci.14 (21), 998–999 (2011). [PubMed] [Google Scholar]
45.Irfan, M. et al. Modification of CTAB protocol for maize genomic DNA extraction. Res. J. Biotechnol.8 (1), 41–45 (2013). [Google Scholar]
46.Aboul-Maaty, N. A. F. & Oraby, H. A. S. Extraction of high-quality genomic DNA from different plant orders applying a modified CTAB-based method. Bull. Natl. Res. Centre. 43 (1), 1–10 (2019). [Google Scholar]
47.Dar, G. J. et al. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification. Open. Life Sci.20 (1), 20221006 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
48.White, T. J., Bruns, T., Lee, S. & Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: guide methods Appl.18 (1), 315–322 (1990). [Google Scholar]
49.Nadiah, N., Mohamed Nor, N., Latiffah, Z. & Masratul Hawa, M. First report of leaf blight on white spider lily caused by Neoscytalidium dimidiatum in Malaysia. New. Disease Rep.35, 16 (2017). [Google Scholar]
50.Hasebe, M. et al. Fern phylogeny based on rbcL nucleotide sequences. Am. Fern J. 134–181 (1995).
51.Thakar, M. K. & Sharma, T. The utility of DNA barcoding technology. Forensic DNA typing: Principles, applications and advancements. 405 (2020).
52.Kress, W. J., Wurdack, K. J., Zimmer, E. A., Weigt, L. A. & Janzen, D. H. Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci.102(23), 8369-8374 (2005). [DOI] [PMC free article] [PubMed]
53.Gutiérrez-López, N. et al. Unique haplotypes of cacao trees as revealed by trnH-psbA chloroplast DNA. PeerJ4, e1855 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Yan, M., Xiong, Y., Liu, R., Deng, M. & Song, J. The application and limitation of universal chloroplast markers in discriminating east Asian evergreen oaks. Front. Plant Sci.9, 569 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Kress, W. J. & Erickson, D. L. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS one. 2 (6), e508 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Strydom, E. & Pietersen, G. Development of a strand-specific RT-PCR to detect the positive sense replicative strand of Soybean blotchy mosaic virus. J. Virol. Methods. 259, 39–44 (2018). [DOI] [PubMed] [Google Scholar]
57.Sudmoon, R. et al. Identifying efficiency in herbal medicine Cinnamomum species (Lauraceae) using banding patterns and sequence alignments of rpoB, rbcL and matK regions. J. Med. Case Rep.41, 1094–1108 (2014). [Google Scholar]
58.Taberlet, P., Gielly, L., Pautou, G. & Bouvet, J. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol.17 (5), 1105–1109 (1991). [DOI] [PubMed] [Google Scholar]
59.Lee, J. Y. et al. Promiscuous methionyl-tRNA synthetase mediates adaptive mistranslation to protect cells against oxidative stress. J. Cell Sci.127 (19), 4234–4245 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Wang, X. R., Tsumura, Y., Yoshimaru, H., Nagasaka, K. & Szmidt, A. E. Phylogenetic relationships of Eurasian pines (Pinus, Pinaceae) based on chloroplast rbcL, matK, rpl20-rps18 spacer, and trnV intron sequences. Am. J. Bot.86 (12), 1742–1753 (1999). [PubMed] [Google Scholar]
61.Yu, M. et al. DNA barcoding of vouchered xylarium wood specimens of nine endangered Dalbergia species. Planta246 (6), 1165–1176 (2017). [DOI] [PubMed] [Google Scholar]
62.Hershkovitz, M. A. Ribosomal and chloroplast DNA evidence for diversification of western American Portulacaceae in the Andean region. Gayana Bot.63 (1), 13–74 (2006). [Google Scholar]
63.Requena, J., Lopez-Pujol, J., Carnicero, P., Susanna, A. & Garcia-Jacas, N. The Centaurea alba complex in the Iberian Peninsula: gene flow, introgression, and blurred genetic boundaries. Plant Syst. Evol.306 (2), 43 (2020). [Google Scholar]
64.Fazekas, A. J. et al. Multiple multilocus DNA barcodes from the plastid genome discriminate plant species equally well. PloS one. 3 (7), e2802 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Madden, T. The BLAST sequence analysis tool. NCBI Handb.2 (5), 425–436 (2013). [Google Scholar]
66.Hall, T. BioEdit version 7.0. 0. Distributed by the author. http://www.mbio.ncsu.edu/BioEdit/bioedit.html (2004).
67.Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res.32 (5), 1792–1797 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Larkin, M. A. et al. Clustal W and Clustal X version 2.0. Bioinformatics. 23(21), 2947–2948 (2007). [DOI] [PubMed]
69.Tamura, K., Stecher, G. & Kumar, S. MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol.38 (7), 3022–3027 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Chettri, N., Rasul, G. & Sharma, E. Managing ecosystem services for enhancing climate change adaptation in the Hindu Kush Himalayas. Impact of Global Changes on Mountains: Responses and Adaptation Taylor and Francis Group. 208–226 (2014).
71.Akram, W. et al. Climate change leading to post-harvest losses of fresh produce. (2024).
72.Shinwari, A. K. et al. Himalayan medicinal plants wealth, threats and conservation for securing the future of biodiversity. Pak J. Bot.56 (6), 2327–2350 (2024). [Google Scholar]
73.Dangwal, L., Singh, T., Singh, A. & Sharma, A. Plant diversity assessment in relation to disturbances in subtropical chirpine forest of the western Himalaya of district Rajouri, J&K, India. Int. J. Plant. Anim. Environ. Sci.2, 206–213 (2012). [Google Scholar]
74.Umer, S., Muhammad, K., Majid, A., Ud-Din, A. & Ahmad, H. DNA barcoding of Anemone obtusiloba var. potentiloides: a threatened and endemic plant from the Western Himalayan region of Pakistan. JAPS: J. Anim. Plant. Sci.32(2) (2022).
75.Valentini, A., Pompanon, F. & Taberlet, P. DNA barcoding for ecologists. Trends Ecol. Evol.24 (2), 110–117 (2009). [DOI] [PubMed] [Google Scholar]
76.Rolo, E. A. et al. Identification of sarcosaprophagous Diptera species through DNA barcoding in wildlife forensics. Forensic Sci. Int.228 (1–3), 160–164 (2013). [DOI] [PubMed] [Google Scholar]
77.Nishant, K., Vrijesh, K. & Ajay, K. Wildlife forensic: current techniques and their limitations. J. Forensic Sci. Criminol.5 (4), 402 (2017). [Google Scholar]
78.Gao, Z., Liu, Y., Wang, X., Wei, X. & Han, J. DNA mini-barcoding: a derived barcoding method for herbal molecular identification. Front. Plant Sci.10, 987 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Kurian, A., Dev, S. A., Sreekumar, V. B. & Muralidharan, E. The low copy nuclear region, RPB2 as a novel DNA barcode region for species identification in the rattan genus Calamus (Arecaceae). Physiol. Mol. Biology Plants. 26 (9), 1875–1887 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
80.Kress, W. J., García-Robledo, C., Uriarte, M. & Erickson, D. L. DNA barcodes for ecology, evolution, and conservation. Trends Ecol. Evol.30 (1), 25–35 (2015). [DOI] [PubMed] [Google Scholar]
81.Thakur, V. V., Tripathi, N. & Tiwari, S. DNA barcoding of some medicinally important plant species of Lamiaceae family in India. Mol. Biol. Rep.48 (4), 3097–3106 (2021). [DOI] [PubMed] [Google Scholar]
82.Ünsal, S. G. et al. Intraspecific discrimination study of wild cherry populations from North-Western Turkey by DNA barcoding approach. Tree. Genet. Genomes. 15 (2), 16 (2019). [Google Scholar]
83.Tan, S. L. et al. DNA barcoding herbaceous and woody plant species at a subalpine forest dynamics plot in Southwest China. Ecol. Evol.8 (14), 7195–7205 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
84.Bolson, M., Smidt, E. C., Brotto, M. L. & Silva-Pereira, V. ITS and trnH-psbA as efficient DNA barcodes to identify threatened commercial woody angiosperms from southern Brazilian Atlantic rainforests. PloS one. 10 (12), e0143049 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
85.Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol.35 (6), 1547–1549 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Chen, Z., Gao, L., Wang, H. & Feng, S. Molecular identification and phylogenetic analysis of Cymbidium species (Orchidaceae) based on the potential DNA barcodes matK, rbcL, psbA-trnH, and internal transcribed spacer. Agronomy14 (5), 933 (2024). [Google Scholar]
87.Hartvig, I., Czako, M., Kjaer, E. D., Nielsen, L. R. & Theilade, I. The use of DNA barcoding in identification and conservation of rosewood (Dalbergia spp). PLoS One. 10 (9), e0138231 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Gholave, A. R., Pawar, K. D., Yadav, S. R., Bapat, V. A. & Jadhav, J. P. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches. Physiol. Mol. Biology Plants. 23 (1), 155–167 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
89.Balkanska, R., Stefanova, K., Stoikova-Grigorova, R. & Ignatova, M. A preliminary assessment of trnH-psbA as DNA barcode for botanical identification of polyfloral honey samples and comparison with rbcL marker. Bulgarian J. Agricultural Sci.26 (1), 238–242 (2020). [Google Scholar]
90.Shafqat, M. et al. DNA barcoding in plants and current molecular issues. Scholars Int. J. Biochem.3 (03), 53–58 (2020). [Google Scholar]
91.Liu, Z., Chen, S-L., Song, J-Y., Zhang, S-J. & Chen, K-L. Application of deoxyribonucleic acid barcoding in Lauraceae plants. Pharmacognosy magazine. 8 (29), 4 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
92.Atria, M., Eurlings, M., Baker, W. J., Dransfield, J. & van Welzen, P. C. Phylogenetic analysis of the Calamus javensis complex (Arecaceae: Calamoideae) in Malesia. Blumea-Biodiversity Evol. Biogeogr. Plants. 65 (3), 205–211 (2020). [Google Scholar]
93.Feng, T. et al. Phylogenetic analysis of Aquilaria Lam.(Thymelaeaceae) based on DNA barcoding. Holzforschung73 (6), 517–523 (2019). [Google Scholar]
94.Guo, M., Xu, Y., Ren, L., He, S. & Pang, X. A systematic study on DNA barcoding of medicinally important genus Epimedium L.(Berberidaceae). Genes9 (12), 637 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
95.Casipit, R. P. A. et al. Genetic diversity of Ixora macrophylla Bartl. and Ixora auriculata Elmer (Rubiaceae) inferred from nrDNA (ITS) and cpDNA (trnL-f) sequence data. Philippine J. Syst. Biol. 14(1). (2020).
96.Jiang, Z. et al. Identification of Apiaceae using ITS, ITS2 and psba-trnH barcodes. Mol. Biol. Rep.50 (1), 245–253 (2023). [DOI] [PubMed] [Google Scholar]
97.Saarela, J. M., Sokoloff, P. C., Gillespie, L. J., Consaul, L. L. & Bull, R. D. DNA barcoding the Canadian Arctic flora: core plastid barcodes (rbcL+ matK) for 490 vascular plant species. PLoS one. 8 (10), e77982 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
98.Muhammad, S. & Siddiqui, M. F. Taxonomic reaffirmation of some members of family Cannabaceae, Moraceae, Rhamnaceae, Rosaceae and Urticaceae of order Rosales using DNA barcoding markers. Pak J. Bot.54 (1), 231–241 (2022). [Google Scholar]
99.Memmedova, P. I. K. & Özdemir, C. Numerical Comparison of Anatomical Features of Lamiaceae Taxa Named After Spil Mountain. Selcuk Univ. J. Sci. Fac.47 (2), 158–167 (2021). [Google Scholar]
100.Hinsinger, D. D. et al. The phylogeny and biogeographic history of ashes (Fraxinus, Oleaceae) highlight the roles of migration and vicariance in the diversification of temperate trees. PloS one. 8 (11), e80431 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
101.Sato, J. J. et al. Potential and pitfalls of the DNA metabarcoding analyses for the dietary study of the large Japanese wood mouse Apodemus speciosus on Seto Inland Sea islands. Mammal study. 44 (4), 221–231 (2019). [Google Scholar]
102.Du, Q. et al. Complete chloroplast genomes of two medicinal Swertia species: the comparative evolutionary analysis of Swertia genus in the Gentianaceae family. Planta256 (4), 73 (2022). [DOI] [PubMed] [Google Scholar]
103.Qin, Y. et al. Taxonomic delimitation and molecular identification of clusters within the species Zanthoxylumnitidum (Rutaceae) in China. PhytoKeys196, 1 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
104.Sheikh, N., Kumar, Y. & Misra, A. Molecular characterization and phylogenetic assessment of a few Dioscorea (Dioscoreaceae) species of North-East India. Indian J. Genet. Plant. Breed.79 (01), 82–88 (2019). [Google Scholar]
105.Acuña, R. et al. Phylogenetic relationships and generic re-arrangements in South Andean Loasas(Loasaceae). Taxon66 (2), 365–378 (2017). [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

[CR1] 1.Singh, M. et al. An Overview of Geography and Biodiversity in the Himalayan Region. J. Indian Fisheries Association. 51, 2 (2024). [Google Scholar]

[CR2] 2.Poornima, R. et al. Climate change implications in the Himalayas. The Himalayas in the Anthropocene: Environment and development p. 237–277 (Springer, 2024).

[CR3] 3.Apollo, M. et al. Himalayan nature-based tourism. Potential, regional diversity, nature conservation and touristic load. Int. J. Conserv. Sci.12 (4), 1527–1546 (2021). [Google Scholar]

[CR4] 4.Tiwari, C. & Rani, M. Where the Wild Things Are: Identifying the Factors Behind and Mitigation Measures for Biodiversity Conservation Crisis in Himalayas. People Mountain Environments: Interconnectedness Sustainable Dev. Himalayas. 247, 86 (2025). [Google Scholar]

[CR5] 5.Hussain, S., Sharma, S., Bhatti, R. C. & Singh, A. N. Sustainability in the Indian Himalayan Region: understandings the ecosystem services, climate change impacts, land use shifts and their threats. The Himalayas in the Anthropocene: Environment and Development p. 33–57 (Springer, 2024).

[CR6] 6.Shukla, G., Bhat, J. A., Das, A. P. & Chakravarty, S. Bioprospecting of Ethnomedicinal Plant Resources: Sustainable Utilization and Restoration (CRC, 2024).

[CR7] 7.Shukla, S. et al. Medicinal and aromatic plant cultivation, improvement and conservation for sustainable development. Industrial Crops Improvement: Biotechnological Approaches for Sustainable Agricultural Development p. 183–204 (Springer, 2025).

[CR8] 8.Vargas, P. Exploring ‘endangered living fossils’(ELFs) among monotypic genera of plants and animals of the world. Front. Ecol. Evol.11, 1100503 (2023). [Google Scholar]

[CR9] 9.Veron, S. et al. High evolutionary and functional distinctiveness of endemic monocots in world islands. Biodivers. Conserv.30 (12), 3697–3715 (2021). [Google Scholar]

[CR10] 10.Stys, B. et al. Climate change impacts on Florida’s biodiversity and ecology. Florida’s climate: changes, variations, & impacts. (2017).

[CR11] 11.Halder, M. & Jha, S. The current status of population extinction and biodiversity crisis of medicinal plants. Medicinal Plants: Biodiversity, Biotechnology and Conservation p. 3–38 (Springer, 2023).

[CR12] 12.Muellner-Riehl, A. N. Mountains as evolutionary arenas: patterns, emerging approaches, paradigm shifts, and their implications for plant phylogeographic research in the Tibeto-Himalayan region. Front. Plant Sci.10, 195 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR13] 13.Zaman, W., Ayaz, A. & Park, S. Integrating morphological and molecular data in plant taxonomy. Pak J. Bot.57 (4), 1453–1466 (2025). [Google Scholar]

[CR14] 14.Singh, D. & Pusalkar, P. Floristic diversity of the Indian Himalaya. Biodiversity of the Himalaya: Jammu and Kashmir State p. 93–126 (Springer, 2020).

[CR15] 15.Shweta, S., Dwivedi, A., Subramaniam, B., Kaushik, S. & Sahu, N. Herbaria: a valuable resource of the time treasured historic plant specimens with boundless research potential for environmental sustainability. Environ. Dev. Sustain. 1–41. (2024).

[CR16] 16.Mahadani, P., Dasgupta, M., Vijayan, J., Kar, C. S. & Ray, S. DNA barcoding in plants: past, present, and future p. 331–350 (Springer, 2022). Plant genomics for sustainable agriculture.

[CR17] 17.Erickson, D. L., Spouge, J., Resch, A., Weigt, L. A. & Kress, J. W. DNA barcoding in land plants: developing standards to quantify and maximize success. Taxon57 (4), 1304–1316 (2008). [PMC free article] [PubMed] [Google Scholar]

[CR18] 18.Hubert, N. & Hanner, R. DNA barcoding, species delineation and taxonomy: a historical perspective. DNA Barcodes3(1). (2015).

[CR19] 19.Kowalska, Z., Pniewski, F. & Latała, A. DNA barcoding–A new device in phycologist’s toolbox. Ecohydrol. Hydrobiol.19 (3), 417–427 (2019). [Google Scholar]

[CR20] 20.Jakoby, G. et al. Tree Forensics: Modern DNA barcoding and traditional anatomy identify roots threatening an ancient necropolis. Plants People Planet.3 (2), 211–219 (2021). [Google Scholar]

[CR21] 21.Miralles, A., Puillandre, N. & Vences, M. DNA barcoding in species delimitation: from genetic distances to integrative taxonomy. DNA barcoding: methods and protocols p. 77–104 (Springer, 2024). [DOI] [PubMed]

[CR22] 22.Shaheen, H. et al. From biodiversity hotspot to conservation hotspot: assessing distribution, population structure, associated flora and habitat geography of threatened Himalayan Yew in temperate forest ecosystems of Kashmir. Biodivers. Conserv.33 (2), 553–577 (2024). [Google Scholar]

[CR23] 23.Dar, G. H. & Khuroo, A. A. An introduction to biodiversity of the Himalaya: Jammu and Kashmir state. Biodiversity of the Himalaya: Jammu and Kashmir state p. 3–26 (Springer, 2020).

[CR24] 24.Awan, M. N., Kabir, M., Ahmad, S. & Huettmann, F. The Future of biodiversity in the changing watersheds of Kashmir Himalaya, Pakistan: Conservation challenges and opportunities. In Hindu Kush-Himalaya Watersheds Downhill: Landscape Ecology and Conservation Perspectives. 113 – 33. (2020).

[CR25] 25.Khan, Z. I. Protected areas in Pakistan: Management and issues. J. Natl. Sci. Foundation Sri Lanka. 31, 1–2 (2003). [Google Scholar]

[CR26] 26.Wang, L., Diao, C. & Lu, Y. The role of remote sensing in species distribution models: a review. Int. J. Remote Sens.46 (2), 661–685 (2025). [Google Scholar]

[CR27] 27.Qureshi, H. & Arshad, M. Assumptions for successful plant invasion and Pakistan’s stance regarding biological pollution. Adv. Biology Earth Sci.2 (2), 143–151 (2017). [Google Scholar]

[CR28] 28.Wagay, N. 6. ETHNOBOTANY FROM NORTH KASHMIR-A REVIEW by NA WAGAY. Life Sci. leaflets. 80, 38 (2016). to 60 – 38 to 60. [Google Scholar]

[CR29] 29.Khan, K. R. et al. Comparative study on floristic diversity of protected and unprotected Forests of Sathan Gali, District Mansehra, KP, Pakistan. Acta Ecol. Sin.39 (4), 273–279 (2019). [Google Scholar]

[CR30] 30.Lone, S. A. et al. Genetic diversity, LCMS based chemical fingerprinting and antioxidant activity of Epimedium elatum Morr & Decne. J. Appl. Res. Med. Aromatic Plants. 5, 72–81 (2017). [Google Scholar]

[CR31] 31.Pathak, M. L., Idrees, M., Poudel, H. R., Nagarkoti, A. B. & Shrestha, A. Nepalese medicinal plants which can develop immune and inhibit viral growth. (2021).

[CR32] 32.Haq, F., Ahmad, H., Ullah, R. & Iqbal, Z. Species diversity and ethno botanical classes of the flora of Allai valley district Battagram Pakistan. Int. J. Plant. Res.2 (4), 111–123 (2012). [Google Scholar]

[CR33] 33.Prakash, P. et al. Documentation of commonly used ethnoveterinary medicines from wild plants of the high mountains in Shimla District, Himachal Pradesh, India. Horticulturae7 (10), 351 (2021). [Google Scholar]

[CR34] 34.Samant, S., Devi, K., Puri, S. & Singh, A. Diversity, distribution pattern and traditional knowledge of sacred plants in Kanawar Wildlife Sanctuary (KWLS), Himachal Pradesh, Northwestern Himalaya. Indian J. Traditional Knowl. (IJTK). 19 (3), 642–651 (2020). [Google Scholar]

[CR35] 35.Kumar, R. R., Chandola, V., Chauhan, J., Prasad, P. & Purohit, V. Medicinal importance swertia speciosa (WALL D. DON): A Review. (2019).

[CR36] 36.Faiz, A. A. H. & Fakhar, I. Utilization and conservation status of plant resources of mountanious range of Pir Punjal of Azad Kashmir, Pakistan. Bangladesh J. Bot.48 (3), 437–447 (2019). [Google Scholar]

[CR37] 37.Chandola, V., Nautiyal, A., Chandra, S. & Ranjan, R. A review on prioritizing conservation of Himalayan medicinal plant species: case of Trillium govanianum (Wall. ex. D. Don) Kunth. J. Med. Plants Stud.7 (5), 23–27 (2019). [Google Scholar]

[CR38] 38.Majid, A. et al. Exploring threatened traditional knowledge; ethnomedicinal studies of rare endemic flora from Lesser Himalayan region of Pakistan. Revista Brasileira de Farmacognosia. 29, 785–792 (2020). [Google Scholar]

[CR39] 39.Ali, A., Badshah, L., Hussain, F. & Shinwari, Z. K. Floristic composition and ecological characteristics of plants of chail valley, district Swat, Pakistan. Pak J. Bot.48 (3), 1013–1026 (2016). [Google Scholar]

[CR40] 40.Haq, S. M., Rashid, I., Malik, A. H., Waheed, M. & Khuroo, A. A. Floristic composition, natural history traits and habitat affiliation in vegetation of major forest types in Jammu and Kashmir, western Himalaya. Nord. J. Bot.2024 (11), e04129 (2024). [Google Scholar]

[CR41] 41.Colomer, J., Pérez-Haase, A., Carrillo, E., Ventura, M. & Ninot, J. M. Fine‐scale vegetation mosaics in Pyrenean mires are driven by complex hydrological regimes and threatened by extreme weather events. Ecohydrology12 (2), e2070 (2019). [Google Scholar]

[CR42] 42.Purohit, S., Joshi, K., Rawat, V., Bhatt, I. D. & Nandi, S. K. Efficient plant regeneration through callus in Zanthoxylum armatum DC: an endangered medicinal plant of the Indian Himalayan region. Plant. Biosystems-An Int. J. Dealing all Aspects Plant. Biology. 154 (3), 288–294 (2020). [Google Scholar]

[CR43] 43.Han, Z. et al. Sulfate conjugation of daphnetin by the human cytosolic sulfotransferases. J. Ethnopharmacol.189, 250–252 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR44] 44.Attitalla, I. H. Modified CTAB method for high quality genomic DNA extraction from medicinal plants. Pak J. Biol. Sci.14 (21), 998–999 (2011). [PubMed] [Google Scholar]

[CR45] 45.Irfan, M. et al. Modification of CTAB protocol for maize genomic DNA extraction. Res. J. Biotechnol.8 (1), 41–45 (2013). [Google Scholar]

[CR46] 46.Aboul-Maaty, N. A. F. & Oraby, H. A. S. Extraction of high-quality genomic DNA from different plant orders applying a modified CTAB-based method. Bull. Natl. Res. Centre. 43 (1), 1–10 (2019). [Google Scholar]

[CR47] 47.Dar, G. J. et al. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification. Open. Life Sci.20 (1), 20221006 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR48] 48.White, T. J., Bruns, T., Lee, S. & Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: guide methods Appl.18 (1), 315–322 (1990). [Google Scholar]

[CR49] 49.Nadiah, N., Mohamed Nor, N., Latiffah, Z. & Masratul Hawa, M. First report of leaf blight on white spider lily caused by Neoscytalidium dimidiatum in Malaysia. New. Disease Rep.35, 16 (2017). [Google Scholar]

[CR50] 50.Hasebe, M. et al. Fern phylogeny based on rbcL nucleotide sequences. Am. Fern J. 134–181 (1995).

[CR51] 51.Thakar, M. K. & Sharma, T. The utility of DNA barcoding technology. Forensic DNA typing: Principles, applications and advancements. 405 (2020).

[CR52] 52.Kress, W. J., Wurdack, K. J., Zimmer, E. A., Weigt, L. A. & Janzen, D. H. Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci.102(23), 8369-8374 (2005). [DOI] [PMC free article] [PubMed]

[CR53] 53.Gutiérrez-López, N. et al. Unique haplotypes of cacao trees as revealed by trnH-psbA chloroplast DNA. PeerJ4, e1855 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR54] 54.Yan, M., Xiong, Y., Liu, R., Deng, M. & Song, J. The application and limitation of universal chloroplast markers in discriminating east Asian evergreen oaks. Front. Plant Sci.9, 569 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR55] 55.Kress, W. J. & Erickson, D. L. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS one. 2 (6), e508 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR56] 56.Strydom, E. & Pietersen, G. Development of a strand-specific RT-PCR to detect the positive sense replicative strand of Soybean blotchy mosaic virus. J. Virol. Methods. 259, 39–44 (2018). [DOI] [PubMed] [Google Scholar]

[CR57] 57.Sudmoon, R. et al. Identifying efficiency in herbal medicine Cinnamomum species (Lauraceae) using banding patterns and sequence alignments of rpoB, rbcL and matK regions. J. Med. Case Rep.41, 1094–1108 (2014). [Google Scholar]

[CR58] 58.Taberlet, P., Gielly, L., Pautou, G. & Bouvet, J. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol.17 (5), 1105–1109 (1991). [DOI] [PubMed] [Google Scholar]

[CR59] 59.Lee, J. Y. et al. Promiscuous methionyl-tRNA synthetase mediates adaptive mistranslation to protect cells against oxidative stress. J. Cell Sci.127 (19), 4234–4245 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR60] 60.Wang, X. R., Tsumura, Y., Yoshimaru, H., Nagasaka, K. & Szmidt, A. E. Phylogenetic relationships of Eurasian pines (Pinus, Pinaceae) based on chloroplast rbcL, matK, rpl20-rps18 spacer, and trnV intron sequences. Am. J. Bot.86 (12), 1742–1753 (1999). [PubMed] [Google Scholar]

[CR61] 61.Yu, M. et al. DNA barcoding of vouchered xylarium wood specimens of nine endangered Dalbergia species. Planta246 (6), 1165–1176 (2017). [DOI] [PubMed] [Google Scholar]

[CR62] 62.Hershkovitz, M. A. Ribosomal and chloroplast DNA evidence for diversification of western American Portulacaceae in the Andean region. Gayana Bot.63 (1), 13–74 (2006). [Google Scholar]

[CR63] 63.Requena, J., Lopez-Pujol, J., Carnicero, P., Susanna, A. & Garcia-Jacas, N. The Centaurea alba complex in the Iberian Peninsula: gene flow, introgression, and blurred genetic boundaries. Plant Syst. Evol.306 (2), 43 (2020). [Google Scholar]

[CR64] 64.Fazekas, A. J. et al. Multiple multilocus DNA barcodes from the plastid genome discriminate plant species equally well. PloS one. 3 (7), e2802 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR65] 65.Madden, T. The BLAST sequence analysis tool. NCBI Handb.2 (5), 425–436 (2013). [Google Scholar]

[CR66] 66.Hall, T. BioEdit version 7.0. 0. Distributed by the author. http://www.mbio.ncsu.edu/BioEdit/bioedit.html (2004).

[CR67] 67.Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res.32 (5), 1792–1797 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR68] 68.Larkin, M. A. et al. Clustal W and Clustal X version 2.0. Bioinformatics. 23(21), 2947–2948 (2007). [DOI] [PubMed]

[CR69] 69.Tamura, K., Stecher, G. & Kumar, S. MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol.38 (7), 3022–3027 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR70] 70.Chettri, N., Rasul, G. & Sharma, E. Managing ecosystem services for enhancing climate change adaptation in the Hindu Kush Himalayas. Impact of Global Changes on Mountains: Responses and Adaptation Taylor and Francis Group. 208–226 (2014).

[CR71] 71.Akram, W. et al. Climate change leading to post-harvest losses of fresh produce. (2024).

[CR72] 72.Shinwari, A. K. et al. Himalayan medicinal plants wealth, threats and conservation for securing the future of biodiversity. Pak J. Bot.56 (6), 2327–2350 (2024). [Google Scholar]

[CR73] 73.Dangwal, L., Singh, T., Singh, A. & Sharma, A. Plant diversity assessment in relation to disturbances in subtropical chirpine forest of the western Himalaya of district Rajouri, J&K, India. Int. J. Plant. Anim. Environ. Sci.2, 206–213 (2012). [Google Scholar]

[CR74] 74.Umer, S., Muhammad, K., Majid, A., Ud-Din, A. & Ahmad, H. DNA barcoding of Anemone obtusiloba var. potentiloides: a threatened and endemic plant from the Western Himalayan region of Pakistan. JAPS: J. Anim. Plant. Sci.32(2) (2022).

[CR75] 75.Valentini, A., Pompanon, F. & Taberlet, P. DNA barcoding for ecologists. Trends Ecol. Evol.24 (2), 110–117 (2009). [DOI] [PubMed] [Google Scholar]

[CR76] 76.Rolo, E. A. et al. Identification of sarcosaprophagous Diptera species through DNA barcoding in wildlife forensics. Forensic Sci. Int.228 (1–3), 160–164 (2013). [DOI] [PubMed] [Google Scholar]

[CR77] 77.Nishant, K., Vrijesh, K. & Ajay, K. Wildlife forensic: current techniques and their limitations. J. Forensic Sci. Criminol.5 (4), 402 (2017). [Google Scholar]

[CR78] 78.Gao, Z., Liu, Y., Wang, X., Wei, X. & Han, J. DNA mini-barcoding: a derived barcoding method for herbal molecular identification. Front. Plant Sci.10, 987 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR79] 79.Kurian, A., Dev, S. A., Sreekumar, V. B. & Muralidharan, E. The low copy nuclear region, RPB2 as a novel DNA barcode region for species identification in the rattan genus Calamus (Arecaceae). Physiol. Mol. Biology Plants. 26 (9), 1875–1887 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR80] 80.Kress, W. J., García-Robledo, C., Uriarte, M. & Erickson, D. L. DNA barcodes for ecology, evolution, and conservation. Trends Ecol. Evol.30 (1), 25–35 (2015). [DOI] [PubMed] [Google Scholar]

[CR81] 81.Thakur, V. V., Tripathi, N. & Tiwari, S. DNA barcoding of some medicinally important plant species of Lamiaceae family in India. Mol. Biol. Rep.48 (4), 3097–3106 (2021). [DOI] [PubMed] [Google Scholar]

[CR82] 82.Ünsal, S. G. et al. Intraspecific discrimination study of wild cherry populations from North-Western Turkey by DNA barcoding approach. Tree. Genet. Genomes. 15 (2), 16 (2019). [Google Scholar]

[CR83] 83.Tan, S. L. et al. DNA barcoding herbaceous and woody plant species at a subalpine forest dynamics plot in Southwest China. Ecol. Evol.8 (14), 7195–7205 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR84] 84.Bolson, M., Smidt, E. C., Brotto, M. L. & Silva-Pereira, V. ITS and trnH-psbA as efficient DNA barcodes to identify threatened commercial woody angiosperms from southern Brazilian Atlantic rainforests. PloS one. 10 (12), e0143049 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR85] 85.Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol.35 (6), 1547–1549 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR86] 86.Chen, Z., Gao, L., Wang, H. & Feng, S. Molecular identification and phylogenetic analysis of Cymbidium species (Orchidaceae) based on the potential DNA barcodes matK, rbcL, psbA-trnH, and internal transcribed spacer. Agronomy14 (5), 933 (2024). [Google Scholar]

[CR87] 87.Hartvig, I., Czako, M., Kjaer, E. D., Nielsen, L. R. & Theilade, I. The use of DNA barcoding in identification and conservation of rosewood (Dalbergia spp). PLoS One. 10 (9), e0138231 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR88] 88.Gholave, A. R., Pawar, K. D., Yadav, S. R., Bapat, V. A. & Jadhav, J. P. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches. Physiol. Mol. Biology Plants. 23 (1), 155–167 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR89] 89.Balkanska, R., Stefanova, K., Stoikova-Grigorova, R. & Ignatova, M. A preliminary assessment of trnH-psbA as DNA barcode for botanical identification of polyfloral honey samples and comparison with rbcL marker. Bulgarian J. Agricultural Sci.26 (1), 238–242 (2020). [Google Scholar]

[CR90] 90.Shafqat, M. et al. DNA barcoding in plants and current molecular issues. Scholars Int. J. Biochem.3 (03), 53–58 (2020). [Google Scholar]

[CR91] 91.Liu, Z., Chen, S-L., Song, J-Y., Zhang, S-J. & Chen, K-L. Application of deoxyribonucleic acid barcoding in Lauraceae plants. Pharmacognosy magazine. 8 (29), 4 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR92] 92.Atria, M., Eurlings, M., Baker, W. J., Dransfield, J. & van Welzen, P. C. Phylogenetic analysis of the Calamus javensis complex (Arecaceae: Calamoideae) in Malesia. Blumea-Biodiversity Evol. Biogeogr. Plants. 65 (3), 205–211 (2020). [Google Scholar]

[CR93] 93.Feng, T. et al. Phylogenetic analysis of Aquilaria Lam.(Thymelaeaceae) based on DNA barcoding. Holzforschung73 (6), 517–523 (2019). [Google Scholar]

[CR94] 94.Guo, M., Xu, Y., Ren, L., He, S. & Pang, X. A systematic study on DNA barcoding of medicinally important genus Epimedium L.(Berberidaceae). Genes9 (12), 637 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR95] 95.Casipit, R. P. A. et al. Genetic diversity of Ixora macrophylla Bartl. and Ixora auriculata Elmer (Rubiaceae) inferred from nrDNA (ITS) and cpDNA (trnL-f) sequence data. Philippine J. Syst. Biol. 14(1). (2020).

[CR96] 96.Jiang, Z. et al. Identification of Apiaceae using ITS, ITS2 and psba-trnH barcodes. Mol. Biol. Rep.50 (1), 245–253 (2023). [DOI] [PubMed] [Google Scholar]

[CR97] 97.Saarela, J. M., Sokoloff, P. C., Gillespie, L. J., Consaul, L. L. & Bull, R. D. DNA barcoding the Canadian Arctic flora: core plastid barcodes (rbcL+ matK) for 490 vascular plant species. PLoS one. 8 (10), e77982 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR98] 98.Muhammad, S. & Siddiqui, M. F. Taxonomic reaffirmation of some members of family Cannabaceae, Moraceae, Rhamnaceae, Rosaceae and Urticaceae of order Rosales using DNA barcoding markers. Pak J. Bot.54 (1), 231–241 (2022). [Google Scholar]

[CR99] 99.Memmedova, P. I. K. & Özdemir, C. Numerical Comparison of Anatomical Features of Lamiaceae Taxa Named After Spil Mountain. Selcuk Univ. J. Sci. Fac.47 (2), 158–167 (2021). [Google Scholar]

[CR100] 100.Hinsinger, D. D. et al. The phylogeny and biogeographic history of ashes (Fraxinus, Oleaceae) highlight the roles of migration and vicariance in the diversification of temperate trees. PloS one. 8 (11), e80431 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR101] 101.Sato, J. J. et al. Potential and pitfalls of the DNA metabarcoding analyses for the dietary study of the large Japanese wood mouse Apodemus speciosus on Seto Inland Sea islands. Mammal study. 44 (4), 221–231 (2019). [Google Scholar]

[CR102] 102.Du, Q. et al. Complete chloroplast genomes of two medicinal Swertia species: the comparative evolutionary analysis of Swertia genus in the Gentianaceae family. Planta256 (4), 73 (2022). [DOI] [PubMed] [Google Scholar]

[CR103] 103.Qin, Y. et al. Taxonomic delimitation and molecular identification of clusters within the species Zanthoxylumnitidum (Rutaceae) in China. PhytoKeys196, 1 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR104] 104.Sheikh, N., Kumar, Y. & Misra, A. Molecular characterization and phylogenetic assessment of a few Dioscorea (Dioscoreaceae) species of North-East India. Indian J. Genet. Plant. Breed.79 (01), 82–88 (2019). [Google Scholar]

[CR105] 105.Acuña, R. et al. Phylogenetic relationships and generic re-arrangements in South Andean Loasas(Loasaceae). Taxon66 (2), 365–378 (2017). [Google Scholar]

PERMALINK

DNA barcoding and phylogenetic insights into the selected endemic flora of the Western Himalayas

Shakila Umer

Khushi Muhammad

Sajjad Sajjad

Latifa AlHusnain

Muneera D F AlKahtani

Abdul Majid

Hamid Ali

Irfan Ullah

Aqib Zeb

Sajad Ali

Azizullah Khalili

Seung Hwan Yang

Sajid Fiaz

Kotb A Attia

Abstract

Introduction

Materials and methods

Introduction to the study area

Fig. 1.

Field visit and sample collection

Table 1.

DNA extraction and gel documentation

Primer selection and PCR amplification

Table 2.

Nucleotide sequencing and analysis

Results

PCR amplification and sequencing success of DNA barcode regions

Table 3.

Table 4.

Table 5.

Authentication based on BLAST method

Table 6.

Species discrimination based on Taxon DNA

Table 7.

Genetic divergence of candidate barcode regions

Table 8.

Phylogenetic analysis

Phylogeny of query species based on ITS2 sequence

Fig. 2.

Phylogeny of query species based on matK sequence

Fig. 3.

Phylogeny of query species based on trnH-psbA sequence

Fig. 4.

Phylogeny of query species based on the rbcL sequence

Fig. 5.

Discussion

Barcode performance

Taxonomic resolution and clarification of problematic taxa

Phylogenetic reconstruction

Species discrimination

Conservation implications

Conclusion

Acknowledgements

Author contributions

Funding

Data availability

Declarations

Competing interests

Footnotes

Contributor Information

References

Associated Data

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases