GAS5 mediates notch signaling to exacerbate calcium oxalate-induced renal injury through the NF-κB/NLRP3 axis by promoting macrophage polarization

Abstract

The contribution of macrophage polarization dysregulation to calcium oxalate (CaOx) nephrolithiasis remains poorly defined. Here, we identify the long non-coding RNA growth arrest-specific transcript 5 (GAS5) as a critical driver of pro-inflammatory M1 macrophage polarization through the Notch/NF-κB/NLRP3 axis, thereby aggravating CaOx-induced renal injury. In human macrophages, calcium oxalate monohydrate (COM) stimulation upregulates GAS5 expression, which functions as a competing endogenous RNA by sequestering miR-449c-5p, leading to derepression of Notch1 and amplification of downstream inflammatory signaling. Activated Notch1 engages TLR4 to trigger NF-κB/NLRP3 inflammasome activation, promoting M1 polarization, inflammatory cytokine release, tubular epithelial pyroptosis, and enhanced crystal adhesion. Given the limited conservation of lncRNA-miRNA interactions across species, we further delineated a species adaptive regulatory mechanism in mice. In murine macrophages, GAS5 enhances Notch1 signaling through sequestration of a distinct miRNA, miR-325-3p, thereby preserving the core ceRNA logic while employing different miRNA mediators. In vivo, macrophage enriched GAS5 overexpression exacerbates Gly induced CaOx deposition, renal dysfunction, and inflammation, whereas pharmacological inhibition of Notch signaling or TLR4 knockdown markedly attenuates these effects. Conversely, restoration of the corresponding regulatory miRNAs suppresses Notch1 signaling and favors anti-inflammatory macrophage polarization. Together, these findings uncover a conserved, yet species-adaptive, GAS5 centered ceRNA regulatory framework that governs macrophage driven inflammation and renal injury in CaOx nephrolithiasis, highlighting GAS5-Notch signaling as a potential immunomodulatory target for nephrolithiasis.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00018-026-06233-x.

Introduction

Nephrolithiasis, a prevalent urological disorder worldwide, exhibits significant variation in its disease burden among regions [1, 2]. Epidemiological studies over the past five years have shown a continuous increase in both the incidence and recurrence rates of nephrolithiasis [3, 4], these trends are primarily associated with metabolic abnormalities and environmental factors [5–8]. From a pathological composition perspective, calcium oxalate (CaOx) constitutes the predominant component of kidney stones, accounting for approximately 70% to 80% of all cases [9, 10]. The formation of CaOx stones is an exceedingly complex process, with oxalate metabolism dysregulation being recognized as a key factor. Elevated oxalate concentrations in the urine lead to the deposition of CaOx crystals within the renal system, thereby inducing injury and apoptosis of renal tubular epithelial cells [11]. At the cellular and molecular level, oxidative stress, inflammation, and particularly macrophage polarization are also implicated in the pathogenesis of CaOx stone formation [12, 13]. The plasticity and regulatory mechanisms of macrophage polarization in the pathogenesis of urolithiasis have emerged as a key research focus in recent years [14, 15]. We know that the mononuclear phagocyte system contributes to microenvironmental homeostasis through the dynamic balance of M1/M2 macrophage phenotypes [16]. Monocyte-derived macrophages exhibit remarkable plasticity and heterogeneity, allowing them to be activated into either classically pro-inflammatory (M1) macrophages or alternatively anti-inflammatory (M2) macrophages in response to distinct microenvironmental cues [17–19]. During the formation of CaOx kidney stones, macrophage polarization plays a crucial role. M1 macrophages facilitate crystal deposition while exacerbating inflammation, whereas M2 macrophages mitigate renal injury and inhibit stone formation by enhancing crystal phagocytosis [14, 20]. Thus, modulating this dynamic balance could be a novel therapeutic target for nephrolithiasis. However, the precise mechanisms by which macrophage polarization influences CaOx nephrolithiasis remain incompletely understood.

The Notch signaling pathway, an evolutionarily conserved intercellular communication system, regulates cell fate determination, differentiation, and immune function modulation through ligand-receptor interactions [21–23]. In mammals, the Notch family consists of four receptors (Notch1-4) and multiple ligands, including Jagged1/2 and DLL1/3/4. Ligand binding to its corresponding receptor initiates a γ-secretase-mediated proteolytic cascade, ultimately releasing the Notch intracellular domain (NICD) [24, 25]. Studies have demonstrated that macrophages express multiple Notch receptors and ligands, with the Jagged1-Notch1 axis modulating M1 macrophage polarization in an RBP-Jκ-dependent manner [26, 27]. However, the precise molecular mechanisms by which Notch signaling modulates macrophage polarization during CaOx nephrolithiasis formation remain to be fully elucidated.

Nuclear factor-kappa B (NF-κB) signaling as a pivotal hub in inflammation regulation orchestrates immunoresponses and tissue homeostasis via tightly controlled cascade mechanisms [28]. Under steady state conditions, the NF-κB complex is sequestered in the cytoplasm in an inactive form. Upon recognition of pathogen-associated molecular patterns (PAMPs) or damage associated molecular patterns (DAMPs), NF-κB undergoes phosphorylation, triggering ubiquitin proteasome mediated degradation of IκB inhibitors and enabling nuclear translocation. Nuclear NF-κB binds to κB sites within promoters of pro-inflammatory genes such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-12 (IL-12), driving inflammatory mediator release and immune cell infiltration [29, 30]. This axis is central not only in various inflammatory disorders but also implicated in the pathogenesis of CaOx nephrolithiasis [10, 31]. Notably, NLRP3 inflammasome activation forms a positive regulatory loop with NF-κB signaling: NF-κB priming enhances NLRP3 expression, and NLRP3 activation further amplifies NF-κB mediated inflammation [32]. Our previous work demonstrated that CaOx crystals directly activate the NLRP3 inflammasome, eliciting intra-renal inflammation and inducing tubular cell pyroptosis, thereby exacerbating injury [33, 34]. In vivo two-photon imaging further confirmed that mitochondrial ROS burst in M1 macrophages within the stone microenvironment promotes NLRP3 inflammasome assembly [35, 36]. Given that both NF-κB and NLRP3 function as key inflammatory pathways facilitating M1 macrophage polarization [12, 37], whether their activation is finely tuned by other critical signal cascades, such as the Notch signaling pathway, to influence macrophage polarization dynamics within the stone microenvironment remains largely unexplored.

Long non-coding RNAs (lncRNAs), a class of functional non-coding transcripts exceeding 200 nucleotides in length, participate in disease regulatory networks through multiple mechanisms, including epigenetic modulation, transcriptional interference, and post transcriptional modifications [38, 39]. Recent studies have revealed that lncRNAs can interact with specific microRNAs (miRNAs) via base pairing in the 3′-untranslated region (3′-UTR), forming competing endogenous RNA (ceRNA) networks to regulate downstream signaling pathways [40]. For instance, in the context of nephrolithiasis, lncRNA XIST has been shown to mediate inflammatory responses and reactive oxygen species (ROS) bursts via the miR-223-3p/NLRP3 axis, thereby promoting CaOx crystal adhesion to the renal epithelium [41]. Meanwhile, the interaction between lncRNA H19 and miR-216b is also implicated in renal tubular epithelial injury in a CaOx-induced mouse model [42]. Notably, growth arrest specific transcript 5 (GAS5) is a key long noncoding RNA involved in the regulation of cell cycle progression and cellular stress responses, and it exhibits highly dynamic expression patterns within inflammatory microenvironments [43]. Accumulating evidence indicates that both the expression level and functional status of GAS5 are closely associated with the risk and progression of various renal diseases. Specifically, GAS5 has been shown to play important regulatory roles in the initiation and progression of renal cell carcinoma and renal fibrosis. Moreover, in more prevalent renal disorders, such as diabetic nephropathy and acute kidney injury, aberrant GAS5 expression has likewise been implicated in exacerbating renal tissue damage and influencing disease outcomes [44, 45]. Previous studies have further suggested that GAS5 not only promotes apoptosis in renal tubular epithelial cells but also participates in the regulation of macrophage activation states [45, 46]. However, whether GAS5 mediates immune responses to CaOx crystals, and the precise roles and molecular mechanisms by which it contributes to kidney stone formation, remain largely unclear. In particular, it is unknown whether GAS5 regulates crystal deposition and remodeling of the renal immune microenvironment through a ceRNA network. Addressing these questions will help elucidate the role of GAS5-driven immune regulation in the pathogenesis of CaOx nephrolithiasis, thereby providing a novel theoretical basis for the development of targeted therapeutic strategies.

This study systematically analyzed the regulatory network of macrophage heterogeneity in CaOx crystal-induced kidney injury. We observed a significant expansion of the pro-inflammatory M1 macrophage subset within the lithogenic microenvironment, which exacerbated renal tubular epithelial cell damage and accelerated stone formation by releasing inflammatory factors. Furthermore, our findings suggest that macrophage phenotypes may be reprogrammed in a COM-rich environment through the GAS5-Notch-NF-κB/NLRP3 axis. COM stimulation induces macrophages to release NICD, thereby promoting M1 macrophage polarization via the NF-κB/NLRP3 signaling pathway. Additionally, we identified a marked upregulation of the long non-coding RNA GAS5 in pro-inflammatory M1 macrophages upon COM exposure, with GAS5 closely associated with activation of the Notch signaling pathway. Mechanistically, in human macrophages, GAS5 functions as a competing endogenous RNA to modulate macrophage polarization by sequestering miR-449c-5p, thereby derepressing Notch1 and amplifying downstream inflammatory signaling. Considering the limited conservation of lncRNA-miRNA interactions across species, we further delineated a species-adaptive regulatory mechanism in murine macrophages, in which GAS5 enhances Notch1 signaling through a distinct miRNA mediator. Functionally, macrophage enriched GAS5 overexpression markedly aggravated renal inflammation and injury in a mouse model of CaOx nephrolithiasis. Collectively, our findings reveal that GAS5 drives M1 macrophage polarization by reinforcing Notch-NF-κB/NLRP3 inflammatory signaling through a conserved yet species-adaptive ceRNA regulatory framework, thereby exacerbating CaOx-induced kidney injury.

Materials and methods

Clinical kidney specimens

Renal tissue samples were obtained from patients undergoing nephrectomy at The Second Hospital of Tianjin Medical University. In the CaOx group, samples were collected from two categories of patients: pure nephrolithiasis cases, in whom end-stage non-functioning kidneys secondary to nephrolithiasis required radical nephrectomy (n = 6); and patients with concurrent nephrolithiasis and renal cell carcinoma (RCC) (n = 4). For the control group, renal tissues were collected from tumor adjacent renal parenchyma of RCC nephrectomy specimens (n = 10). To minimize potential field effects, adjacent normal tissues were obtained from areas as distant as possible from the tumor margin. All sampled tissues were confirmed by pathological examination to be free of tumor infiltration and significant inflammation. This approach has been widely adopted in renal translational studies when healthy nephrectomy tissue (e.g., healthy tissue from nephrectomies due to trauma) is not available [47, 48]. This study was approved by the Institutional Ethics Committee of the Second Hospital of Tianjin Medical University (KY2024K242), and informed consent was obtained from all participants. Detailed demographic and clinical characteristics of all patients are provided in Supplementary Table S1.

Cell culture and macrophage polarization

THP-1 human acute monocytic leukemia cells (Wuhan PunoSai Life Science) were maintained in RPMI-1640 medium, HK-2 human renal proximal tubule cells (ATCC) and RAW264.7 cells were maintained in DMEM medium, each supplemented with 10% FBS (Gibco) and 1% penicillin–streptomycin (Gibco). All cultures were incubated at 37 °C/5% CO₂. For THP-1 cells in the logarithmic growth phase, cells were treated with 100 ng/mL phorbol 12-myristate 13-acetate (PMA) for 24 h to induce adhesion, differentiating into M0 macrophages. After removing the supernatant, cells were washed three times with sterile PBS and used for subsequent experiments. Stable TLR4 knockdown (LV-sh-TLR4) and control (LV-Ctrl) THP-1 cells were constructed using lentivirus and selected with fluorescence microscopy and puromycin (Glpbio, USA), lentiviruses were produced by Shanghai Genechem Co., Ltd. (China). The treatment groups were as follows: the CON group was treated with an equal volume of PBS as a control, the COM group was treated with 200 µg/mL COM for 24 h, the COM + siTLR4 group was treated with 200 µg/mL COM for 24 h, and the COM + siTLR4 + JAG1 group was treated with 200 µg/mL COM and 2 µg/mL recombinant JAG1 for 24 h. The COM + siNotch1 group was treated with 200 µg/mL COM for 24 h. The COM + FLI-06 group was treated with 200 µg/mL COM and 3 µM FLI-06 for 24 h. The COM + oe-miR-449c-5p group was treated with 200 µg/mL COM for 24 h.

Co-culture of macrophages and HK-2 cells

HK-2 cells were plated in 6-well plates at a density of 1 × 10⁶ cells/well. For co-culture studies, PMA-differentiated M0 macrophages were seeded into 0.4 μm polyester membrane Transwell chambers (Corning, USA). The cells were then treated with either COM (200 μg/mL) or an equal volume of PBS (control) and grouped accordingly. After 24 h of stimulation, the macrophages were washed three times with sterile PBS to remove any non-internalized or adherent COM crystals. The Transwell chambers were then carefully transferred and inserted into the 6-well plates containing the pre-plated HK-2 cells. The co-culture system was incubated at 37 °C with 5% CO₂ for 24 h, after which the damage to HK-2 cells was assessed.

Animals and experimental protocol

All experiments utilized male C57BL/6 J mice (6–8 weeks, 20–28 g) maintained on standard diet and water. The mice were housed in a pathogen-free barrier system with stable temperature and humidity, and a 12-h light/dark cycle. All animal experiments were approved by the Animal Ethics Committee of the Second Hospital of Tianjin Medical University (Tianjin, China; approval no. KY2022K103), and all procedures were conducted in accordance with international guidelines for the use of experimental animals. All C57BL/6 mice were purchased from Vitonlihua (Beijing, China), each experimental group consisted of seven mice.

The experimental groups were defined as follows:

The vehicle control cohort (NC group): Daily intraperitoneal injections of 0.9% NaCl solution (volume-matched) administered for 7 consecutive days.

The glyoxylate cohort (Gly group): To establish a CaOx nephrocalcinosis model, mice were injected intraperitoneal with glyoxylate (100 mg/kg/d; Macklin), once daily for 7 consecutive days, following in our previous study.

The glyoxylate + FLI-06 cohort (Gly + FLI-06 group): Mice were injected intraperitoneal with glyoxylate and FLI-06 (40 mg/kg/d;Medchemexpress, USA), once daily for 7consecutive days.

The glyoxylate + AAV-GAS5 cohort (Gly + AAV-GAS5 group): To overexpress GAS5, mice were administered a single tail vein injection of adeno-associated virus (AAV) carrying GAS5 (3.07E + 12v.g./mL; 100 µL), prepared by Shanghai Genechem Co., Ltd. (China). Two weeks after viral transduction, mice were injected intraperitoneal with glyoxylate (100 mg/kg/d) for 7 consecutive days to evaluate the effect of GAS5 overexpression on nephrocalcinosis.

The glyoxylate + AAV-GAS5 + FLI-06 cohort (Gly + AAV-GAS5 + FLI-06 group): Mice received the same AAV-GAS5 injection and glyoxylate regimen as the Gly + AAV-GAS5 group, with the addition of FLI-06 co-administered intraperitoneally with glyoxylate.

The sequence of the F4/80 gene promoter fragment used is as follows:

CTCCCTCTGTCTGTCTGTCTGTCTCTTTGGTGTGATGTATGTGGTGTGTGTGTATTCTACAAGGTTGACATGATGACAGAATTTAATTTTCTTAGCAGCAAGCTCATGGATCCTGGTGATAAATGCAGCATGACTTTACTGAAAAGGCTTTGTGATCTTGAAGAGTGGATTGACTTCACTGTGGGCAGCACATGCAATCTCACTTGTTTGGTGTAATGAAAGAAGAGAATGAGAGGTGGAAGGGGGATGGTAATGTTGAAAAAAAGAATGGTACAGAGGAAACTGAGGTTGGAGAGAGATGGGGTAGATGGTAAGAGATGGAGAAAGAGGGAAGGAAATGGAGAGAAAGACAGAGAGACAGAGAGAGACACACAGAGAGACACACAGAGACAGAGAGGAAGGGAAAGGGAAAGAGAAAGGAAGAGGAAGAGGGGGAGGGGAAGGGGAAGGGGAAGGGGAAGGGAGAGGGAGAAATGTGGACACTAGCCAGATTTAAGGGAGAAATTAGGGGGTTGCCAGTCTGTCCACCTCTGATGGTGGCAACTCAGCAGAAAGCTGCTGGGCTCAGTCTGGCTTTGTTGAGCAACCCTGACTCCACCCCTTTTCTTCCCCACAAAGCAAGCTTTTAAAGGGAAGGCTTTCTTCATTGAATGACTGCCACAGTACG.

The sequence of the AAV-GAS5 construct used in this study is as follows:

CTTTCGGAGCTGTGCGGCATTCTGAGCAGGAATGGCAGTGTGGACCTCTGTGATGGGACATCTTGTGGGATCTCACAGCCAGTTCTGTGGCAAAGGAGGATGAAGGCTTACGAGGACTCGTCAGGAAGCTGGATAACAGAGCGAGCGCAATGTGCTAGAATAGAAGACCAGAAAATGAAATGGTGGAGTTTGAGGCTGGATAGACAGTTTGAAAGTTAACTGGTTGCATGCTTGTTCATTTGGCTGGCTTGCTTGGGTACAAATAATGGTTTGAATAAAGAAAGGTATTAATGGGTCACCTCAAGTGAAGGCACTGCAAACACAATGATTGGTCATTCTGAATTTCCGGTCCTTCATTCTGAATTTCAAAGGCTCCTGTGACAAGTGGACATGCAGTGACTGCACCTTTGTTTCTGAGGTGCCTGGATGGAGGCTCAAATAGAAGATGGTGTCAGATATATTGTGTTAAAATTTTACCATTAAAGTGTATTATAACATGAA.

RNA sequencing and analysis

Total RNA was isolated from mouse kidney tissue samples using the RNAmini Kit. To enhance the accuracy of subsequent sequencing, we enriched the mRNA and performed appropriate fragmentation, followed by careful execution of the reverse transcription step. Sequencing libraries were then constructed according to standard procedures, and library sequencing was executed on Illumina NovaSeq 6000 (Agilent, USA). Finally, the raw data were analyzed using R language.

Trypan blue staining

To evaluate the viability of THP-1 derived M0 macrophages, which exhibit reduced proliferative activity, a Trypan Blue exclusion assay was performed. Cell suspensions were combined with 0.4% Trypan Blue solution (Solarbio, China) and incubated at room temperature. Following incubation, the cells were examined under a bright-field microscope. Viable cells, which exclude the dye, remained unstained, whereas non-viable cells with compromised membranes incorporated the blue dye. The percentages of viable and non-viable cells were determined by counting, and cell viability was calculated accordingly to evaluate cellular activity.

TUNEL assay

Cell apoptosis was detected using a one-step TUNEL assay kit (MA0224, Meilunbio) on both cell coverslips and kidney tissue sections. Samples were fixed in 4% paraformaldehyde (PFA) at room temperature for 10 min, followed by three PBS washes. Permeabilization was carried out using 0.5% Triton X-100, after which the samples were rinsed again with PBS. Subsequently, the samples were treated with Proteinase K (diluted 1:100 in PBS to a final concentration of 20 µg/mL) for 30 min at room temperature. A freshly prepared TUNEL working solution was applied and incubated in the dark for 60 min. Nuclei were counterstained with DAPI. Imaging was performed under a confocal microscope, and TUNEL-positive cells were quantified with ImageJ software.

Real-Time quantitative PCR

Total RNA was isolated from kidney tissues and cells using TRIzol reagent. The RNA concentration was measured using a spectrophotometer. Subsequently, First-strand cDNA was synthesized with Hifair® AdvanceFast SuperMix (Yeasen, China) per manufacturer specifications. Subsequent qRT-PCR analyses employed Hieff UNICON® Blue SYBR Green Master Mix (Yeasen, China) on a Bio-Rad CFX96 thermocycler under standardized cycling conditions. GAPDH expression served as the internal reference to normalize target gene mRNA levels. All qRT-PCR reactions were performed in triplicate. Primer sequences are listed in Supplementary Table S2.

Western blot analysis

Western blotting was performed to analyze protein expression in both kidney tissues and cultured cells. Total protein was extracted by lysing the samples in RIPA buffer (Proteintech, China) containing 1% PMSF (Solarbio, China) and 1% phosphatase inhibitors (Proteintech, China). The protein concentration of each sample was quantified using a BCA Protein Assay Kit (Solarbio, China). Subsequently, proteins were denatured by heating at 95 °C for 5 min in 4 × SDS-PAGE loading buffer (Solarbio, China). The denatured samples were then separated via SDS-PAGE and electrophoretically transferred onto PVDF membranes. To prevent non-specific binding, the membranes were blocked with 5% skim milk (Biosharp, China) for 1 h at room temperature and rinsed three times with TBST. Next, the membranes were probed with specific primary antibodies overnight at 4 °C. After extensive washing with TBST, the membranes were incubated for 1 h at room temperature with horseradish peroxidase (HRP)-conjugated secondary antibodies. Following another series of TBST washes, the blots were treated with ECL reagent (Elabscience, China) for signal development. Protein bands were visualized using a Tanon-5200 Imaging system (Shanghai, China). GAPDH was used as an internal loading control for normalization, and the band density was quantified using ImageJ software. All antibody information is provided in Supplementary Table S3.

Cell counting Kit‑8 (CCK‑8) assay

Cell viability of HK-2 cells after co-culture was measured using the CCK-8 assay. HK-2 cells were seeded at a density of 2 × 10⁴ cells per well in a 24-well plate. M0 macrophages were loaded into 0.4 μm polyester membrane Transwell chambers (Corning, USA), placed in the 24-well plate, and treated with COM or PBS for 24 h. After the treatment, HK-2 cells were exposed with CCK-8 solution for 1 h. The OD at 450 nm was measured using a microplate reader to assess cell viability.

Lactate dehydrogenase (LDH) release

The LDH release assay was used to measure the LDH concentration in THP-1 macrophages after COM treatment to assess the extent of cell membrane damage. THP-1 macrophages were cultured for 24 h in various concentrations of COM (0, 100, 200, 300, 400, 500 μg/mL). According to the manufacturer's instructions, the LDH concentration in the culture medium was measured using an LDH assay kit (Biyotime, China). The OD at 490 nm was measured using a microplate reader to quantify LDH release.

Coimmunoprecipitation (Co-IP) assay

Following a 24-h treatment of macrophages with COM in six-well plates, the culture medium was aspirated, and the cells were rinsed once with PBS. Each well was treated with 300 µL of pre-chilled IP lysis/wash buffer and incubated on ice for 5 min with periodic mixing. The resulting lysates were collected and centrifuged at 13,000 × g for 10 min at 4 °C to remove cellular debris. After determining the protein concentration, the lysates were immunoprecipitated overnight at 4 °C with specific antibodies or control IgG.The next day, magnetic beads were prepared by washing twice with wash buffer in 1.5 mL microcentrifuge tubes. The antigen–antibody complexes were then combined with protein G magnetic beads and incubated for 1 h at room temperature with gentle agitation. The beads were captured using a magnetic rack and washed three times with wash buffer, followed by a final rinse with ultrapure water. Target antigens were eluted by adding 100 µL of elution buffer and incubating for 10 min at room temperature.The eluate containing the immunoprecipitated proteins was collected and denatured at 95 °C for 5 min in 4 × SDS-PAGE loading buffer for subsequent immunoblotting analysis. All steps were performed using a commercial Co-IP kit (Thermo Fisher Scientific, USA).

Immunohistochemistry

Paraffin-embedded mouse kidney samples were sectioned, deparaffinized in xylene and ethanol, rehydrated, washed three times with PBS, and subjected to heat-induced epitope retrieval in citrate buffer (pH 6.0, Proteintech, China) at 95 °C for 15 min. After cooling and washing in PBS, endogenous peroxidase activity (Zsbio, China) was blocked at room temperature for 15 min. Slides were then incubated overnight at 4 °C with the primary antibody, followed by a 20 min room-temperature signal enhancement step. After washing three times in PBS, HRP-conjugated secondary antibodies were applied for 1 h (Zsbio, China), after which DAB (Zsbio, China) was used for color development and slides were rinsed under tap water for 10 min. Counterstaining with hematoxylin (30 s) was followed by another 10 min water rinse. Sections were dehydrated through graded ethanol, cleared in xylene, mounted with resin, and examined under a light microscope.

Immunofluorescence assay (IFA)

Immunofluorescence (IF) staining was performed on both cultured cells and paraffin embedded tissue sections. For cellular IF, treated cells were fixed in 4% PFA (10 min) and permeabilized with 0.5% Triton X-100 (5 min), with PBS washes between each step. Subsequently, the samples were blocked with 1% BSA (Biosharp, China) for 30 min. Following blocking, an overnight incubation at 4 °C with diluted primary antibodies was conducted. The next day, cells were rinsed with PBS and then incubated for 1 h at room temperature with secondary antibodies (FITC-conjugated goat anti-mouse or anti-rabbit IgG; Invitrogen, USA). Nuclei were labeled with DAPI (5 min). Finally, the samples were mounted with an anti-fade medium and visualized using a confocal microscope. For tissue IF, paraffin sections were first deparaffinized and rehydrated, after which the protocol closely mirrored that used for cells.

Calcein‑AM/PI staining

Macrophages were seeded in confocal dishes, and after siTLR4 gene silencing or addition of recombinant JAG1, they were treated with COM for 24 h. According to the manufacturer's protocol, a Calcein-AM/PI dual staining kit (Proteintech, China) was used to assess COM-induced cell death in macrophages. Subsequently, the cells were stained with 2 µM Calcein-AM and 5 µM PI for 20 min, and the labeled cells were observed under a confocal microscope.

Transmission electron microscopy (TEM)

Kidney tissues were fixed in glutaraldehyde (Solarbio, China) to preserve the structural integrity. The tissues were dehydrated to remove moisture, and the slides were stained with uranyl acetate and lead citrate. Following standard procedures, transmission electron microscopy was used to examine the ultrastructure of the cells and their organelles (Hitachi, Japan), assessing the morphology and integrity of the organelles, and digital images were captured.

Flow cytometry

Apoptosis in HK-2 cells under co-culture conditions was evaluated using an Annexin V-FITC/PI apoptosis detection kit (BD Biosciences, USA) in accordance with the manufacturer’s protocol. The percentage of apoptotic cells was analyzed by flow cytometry (FACScan, BD Biosciences, USA). The resulting data were processed with FlowJo software.

Renal function analysis

Blood was collected from mice into serum collection tubes and centrifuged at 3,000 × g for 15 min at 4 °C. Serum was then harvested, and biochemical assays were performed according to the manufacturers’ instructions (Njjcbio, China) to determine BUN and CRE concentrations.

Dual-luciferase reporter gene assay

To validate binding sites between Notch1, GAS5, and miR-449c-5p, luciferase reporter constructs were generated using the pGL4.13 backbone. Wild-type and mutant sequences of the 3′-UTR binding sites from Notch1 and GAS5 were cloned downstream of the firefly luciferase gene, yielding four recombinant plasmids: pPGK-Fluc-GAS5-3′UTR, pPGK-Fluc-GAS5-mut-3′UTR, pPGK-Fluc-Notch1-3′UTR, and pPGK-Fluc-Notch1-mut-3′UTR. These were co-transfected with a miR-449c-5p overexpression plasmid into HEK293T cells. Luciferase activity was measured using a Renilla-Firefly Dual Luciferase Assay Kit on a multifunctional microplate reader (Medchemexpress, USA). Firefly luciferase activity was normalized to Renilla luciferase activity and reported as relative expression.

Statistical analysis

All quantitative analyses of images were performed using ImageJ. Under Statistical Analysis that molecular quantification was based on n = 7 biological replicates per group, and that the images shown are representative results. Experimental data were analyzed in GraphPad Prism 8.4.0 software, and were presented as mean ± SEM. Comparisons between two groups utilized unpaired t tests, while one-way ANOVA was used for comparisons involving three or more groups, followed by appropriate multiple-comparison tests. Statistical significance was set at *P < 0.05, **P < 0.01, ***P < 0.001; non-significant results (P > 0.05) were denoted as “ns”. All experiments were independently repeated at least three times.

Results

Macrophage subpopulation imbalance and enhanced M1 macrophage polarization in patients and murine models with CaOx nephrolithiasis

To investigate the potential pathogenesis of nephrolithiasis, we innovatively analyzed gene expression profiles between stone patients and healthy controls using the GEO dataset (GSE73680) from the NCBI database. The results revealed distinct alteration patterns in monocyte-macrophage subsets in stone patients. Subsequently, we selected six normal samples and thirteen CaOx plaque mucosal samples from this cohort to further explore the role of macrophage polarization in the immunomodulation of CaOx nephrolithiasis. The GSE73680 expression matrix was log2-transformed and normalized with the R function. CIBERSORT algorithm analysis revealed the proportions of 22 immune cell types (Fig. S1), with heatmaps showing significant differences in mast cells and M2 macrophages between the CaOx and controls (Fig. 1A). Violin plots highlighted statistical differences in M2 macrophages and resting mast cells (Fig. 1B), implicating macrophage polarization as a critical factor in CaOx kidney stone formation. Quantitative real-time PCR (qRT-PCR) analyses of patient samples and glyoxylate-induced mouse models revealed higher levels of M1 macrophages (CD86) and lower levels of M2 macrophages (CD206) in CaOx individuals compared to controls (Fig. 1C, E), consistent with findings from western blotting (Fig. 1D, F). Immunofluorescence staining of renal tissues revealed elevated CD86 expression surrounding CaOx deposits, whereas CD206 expression was more prevalent in the renal tissues of the control group (Fig. 1G, H). Collectively, these findings indicate that pro-inflammatory M1 macrophages are induced in diseased renal tissue. In patients with CaOx kidney stones, renal injury may be associated with dysregulation of monocyte/macrophage subpopulations, and this macrophage polarization imbalance appears to be a key driver of disruption in the renal stone-related immune microenvironment.

Fig. 1.

Expression of M1 macrophage markers is significantly increased in patients with CaOx nephrolithiasis and in murine models of nephrolithiasis. (A) The expression of 22 immune background cell types was calculated using the CIBERSORT algorithm from the GSE73680 dataset and displayed in a heatmap. (B) The violin plot showed the statistical differences in immune cell infiltration. (C) qRT-PCR measurement of CD86 and CD206 gene expression in renal tissues from patients with nephrolithiasis. n = 3. (D) Representative western blots and corresponding quantitative analysis of CD86 and CD206 expression in renal tissues from patients with nephrolithiasis. n = 3. (E) qRT-PCR measurement of CD86 and CD206 gene expression in renal tissues from nephrolithiasis model mice. n = 3. (F) Representative western blots and corresponding quantitative analysis of CD86 and CD206 expression in renal tissues from nephrolithiasis model mice. n = 3. (G) Representative images and statistical graphs of tissue immunofluorescence showing CD86 and CD206 expression in renal tissue sections from patients with nephrolithiasis. n = 3. (H) Representative images and statistical graphs of tissue immunofluorescence showing CD86 and CD206 expression in renal tissue sections from nephrolithiasis model mice. n = 3. All data are expressed as mean ± SEM. Statistical comparisons between two groups utilized Student’s t-test, while multi-group analyses employed one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001, non-significant results (P > 0.05) were denoted as “ns”

COM induced M1 macrophage polarization enhances NLRP3 inflammasome activation, pyroptosis, and adhesion in renal tubular epithelial cells

To verify the role of COM-treated macrophages in CaOx nephrolithiasis, we innovatively assessed the viability of THP-1 macrophages following exposure to various concentrations of COM. After 24 h of treatment, trypan blue exclusion assays revealed no significant decrease in cell viability in the range of COM concentrations below 200 μg/mL (Fig. S2A). Additionally, lactate dehydrogenase (LDH) release, indicative of membrane damage, was measured under different COM concentrations. Elevated LDH levels were detected in cells exposed to COM concentrations exceeding 200 μg/mL, suggesting increased membrane permeability and cytotoxicity (Fig. S2B). Based on these findings, 200 μg/mL was selected as the optimal concentration for subsequent experiments. In THP-1 derived macrophages treated with 200 μg/mL COM, qRT-PCR and western blotting analyses revealed a marked upregulation of the M1 macrophage marker CD86, while the expression of the M2 macrophage marker CD206 was relatively reduced (Fig. 2A-C). Immunofluorescence staining further confirmed enhanced expression of CD86 in the COM-treated group compared to controls, indicating that COM promotes M1 macrophage polarization (Fig. 2D and S2C). Given the tight association between nephrolithiasis formation and renal tubular epithelial cell injury and considering the pronounced pro-inflammatory M1 macrophage polarization induced by COM-treated macrophages, we next investigated the effects of these polarized macrophages on human renal proximal tubular epithelial cells (HK-2). To simulate a renal microenvironment where macrophages encounter CaOx crystals, THP-1 macrophages were pre-treated with COM and then co-cultured with HK-2 cells (Fig. 2E). Co-culture results revealed decreased HK-2 cell viability and increased LDH release (Fig. 2F, G). Flow cytometry and TUNEL staining corroborated a significant rise in HK-2 cell death in the treatment group (Fig. 2H and S2D-F). We further explored the mode of cell death in HK-2 cells within the co-culture system. In addition to classical apoptotic changes, such as increased cleaved caspase-3 and BAX, and decreased BCL-2, the COM-treated macrophages markedly induced pyroptosis mediated by the NLRP3 inflammasome (Fig. S2H, I). qRT-PCR and western blot analyses demonstrated significant upregulation of pyroptotic mediators NLRP3, GSDMD, Caspase-1, and IL-1β at both mRNA and protein levels (Fig. 2I-K). Since cell crystal adhesion is a key step in CaOx stone formation, we evaluated the adhesive status of HK-2 cells under co-culture. COM-treated macrophages significantly increased expression of adhesion related proteins, osteopontin (OPN) and cluster of differentiation 44 (CD44), in HK-2 cells (Fig. 2L and S2G). To distinguish the direct cytotoxic effects of COM from macrophage-mediated injury, HK-2 cells were directly exposed to COM or PBS. We observed a slight reduction in cell viability and a modest increase in LDH release in HK-2 cells treated with COM alone; however, these changes were markedly weaker than those observed in the co-culture system of COM-treated THP-1 macrophages and HK-2 cells (Fig. S2J and S3A). Similar trends were also noted in the release of inflammatory mediators and in the expression of adhesion-related proteins (Fig. S3B-E). Collectively, these findings indicate that COM promotes macrophage polarization toward the M1 phenotype, which in turn acts as an amplifier of renal injury by activating NLRP3 inflammasome mediated pyroptosis and enhancing epithelial cell adhesion to crystals, thereby exacerbating tubular epithelial damage to a much greater extent than the intrinsic toxicity of the crystals themselves.

Fig. 2.

COM induced M1 macrophage polarization enhances NLRP3 inflammasome activation, pyroptosis, and adhesion in renal tubular epithelial cells. (A) qRT-PCR measurement of CD86 and CD206 gene expression in THP-1 macrophages under COM treatment. n = 3. (B, C) Representative western blots and corresponding quantitative analysis of CD86 and CD206 expression in THP-1 macrophages under COM treatment. n = 3. (D) Immunofluorescence staining for CD86 expression in THP-1 macrophages under COM treatment. n = 3. (E) Schematic diagram summarizing the experimental procedure for co-culturing THP-1 macrophages with HK-2 cells. (F, G) CCK8 and LDH assays were performed to evaluate cell viability and membrane damage of HK-2 cells in different groups under co-culture conditions. n = 4. (H) Flow cytometry analysis showing the percentage of apoptotic HK-2 cells under co-culture conditions in different groups. n = 3. (I) qRT-PCR measurement of NLRP3, Caspase-1, GSDMD, and IL-1β gene expression in HK-2 cells under COM treatment in co-culture. n = 3. (J, K) Representative western blots and corresponding quantitative analysis of NLRP3, Caspase-1, GSDMD, GSDMD-N, and IL-1β expression in HK-2 cells under COM treatment in co-culture. n = 3. (L) Representative western blots of the adhesion factors OPN and CD44 expression in HK-2 cells under COM treatment in co-culture. n = 3. All data are expressed as mean ± SEM. Statistical comparisons between two groups utilized Student’s t-test, while multi-group analyses employed one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001

Activation of Notch signaling synergizes with NF-κB/NLRP3 inflammatory axis to exacerbate renal injury in patients and murine models with CaOx nephrolithiasis

In the context of immune regulation, the Notch signaling pathway exerts precise control over hematopoietic lineage differentiation through its spatiotemporal expression patterns, playing a pivotal role in macrophage polarization [26]. To explore the potential impact of the Notch signaling pathway on macrophage phenotype and CaOx nephrolithiasis formation, we conducted differential gene expression analysis on GSE73680 data. A volcano plot identified 2,544 upregulated and 3,068 downregulated genes in the CaOx group compared to controls (Fig. 3A). Venn diagram analysis revealed an overlap between differentially expressed genes (DEGs) and Notch pathway genes, identifying 17 potential human gene targets implicated in CaOx stone formation (Fig. 3B). Subsequently, we performed Gene Ontology (GO) enrichment analysis on these candidate genes. The biological process (BP) terms indicated that these genes are closely associated with regulation of gene expression and signal transduction (Fig. 3C and S4A). Among the signal transduction-related categories, immune response-modulating signaling pathways were also identified, suggesting a potential synergy between the Notch signaling pathway and inflammation-related pathways during stone formation. To investigate the molecular mechanisms underlying CaOx nephrolithiasis, we established a murine model by intraperitoneally injecting glyoxylate (Gly), a widely used method for inducing CaOx kidney stones [34]. Mice in the stone group received daily intraperitoneal injections of Gly at a dose of 100 mg/kg for seven consecutive days to mimic hyperoxaluric conditions observed in humans, while control mice were administered an equal volume of saline. Renal tissues were harvested for subsequent transcriptome sequencing (RNA-seq) and DEGs analysis. RNA-seq analysis revealed significant enrichment of the Notch signaling pathway, along with multiple inflammation-related pathways. Heatmap visualization of transcriptomic data from CaOx-treated mice demonstrated upregulation of genes associated with the Notch pathway, the NF-κB/NLRP3 inflammatory pathway (Fig. S4B). Additionally, a marked increase in renal apoptosis was observed in the renal tissues of stone patients (Fig. 3D, E). To further explore the involvement of the Notch signaling-mediated NF-κB/NLRP3 inflammatory pathway in nephrolithiasis formation, we performed qRT-PCR analysis on renal tissue samples collected from patients with nephrolithiasis (n = 10) and healthy controls (n = 10). The results showed that the mRNA expression levels of Notch1, P65, and NLRP3 were significantly upregulated in stone-forming individuals compared with controls (Fig. 3F, G and S4C). Linear regression analysis revealed a positive correlation between Notch1 mRNA levels and those of P65 and NLRP3 in nephrolithiasis patients (Fig. 3H and S4D), suggesting a potential regulatory relationship. Consistent with these findings, immunohistochemical staining revealed increased expression of key inflammatory mediators involved in the Notch and NF-κB/NLRP3 pathways in the renal tissues of stone patients (Fig. 3I-L). We next assessed the protein expression of components within these pathways in renal tissues by western blotting. In agreement with the transcriptional data, tissues from CaOx stone patients exhibited markedly elevated protein levels of Notch1, P65, P-P65, NLRP3, TLR4, and HMGB1 compared to normal tissues (Fig. 3M, N), indicating activation of both the Notch signaling cascade and downstream inflammatory effectors. Collectively, these findings suggest that the Notch signaling pathway, in concert with the NF-κB/NLRP3 axis, plays a pivotal role in promoting macrophage polarization and exacerbating renal injury. The coordinated activation of these pathways may amplify inflammation and contribute to the pathogenesis of CaOx-induced renal damage.

Fig. 3.

The Notch signaling pathway and related inflammatory pathways are significantly upregulated in both patients and murine models with CaOx nephrolithiasis. (A) DEGs based on the GSE73680 database, displayed in a volcano plot. (B) Venn diagram depicting the intersection between DEGs in GSE73680 and Notch pathway associated genes, highlighting 17 potential candidate genes. (C) GO enrichment analysis of 17 potential human gene targets. (D, E) Representative images and quantification of TUNEL staining showing tubular epithelial cell apoptosis in renal tissues from patients with nephrolithiasis. n = 3. (F, G) qRT-PCR measurement of Notch1 and NLRP3 gene expression in kidney tissues from 10 normal individuals and 10 nephrolithiasis patients. n = 10. (H) Assessing the correlation between Notch1 and NLRP3 mRNA levels by linear regression (R = 0.9364, P < 0.0001). (I) Representative images of immunohistochemical staining for Notch1, P-P65, and NLRP3 in renal tissues from patients with nephrolithiasis. n = 3. (J) Representative immunohistochemical quantification of Notch1 in renal tissues from patients with nephrolithiasis. n = 3. (K) Representative immunohistochemical quantification of P-P65 in renal tissues from patients with nephrolithiasis. n = 3. (L) Representative immunohistochemical quantification of NLRP3 in renal tissues from patients with nephrolithiasis. n = 3. (M, N) Representative western blots and corresponding quantitative analysis of Notch1, NLRP3, P65, P-P65, TLR4, and HMGB1 expression in renal tissues from patients with nephrolithiasis. n = 3. All data are expressed as mean ± SEM. Statistical comparisons between two groups utilized Student’s t-test, while multi-group analyses employed one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001, non-significant results (P > 0.05) were denoted as “ns”

Inhibition of macrophage Notch1 protects renal tubular cells by down-regulating NF-κB/NLRP3 and reversing M1 macrophage polarization

To elucidate the critical role of the Notch signaling pathway in macrophage polarization and the NF-κB/NLRP3 inflammatory axis in vitro. To begin with, live/dead staining with Calcein-AM (green) and propidium iodide (PI, red) demonstrated a marked increase in macrophage death following COM treatment (Fig. 4A and S5A). Concurrently, qRT-PCR and western blotting analyses revealed that key signaling molecules including Notch1, P65, P-P65, NLRP3, HMGB1, and TLR4 were significantly upregulated in THP-1 macrophages upon COM exposure (Fig. 4B, C and D). These results collectively indicate that COM stimulation activates both the Notch and NF-κB/NLRP3 inflammatory signaling pathways in polarized macrophages. While previous studies have documented crosstalk between the Notch and NF-κB pathways, the relationship between Notch signaling and NLRP3 inflammasome activation during macrophage polarization remains unclear. To further explore this potential interaction, co-immunoprecipitation (Co-IP) assays were conducted, which confirmed a direct association between Notch1 and NLRP3 in COM-treated macrophages (Fig. 4E). Together, these findings demonstrate that COM promotes macrophage polarization toward the pro-inflammatory M1 phenotype and triggers the release of inflammatory mediators. Moreover, a mechanistic link exists between the Notch signaling pathway and the NLRP3 inflammasome in this process. Subsequently, we transfected THP-1 cells with small interfering RNA (siRNA) targeting Notch1. The knockdown efficiency was confirmed by measuring both mRNA and protein expression levels of Notch1 (Fig. S5B, C). Additionally, FLI-06, a γ-secretase inhibitor that interferes with Notch receptor cleavage by inhibiting γ-secretase activity, was selected as an inhibitor of the Notch signaling pathway [49]. To reduce Notch1 expression, THP-1 macrophages were treated with either the Notch signaling inhibitor FLI-06 or Notch1-targeting siRNA (si-Notch1). Our study demonstrated that inhibition of Notch1 expression following COM treatment significantly reduced apoptotic cells in THP-1 macrophages, indicating that suppressing Notch1 expression effectively inhibits macrophage death (Fig. 4F and S5D). Furthermore, immunofluorescence staining revealed that both siRNA transfection and FLI-06 application significantly inhibited M1 polarization and promoted M2 polarization in THP-1 macrophages (Fig. S5E, F and G). Consistent with this, western blot results confirmed that Notch1 silencing suppressed M1 polarization and promoted M2 polarization in macrophages (Fig. 4G, H). We further assessed the expression of key inflammatory proteins in the NF-κB/NLRP3 axis. After COM intervention, protein levels of Notch1, P-P65, and NLRP3 were significantly elevated in THP-1 macrophages. However, these increases in major inflammatory factors were markedly reversed by Notch1 gene silencing (Fig. 4I, J). Finally, we investigated the impact of reduced Notch1 expression in macrophages on HK-2 cells. Under COM stimulation, both siRNA transfection and FLI-06 application significantly inhibited M1 polarization in THP-1 macrophages and reduced the release of inflammatory factors. This consequently led to decreased apoptosis and necrosis in co-cultured HK-2 cells (Fig. 4K). In summary, these results demonstrate that the Notch1-mediated NF-κB/NLRP3 inflammatory axis plays a crucial role in promoting M1 macrophage polarization. Inhibition of the Notch1 signaling pathway protects renal tubular epithelial cells and mitigates kidney injury by downregulating the NF-κB/NLRP3 inflammatory axis and reversing M1 macrophage polarization.

Fig. 4.

Inhibition of macrophage Notch1 ameliorates COM-induced renal tubular injury via suppressing NF-κB/NLRP3 and reversing M1 macrophage polarization. (A) Live/dead cell staining of macrophages treated with COM in different groups. n = 3. (B) qRT-PCR measurement of Notch1, NLRP3, P65, TLR4, and HMGB1 gene expression in THP-1 macrophages after COM treatment. n = 3. (C, D) Representative western blots and corresponding quantitative analysis of Notch1, NLRP3, P65, P-P65, TLR4, and HMGB1 expression in THP-1 macrophages after COM treatment. n = 3. (E) Representative western blots of co-immunoprecipitation of Notch1 and NLRP3. (F) Representative images plots of TUNEL staining to detect cell apoptosis in THP-1 macrophages from all four experimental cohorts. n = 3. (G, H) Representative western blots and corresponding quantitative analysis of CD86 and CD206 expression in THP-1 macrophages from all four experimental cohorts. n = 3. (I, J) Representative western blots and corresponding quantitative analysis of Notch1, P-P65, and NLRP3 expression in THP-1 macrophages from all four experimental cohorts. n = 3. (K) Flow cytometry analysis showing the percentage of apoptotic HK-2 cells under co-culture conditions from all four experimental cohorts. n = 3. All data are expressed as mean ± SEM. Statistical comparisons between two groups utilized Student’s t-test, while multi-group analyses employed one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001

The inhibition of Notch signaling suppresses macrophage polarization toward the M1 phenotype, downregulates the NF-κB pathway and NLRP3 inflammasome expression, and alleviates CaOx crystal deposition and kidney damage in vivo

To investigate the role and underlying mechanisms of the Notch signaling pathway in CaOx nephrolithiasis, we established a mouse model of CaOx nephrolithiasis induced by Gly and assessed the effects of Notch pathway inhibition on macrophage polarization, NF-κB/NLRP3 inflammatory signaling, CaOx crystal deposition, and renal injury. Mice were randomly divided into three groups: control (saline-treated), Gly model, and Gly + FLI-06 treatment. Immunofluorescence analysis demonstrated that the expression of Notch1 and its ligand Jagged1 in the kidneys was significantly decreased in the FLI-06-treated group compared to the Gly group (Fig. S6A), indicating effective inhibition of the Notch pathway. Following Notch inhibition, serum creatinine (CRE) and blood urea nitrogen (BUN) levels were markedly reduced (Fig. 5A, B). Von Kossa staining and quantitative analysis revealed a significant reduction in CaOx crystal deposition in the FLI-06-treated group. Additionally, TUNEL staining showed that renal tubular epithelial cell apoptosis was notably alleviated in the treatment group. Transmission electron microscopy (TEM) further revealed that FLI-06 mitigated ultrastructural damage in renal tubular cells, including damage to mitochondria, vesicles, and phagosomes, when compared to the Gly group (Fig. 5C). To further confirm the role of the Notch pathway in stone formation, we evaluated the expression of adhesion-related proteins in renal tissue. Expression levels of OPN and CD44 were significantly decreased in the FLI-06 group but markedly elevated in the Gly model group (Fig. 5D, E and S6B). Collectively, these findings suggested that the Notch signaling pathway plays a key role in the formation of CaOx nephrolithiasis, and its inhibition can reduce crystal deposition and renal injury. Subsequently, we assessed macrophage polarization status in renal tissues. Western blotting analyses revealed that compared with the Gly group, the expression of the pro-inflammatory M1 marker CD86 was significantly decreased, while the anti-inflammatory M2 marker CD206 was markedly increased in the FLI-06 group (Fig. 5F, G), Similar results were demonstrated by immunofluorescence (Fig. 5H, I), indicating that Notch inhibition could attenuate renal inflammation by regulating macrophage polarization. To further elucidate how the Notch pathway regulates macrophage polarization, we examined the expression of key inflammatory factors in the downstream NF-κB/NLRP3 signaling pathway by western blot. FLI-06 treatment significantly downregulated the expression of Notch1, Jagged1, NLRP3, P65, P-P65, TLR4, and HMGB1 (Fig. 5J, K). Immunofluorescence analysis of P-P65 confirmed that NF-κB activation was suppressed in the FLI-06 group (Fig. S6C). Given that NF-κB signaling and the NLRP3 inflammasome play critical roles in M1 macrophage polarization, these results collectively suggest that inhibition of the Notch signaling pathway can suppress M1 macrophage polarization by downregulating NF-κB and NLRP3 activation, thereby alleviating CaOx deposition and renal damage.

Fig. 5.

Inhibition of Notch signaling suppresses inflammatory pathways and M1 macrophage polarization, alleviating kidney damage and crystal deposition. (A, B) Serum levels of CRE and BUN in all three experimental cohorts of mice. n = 5. (C) Representative images and quantification of Von Kossa staining of renal tissue sections from all three experimental cohorts, showing calcium salt deposition in the kidneys. Representative images and quantification of TUNEL staining assessing cell apoptosis of renal tissue sections from all three experimental cohorts. n = 3. TEM to examine the ultrastructure of renal tissue sections and cells from all three experimental cohorts. n = 3. The red arrows indicate damaged and swollen mitochondria. (D, E) Representative western blots and corresponding quantitative analysis of OPN and CD44 expression in renal tissues collected from all three experimental cohorts. n = 3. (F, G) Representative western blots and corresponding quantitative analysis of CD86 and CD206 expression in renal tissues collected from all three experimental cohorts. n = 3. (H, I) Representative images and statistical data of CD86 and CD206 expression in renal tissue sections from all three experimental cohorts assessed by immunofluorescence. n = 3. (J, K) Representative western blots and corresponding quantitative analysis of Notch1, Jagged1, NLRP3, P65, P-P65, TLR4, and HMGB1 expression in renal tissues collected from all three experimental cohorts. n = 3. All data are expressed as mean ± SEM. Statistical comparisons between two groups utilized Student’s t-test, while multi-group analyses employed one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001, non-significant results (P > 0.05) were denoted as “ns”

TLR4 acts as a nodal point integrating Notch inputs with NF-κB/NLRP3 signaling to specify M1 macrophage identity

Given that the TLR4 signaling pathway, as a pattern recognition receptor, plays a crucial role in initiating inflammatory injury and tissue repair in macrophage-mediated innate immunity, and considering the observed downregulation of TLR4 protein expression following Notch pathway inhibition in our earlier studies, we hypothesized that the TLR4 signaling pathway critically coordinates macrophage polarization via the Notch/NF-κB/NLRP3 axis. Genomic analysis of mouse renal tissues also revealed significant upregulation of TLR4 pathway-related genes in the Gly group (Fig. S7A). To investigate the role of the TLR4 pathway in mediating the regulatory effects of the Notch pathway on the NF-κB/NLRP3 axis, we generated stable THP-1 macrophage cell lines by transducing cells with lentiviral vectors encoding TLR4 shRNA (LV-sh-TLR4) or a negative control. qRT-PCR and western blotting analyses confirmed efficient knockdown of TLR4 (Fig. 6A and S7B). Calcein-AM/PI staining was then used to label live (green) and dead (red) cells, allowing assessment of cell viability after gene silencing. TLR4 knockdown significantly attenuated COM-induced THP-1 macrophage cell death. Furthermore, as Jagged1 (JAG1) is a key ligand of the Notch signaling pathway, exogenous recombinant JAG1 was added to activate Notch signaling. However, in TLR4-knockdown cells, JAG1 supplementation failed to increase cell death (Fig. 6B, C), suggesting that TLR4 knockdown effectively suppresses COM-induced inflammatory cell death in THP-1 macrophages and that the Notch pathway exerts its downstream inflammatory effects via TLR4. Subsequent qRT-PCR and western blot results showed that TLR4 knockdown significantly inhibited M1 polarization and promoted M2 polarization of THP-1 macrophages. Treatment with recombinant JAG1 had no significant effect on the polarization state (Fig. 6D, E), and immunofluorescence staining yielded consistent findings (Fig. 6F). We then evaluated the expression of key inflammatory proteins in the NF-κB/NLRP3 axis. Compared to the COM-treated group, the TLR4 knockdown group showed reduced expression of Notch1 and JAG1, and significantly decreased levels of P65, P-P65, NLRP3, and HMGB1. The modest decrease in Notch1 and JAG1 expression may be due to the attenuation of downstream inflammatory signals (Fig. 6G, H and S7C), which weakened the crosstalk between the Notch and NF-κB/NLRP3 pathways, thus reducing positive feedback and Notch pathway activation. Interestingly, although the addition of recombinant JAG1 restored Notch1 and JAG1 expression, the expression of downstream inflammatory proteins remained unchanged. Finally, we explored the effect of TLR4 knockdown in macrophages on HK-2 cells. Under COM stimulation, macrophages with reduced TLR4 expression showed a significantly lower proportion of M1-type cells, resulting in reduced apoptosis and necrosis in co-cultured HK-2 cells. Notably, TLR4 knockdown completely abrogated the pro-death effect of recombinant JAG1 on HK-2 cells (Fig. 6I). In conclusion, TLR4 knockdown improves the survival of macrophages in an oxalate environment and suppresses COM-induced macrophage polarization. The TLR4 pathway is a critical mediator in the Notch-regulated NF-κB/NLRP3 axis, and its inhibition can reduce apoptosis and necrosis in co-cultured renal tubular epithelial cells.

Fig. 6.

TLR4 deficiency alleviates inflammatory factor release and M1 macrophage polarization. (A) Assessment of TLR4 knockdown efficiency by Western blot. n = 3. (B, C) Live/dead cell staining and quantification of macrophages treated with COM in all four experimental cohorts. n = 3. (D) Quantitative analysis of CD86 and CD206 mRNA expression in all four experimental cohorts by qRT-PCR. n = 3. (E) Representative western blots and corresponding quantitative analysis of macrophage markers CD86 and CD206 expression in all four experimental cohorts. n = 3. (F) Representative images and statistical analysis of CD86 and CD206 expression by immunofluorescence in all four experimental cohorts. n = 3. (G) Quantitative analysis of Jagged1, Notch1, P65, NLRP3, and HMGB1 mRNA expression in all four experimental cohorts by qRT-PCR. n = 3. (H) Representative western blots of Jagged1, Notch1, P65, P-P65, NLRP3, and HMGB1 expression in all four experimental cohorts. n = 3. (I) Flow cytometry analysis showing the percentage of apoptotic HK-2 cells under co-culture conditions in all four experimental cohorts. n = 3. All data are expressed as mean ± SEM. Statistical comparisons between two groups utilized Student’s t-test, while multi-group analyses employed one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001, non-significant results (P > 0.05) were denoted as “ns”

GAS5 is upregulated in human M1 macrophages and competitively regulates Notch1 signaling via miR-449c-5p

Given the cooperative interaction between the Notch signaling pathway and the NF-κB/NLRP3 inflammatory axis in promoting M1 macrophage polarization and considering the highly conserved nature of the Notch pathway. Our finding through GO pathway enrichment analysis of seventeen candidate genes associated with CaOx nephrolithiasis that Notch signaling plays a significant role in nuclear gene expression regulation, we sought to determine whether other transcripts regulate this pathway. Based on RNA-seq transcriptome data from Gly-induced mouse models, we performed differential expression analysis of lncRNAs (Fig. 7A). Volcano plot analysis revealed 15 upregulated and 20 downregulated lncRNAs in the Gly-treated group compared to the control (Fig. 7B). Subsequently, we conducted heatmap analysis on lncRNAs with statistically significant p-values and FPKM ≥ 1 (Fig. 7C), identifying several lncRNAs (e.g., Eprn, SNHG1, GAS5) that were significantly dysregulated in the Gly-treated mouse models. To investigate whether these lncRNAs exert regulatory functions in macrophages, we selected the top seven most significantly dysregulated lncRNAs from the glyoxylate group for further analysis. In RAW264.7 macrophages under COM exposure, qRT-PCR validation showed that among the seven candidates, GAS5 was the most significantly upregulated (Fig. 7D). Based on this observation, we focused on GAS5, which is inflammation-related and highly expressed in macrophages. In THP-1 macrophages, COM treatment significantly increased the expression levels of both Notch1 and GAS5 (Fig. S7D, E). Using cross-prediction based on the StarBase v3.0 and miRDB databases, we compared three miRNAs predicted to target both Notch1 and GAS5, and identified miR-449c-5p as a potential shared target. Further analysis indicated that miR-449c-5p was predicted to bind to specific complementary sites within the human GAS5 transcript and the 3′ untranslated regions (3′UTR) of human Notch1 (Fig. 7E). qRT-PCR analysis confirmed that GAS5 and miR-449c-5p exhibited inverse expression patterns in THP-1 cells and in renal stone patient samples (Fig. 7F, G), with correlation analysis supporting a negative regulatory relationship (Fig. 7H). To further validate the interaction between GAS5 and miR-449c-5p, we performed a dual-luciferase reporter assay. Wild-type (WT) and mutant (Mut) GAS5 reporter constructs were co-transfected with miR-449c-5p mimics (Fig. S7F). Luciferase activity was significantly reduced in the WT group but remained unchanged in the Mut group, confirming direct targeting (Fig. 7I). Similarly, correlation analysis showed a negative association between Notch1 and miR-449c-5p in THP-1 macrophages (Fig. 7J). Dual-luciferase assays with WT and Mut Notch1 3′UTR constructs further confirmed that miR-449c-5p suppresses Notch1 expression via direct interaction (Fig. 7K and S7G). These results indicate that miR-449c-5p directly targets both Notch1 and GAS5, establishing a negative regulatory relationship. More importantly, we transfected THP-1 cells in vitro with a miR-449c-5p overexpression plasmid to generate OE-miR-449c-5p cells, and verified the transfection efficiency using qRT-PCR (Fig. S7H). qRT-PCR and western blot analyses showed that, compared to the COM-treated group, overexpression of miR-449c-5p resulted in decreased CD86 levels, GAS5 levels, and increased CD206 levels in THP-1 cells (Fig. S7I-K), indicating that miR-449c-5p influences macrophage polarization. These findings establish miR-449c-5p as an obligate intermediary linking GAS5 to Notch1 activation and M1 polarization programs in human macrophages.

Fig. 7.

GAS5 is upregulated in human M1 macrophages and competitively regulates Notch1 signaling via miR-449c-5p. (A) Schematic integration of murine model procedures with critical intervention timepoints. (B) DEGs associated with lncRNAs were identified from mouse RNA-seq datasets and visualized using a volcano plot. (C) A heatmap displaying lncRNA-related DEGs with FPKM ≥ 1. (D) qRT-PCR validation of the expression levels of seven significantly upregulated lncRNAs, as identified in the heatmap, in RAW264.7 macrophages. n = 5. (E) Bioinformatic analysis predicting the binding sites of miR-449c-5p within the 3′UTRs of Notch1 and GAS5. (F) qRT-PCR measurement of GAS5 and miR-449c-5p gene expression levels in THP-1 macrophages across different treatment groups. n = 5. (G) qRT-PCR measurement of GAS5 and miR-449c-5p gene expression in normal renal tissues and renal tissues from patients with nephrolithiasis. n = 5. (H) Assessing the correlation between GAS5 and miR-449c-5p mRNA levels by linear regression (R = −0.560, P = 0.013). (I) Dual-luciferase reporter assay validates the targeting of miR-449c-5p by GAS5. n = 3. (J) Assessing the correlation between Notch1 and miR-449c-5p mRNA levels by linear regression (R = −0.553, P = 0.014). (K) Dual-luciferase reporter assay validates the targeting of miR-449c-5p by Notch1. n = 3. All data are expressed as mean ± SEM. Statistical comparisons between two groups utilized Student’s t-test, while multi-group analyses employed one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001, non-significant results (P > 0.05) were denoted as “ns”

Overexpression of GAS5 promotes M1 macrophage polarization via the GAS5-miR-325-3p-Notch1 ceRNA axis, upregulates proinflammatory cytokines, and exacerbates CaOx crystal deposition and renal injury in vivo.

To extend our findings to the in vivo setting and to determine whether the GAS5-Notch1 axis similarly promotes M1 macrophage polarization and renal injury in mice, it was first necessary to address the potential species specificity of interactions between lncRNAs and miRNAs. Although the GAS5-miR-449c-5p-Notch1 ceRNA network has been well validated in human macrophages, miRNA binding sites within lncRNAs are often not fully conserved across species [50, 51]. Consistent with this notion, bioinformatic analyses revealed that the seed sequence of miR-449c-5p is not fully conserved within the murine GAS5 transcript or the 3′UTR of Notch1. These findings suggest that the precise molecular partners of GAS5 may differ in mice. To identify the relevant miRNA in the murine system, we performed cross prediction analyses using the StarBase v3.0 and miRDB databases. This approach identified miR-325-3p as a high confidence candidate capable of simultaneously targeting murine GAS5 and Notch1. Subsequently, validation experiments in RAW264.7 murine macrophages confirmed functional interactions among GAS5, miR-325-3p, and Notch1 (Fig. S8A-D). Importantly, this establishes miR-325-3p as a key mediator in murine macrophages, thereby presenting a functional analogue to the role of miR-449c-5p in human cells. Collectively, this finding not only supports a conserved ceRNA regulatory logic, whereby GAS5 enhances Notch1 signaling by sequestering specific miRNAs, but also highlights the species adaptive nature of the miRNAs involved. After elucidating the murine ceRNA axis (GAS5-miR-325-3p-Notch1), we further investigated its functional relevance in vivo. To this end, we generated an adeno-associated virus serotype 9 (AAV9) vector designed to carry the murine GAS5 gene under the control of the macrophage-specific F4/80 promoter (AAV9-Gas5). This construct was administered via tail vein injection to achieve targeted overexpression of Gas5 in renal macrophages (Fig. 8A). To verify the targeting efficiency of the adeno associated virus toward renal macrophages and the specificity of GAS5 overexpression, we first confirmed the high transduction efficiency of the control virus AAV9-EGFP in renal macrophages by immunofluorescence analysis (Figure S8E, F). Subsequently, qRT-PCR analysis revealed that GAS5 expression in the kidneys of mice injected with AAV9-GAS5 was significantly increased compared with that in the control group (Figure S8G). To further determine the cellular localization of GAS5 overexpression, fluorescence in situ hybridization (FISH) was performed on renal tissue sections to specifically label GAS5, followed by co-localization analysis with the macrophage marker F4/80. The results demonstrated a high degree of overlap between the GAS5 signal and F4/80 positive areas, confirming that GAS5 was predominantly enriched in F4/80-positive renal macrophages (Figure S8H, I). After stable viral expression was established, a CaOx nephrolithiasis model was induced in mice, with or without co-treatment using the Notch pathway inhibitor FLI-06. Overexpression of GAS5 significantly increased plasma levels of BUN and CRE (Fig. 8B, C). Von Kossa staining and subsequent quantification revealed enhanced CaOx crystal deposition in the GAS5-overexpressing group. Additionally, TUNEL assays indicated a notable increase in tubular epithelial cell apoptosis compared to the Gly-treated control group (Fig. 8D). Overexpression of GAS5 also elevated the expression of adhesion molecules and pro-inflammatory M1 macrophage markers, thereby promoting stone aggregation (Fig. 8D, F, H and S9A-E). Interestingly, FLI-06 administration reversed these effects, leading to reductions in plasma BUN and CRE levels (Fig. 8B, C), decreased crystal deposition, and alleviated tubular cell apoptosis. Assessment of renal expression of adhesion proteins and macrophage polarization markers further confirmed this reversal: OPN and CD44 levels were downregulated, and macrophage polarization shifted from the pro-inflammatory M1 phenotype toward the anti-inflammatory M2 phenotype, significantly mitigating stone burden (Fig. 8D, F, H and S9A-E). We next performed qRT-PCR to quantify the expression levels of GAS5, miR-325-3p, and Notch1 in kidney tissues (Fig. 8E, G, J). GAS5 overexpression elevated the expression of both GAS5 and Notch1, while miR-325-3p expression was markedly decreased. Treatment with FLI-06 led to partial restoration of miR-325-3p levels. Given our previous findings that miR-325-3p serves as a shared target of both GAS5 and Notch1, and that both GAS5 and Notch1 are negatively regulated by miR-325-3p, these results support a model in which GAS5 functions as a ceRNA in vivo, at least in part by sequestering miR-325-3p and relieving its repression of Notch1, thereby indirectly upregulating Notch1 expression. Furthermore, western blotting and immunohistochemistry revealed that GAS5 overexpression enhanced the expression of key inflammatory mediators downstream of the NF-κB/NLRP3 signaling axis, including Notch1, P-P65, and NLRP3 (Fig. 8I, K-M and S9F, G). These changes were attenuated following FLI-06 treatment, indicating that the pro-inflammatory effects of GAS5 are largely dependent on Notch1 signaling in vivo. Collectively, these findings demonstrate that GAS5 facilitates Notch1-mediated M1 macrophage activation through the GAS5-miR-325-3p-Notch1 ceRNA axis, thereby exacerbating CaOx nephrolithiasis progression by promoting inflammatory cytokine expression, enhancing crystal deposition, and aggravating renal injury.

Fig. 8.

Overexpression of GAS5 promotes M1 macrophage polarization, enhances crystal aggregation, and exacerbates inflammatory injury. (A) Workflow for establishing murine models with GAS5 overexpression and FLI-06 co-administration. Gly induction (100 mg/kg/d, intraperitoneal) commenced at day 14 post-modeling, with renal harvest at day 7 post-induction. Abbreviations: ip, intraperitoneal; iv, intravenous. (B, C) The contents of CRE (B) and BUN (C) in the serum of all four experimental cohorts of mice. n = 5. (D) Representative images and quantification of Von Kossa staining of renal tissue sections from all four experimental cohorts, showing calcium salt deposition in the kidneys. Representative images and quantification of TUNEL staining assessing tubular epithelial cell apoptosis of renal tissue sections from all four experimental cohorts. n = 3. Representative images of CD86 and CD206 expression in kidney tissue sections from each group assessed by immunofluorescence. n = 3. (E) qRT-PCR measurement of miR-325-3p gene expression in renal tissues collected from all four experimental cohorts. n = 3. (F) Representative western blots and corresponding quantitative analysis of OPN and CD44 protein levels in renal tissues collected from all four experimental cohorts. n = 3. (G) qRT-PCR analysis of GAS5 expression in renal tissues collected from all four experimental cohorts. n = 3. (H) Representative western blots and corresponding quantitative analysis of the macrophage markers CD86 and CD206 in renal tissues collected from all four experimental cohorts. n = 3. (I) Representative immunohistochemical staining of Notch1, P-P65, and NLRP3 in renal tissues collected from all four experimental cohorts. n = 3. (J) qRT-PCR measurement of Notch1 gene expression in renal tissues collected from all four experimental cohorts. n = 3. (K) Representative immunohistochemical quantification of Notch1 in renal tissues collected from all four experimental cohorts. n = 3. (L) Representative immunohistochemical quantification of P-P65 in renal tissue sections from all four experimental cohorts. n = 3. (M) Representative immunohistochemical quantification of NLRP3 in renal tissue sections from all four experimental cohorts. n = 3. All data are expressed as mean ± SEM. Statistical comparisons between two groups utilized Student’s t-test, while multi-group analyses employed one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001, non-significant results (P > 0.05) were denoted as “ns”

Discussion

Nephrolithiasis are a common urological disease with a high incidence in many countries worldwide, posing a substantial burden on global healthcare systems [52]. The formation of nephrolithiasis is a complex process involving diverse components, with CaOx stones accounting for approximately 70–80% of all cases. Other types of stones include uric acid, struvite, and cystine stones [53]. Increasing evidence suggests that abnormal oxalate metabolism and inflammation are critical contributors to CaOx stone formation [54, 55]. CaOx crystals can directly damage renal tubular epithelial cells, triggering inflammatory responses that accelerate stone formation [56]. Previous studies have shown that oxalate exposure significantly reduces the viability of renal tubular epithelial cells, while ROS facilitates activation of the NLRP3 inflammasome, thereby promoting CaOx stone formation [38]. Macrophages, as essential components of the mononuclear phagocyte system, play a crucial role in this process. Recent findings indicate that the polarization state of macrophages significantly affects kidney stone pathogenesis. Proinflammatory M1 macrophages enhance crystal deposition in the kidney, aggravate inflammation, and secrete inflammatory cytokines that contribute to renal injury. In contrast, anti-inflammatory M2 macrophages alleviate crystal accumulation and inflammation by producing protective cytokines [57]. Our study demonstrates that COM exposure drives macrophage polarization toward the M1 phenotype, a finding supported by our experimental data. This process involves multiple inflammatory signaling pathways, among which the NF-κB and NLRP3 inflammasome pathways appear to play particularly important roles. Consistent with this, increased expression of P-P65, NLRP3, TLR4, and HMGB1 was observed in both patient samples and COM-stimulated macrophages, suggesting that the activation of these pathways contributes critically to M1 polarization and subsequent renal injury. These data reinforce the notion that M1 macrophages are key contributors to CaOx nephrolithiasis, which is consistent with previous reports. Furthermore, our work provides novel evidence implicating the GAS5-Notch signaling axis in regulating the NF-κB/NLRP3 pathways in this context. Collectively, these findings offer new insights into the immunological mechanisms underlying CaOx stone formation and may inform the development of future therapeutic interventions.

Pyroptosis is a form of programmed inflammatory cell death [58]. Our previous studies have demonstrated that oxalate exposure leads to renal injury and induces pyroptosis in HK-2 renal tubular epithelial cells [33]. This process involves the activation of caspase-1, which promotes the maturation and secretion of pro-inflammatory cytokines IL-1β and IL-18. These cytokines, in turn, amplify the inflammatory response by recruiting immune cells and stimulating the production of additional inflammatory mediators. As a form of programmed cell death, pyroptosis is characterized by the upregulation of caspase-1, IL-1β, and GSDMD, along with elevated intracellular ROS and calcium ion levels [34, 59]. In our study, we co-cultured COM-stimulated macrophages with renal tubular epithelial cells and found significantly increased expression levels of NLRP3, caspase-1, IL-1β, and GSDMD in epithelial cells. Additionally, there was a marked upregulation of cell adhesion proteins such as OPN and CD44. These results indicate that macrophages in the COM-rich microenvironment promote pyroptosis in renal tubular epithelial cells, contributing to renal inflammation and injury.

Previous studies have reported that in the intestinal mucosa of patients with Crohn’s disease (CD), a high proportion of M1-type macrophages co-express hypoxia-inducible factor 1-alpha (HIF-1α) and Jagged1, and the Notch signaling pathway has been identified as a key regulator of macrophage-mediated immune inflammation [60]. However, the downstream molecular mechanisms, particularly those involved in Notch-mediated macrophage polarization, remain incompletely understood. In Japanese encephalitis virus (JEV) infection, miRNA let-7a/b has been shown to activate the Notch signaling pathway through Toll-like receptor 7 (TLR7), thereby enhancing neuroinflammation mediated by microglial cells [61]. Similarly, upregulation of Notch signaling has been observed in a murine sepsis model, and conditional deletion of Notch1 in macrophages alleviated lipopolysaccharide (LPS)-induced inflammatory responses [62, 63]. The Toll-like receptor family, a group of transmembrane proteins, plays a central role in recognizing PAMPs and DAMPs, such as the prototypical DAMP molecule HMGB1, and initiating inflammatory responses. TLR4, the most extensively studied member of the TLR family, is expressed on the surface of macrophages and promotes the production of pro-inflammatory cytokines upon activation [64–66]. These findings collectively suggest that Notch signaling may exert pro- or anti-inflammatory functions by modulating macrophage polarization during oxalate crystal-induced acute kidney injury. In our study, Co-IP assays confirmed a direct interaction between Notch1 and the NLRP3. Furthermore, inhibition of Notch signaling was found to attenuate renal injury, concomitant with the suppression of downstream NF-κB signaling and NLRP3 inflammasome activation, thereby reducing M1 macrophage polarization. It is important to note that FLI-06, as a γ-secretase inhibitor, can potentially affect multiple substrates beyond Notch receptors. Therefore, to strengthen the specificity of our conclusions regarding Notch1 signaling, we employed a complementary genetic approach. Specifically, targeted knockdown of Notch1 using specific siRNA in THP-1 macrophages yielded effects on downstream TLR4/NF-κB/NLRP3 pathway activation and macrophage polarization that were concordant with those observed with FLI-06 treatment. The convergence of findings from independent pharmacological inhibition and genetic suppression strongly argues that the observed phenotypes are primarily attributable to the inhibition of Notch1 signaling, rather than to off-target effects of FLI-06. We further investigated the mechanism and identified the membrane receptor TLR4 as a critical component in transmitting Notch-mediated signals. This was evidenced by the observation that TLR4 knockdown markedly inhibited COM-induced M1 polarization and inflammatory cytokine release. Most importantly, even upon artificial activation of Notch signaling by recombinant Jagged1, the absence of TLR4 abrogated the downstream propagation of inflammatory signals and failed to restore the M1 phenotype. Building on these functional data, we propose a refined mechanism for the molecular hierarchy in this context. In this study, we demonstrate that GAS5 enhances Notch1 signaling, which in turn strengthens TLR4 dependent inflammatory activation in macrophages. Importantly, our data support a mechanism in which TLR4 remains the central upstream driver of NF-κB and NLRP3 activation, while Notch1 functions as an upstream regulatory amplifier rather than a parallel or downstream pathway. This interpretation is consistent with emerging evidence that Notch signaling can modulate the transcriptional landscape of innate immune cells, thereby increasing the expression or responsiveness of key pattern-recognition receptors, including TLR4 [67, 68]. Thus, elevated Notch1 may enhance TLR4 promoter activity, facilitate chromatin accessibility to TLR4 regulated transcription factors, or increase macrophage sensitivity to TLR4 ligands. These mechanisms do not replace TLR4 mediated NF-κB activation but instead potentiate the magnitude of TLR4/NF-κB signaling, ultimately promoting M1 polarization, pyroptosis, and crystal adhesion. Together, these findings position Notch1 as a functional enhancer of the TLR4/NF-κB axis, integrating lncRNA GAS5 with innate immune inflammatory pathways in CaOx nephropathy.

An increasing number of studies have demonstrated that lncRNAs serve as key immune regulators by modulating mRNA stability or protein function, playing irreplaceable roles in transcriptional and translational gene expression processes [69, 70]. For example, lncRNA Sros1 has been shown to be degraded by miR-1, leading to stabilization of Stat1 mRNA and promoting IFN-γ-STAT1-mediated M1 macrophage polarization [71]. In the present study, we focused on lncRNA GAS5, which has recently emerged as a crucial regulator in numerous cellular processes, and whose dysregulation is implicated in the pathogenesis of various diseases [72–74]. GAS5 has been reported to act as a ceRNA for miR-743a-5p, thereby indirectly upregulating NUAK1 expression by competitively binding to miR-743a-5p [75]. This mechanism was found to promote necroptosis in BRL cells and aggravate liver injury. Additionally, GAS5 carried in nasal epithelial exosomes of patients with allergic rhinitis (AR) has been shown to regulate Th1/Th2 imbalance by suppressing EZH2 transcription and T-bet expression, thus providing a potential therapeutic target for AR [76]. In this study, we demonstrate for the first time that GAS5 serves as a critical regulator of macrophage polarization and renal injury by reinforcing Notch1-dependent inflammatory signaling through a ceRNA mechanism. In human macrophages, we identified miR-449c-5p as a key miRNA mediator shared by GAS5 and Notch1. GAS5 expression was markedly upregulated in COM-treated THP-1 derived macrophages and in renal tissues from stone patients, whereas miR-449c-5p expression was significantly reduced, showing a clear inverse correlation with GAS5 and Notch1 levels. Dual-luciferase reporter assays further confirmed that miR-449c-5p directly targets both GAS5 and the 3′UTR of Notch1, establishing a functional ceRNA network in human macrophages. Importantly, enforced expression of miR-449c-5p effectively suppressed Notch1 expression and attenuated M1 macrophage polarization, providing functional validation of this regulatory axis. Given the limited evolutionary conservation of lncRNA-miRNA interactions, we further extended our investigation to the murine system and uncovered a species-adaptive regulatory mechanism. Although the miR-449c-5p binding sites are not conserved in murine GAS5 or Notch1, GAS5 is still able to enhance Notch1 signaling in murine macrophages by sequestering miR-325-3p as an intermediary. Thus, while the specific miRNAs involved differ between species, the core regulatory logic namely, GAS5-driven derepression of Notch1 to promote pro-inflammatory macrophage polarization is conserved. This conserved, yet species-adaptive, ceRNA framework provides a mechanistic basis for the pro-inflammatory effects of GAS5 observed in both in vitro human systems and in vivo murine models of CaOx nephrolithiasis.

To investigate the role of the GAS5-miR-325-3p-Notch1 axis in macrophage polarization during CaOx nephrolithiasis, we employed a targeted delivery strategy using tail vein injection of an adeno-associated virus to upregulate GAS5 expression specifically in renal macrophages. Concurrently, the Notch signaling pathway was pharmacologically inhibited by intraperitoneal administration of FLI-06. Renal injury indices, crystal deposition, and macrophage phenotypic markers were subsequently assessed in mouse kidney tissues. Our results demonstrated that GAS5 overexpression markedly promoted M1 macrophage activation and exacerbated CaOx crystal deposition and renal damage in vivo, effects that were largely abrogated by Notch pathway inhibition. These findings establish Notch1 as a critical downstream effector mediating the pro-inflammatory and pro-lithogenic effects of GAS5 in mice. Importantly, together with our in vitro human macrophage data, these results support a conserved ceRNA regulatory logic whereby GAS5 enhances Notch1 signaling through sequestration of species-specific miRNA mediators, thereby driving macrophage polarization and renal injury during CaOx nephrolithiasis.

Our study reveals that, under COM exposure, Notch1 promotes M1 macrophage polarization and exacerbates CaOx nephrolithiasis by activating the NF-κB/NLRP3 inflammatory signaling pathway via TLR4, thereby amplifying the inflammatory response. These findings reveal novel mechanisms underlying the pathogenesis of nephrolithiasis. By delineating the synergistic involvement of macrophage polarization imbalance, overactivation of inflammatory signaling pathways, and pyroptosis in CaOx crystal formation, we identify GAS5 as a critical upstream regulator that sustains Notch1 signaling through a ceRNA mechanism. Importantly, this regulation is mediated by distinct, species-adaptive miRNA partners, miR-449c-5p in human macrophages and miR-325-3p in murine macrophages, while preserving a conserved regulatory logic. Targeting this GAS5-Notch-NF-κB/NLRP3 inflammatory axis may therefore represent a promising immunomodulatory strategy for the prevention and treatment of CaOx nephrolithiasis (Fig. 9). In conclusion, under COM-induced conditions, GAS5 driven reinforcement of Notch signaling reprograms macrophage phenotype toward a pro-inflammatory M1 state, thereby aggravating CaOx-induced renal injury.

Fig. 9.

Schematic diagram illustrating how the GAS5-Notch-NF-κB/NLRP3 axis mediates M1 macrophage polarization, reprograms macrophage phenotypes, and aggravates CaOx induced kidney injury in CaOx nephrolithiasis. Upon COM exposure, Notch1 activates the NF-κB/NLRP3 inflammatory signaling pathway via TLR4, thereby amplifying the inflammatory response, promoting M1 macrophage polarization, and exacerbating renal injury. This occurs through a synergistic process involving macrophage polarization imbalance, hyperactivation of inflammatory signaling, and pyroptosis during CaOx crystal formation. Meanwhile, GAS5 regulates Notch1 expression by targeting distinct miRNAs in a species dependent manner (miR-449c-5p in human macrophages and miR-325-3p in murine macrophages), functioning as a ceRNA network, plays a critical role in macrophage polarization and serves as a key molecular mechanism bridging these inflammatory processes. The persistent pro-inflammatory immune microenvironment further intensifies damage to renal tubular epithelial cells, thereby promoting CaOx nephrolithiasis formation

Conclusion

This study identifies GAS5 as a central regulator of macrophage driven inflammation in CaOx nephrolithiasis by reinforcing Notch1 signaling through a ceRNA dependent, species-adaptive mechanism. Activation of the GAS5-Notch1-NF-κB/NLRP3 axis promotes M1 macrophage polarization and aggravates renal injury and crystal formation, highlighting GAS5 centered inflammatory signaling as a potential immunotherapeutic target.

Limitations

Several limitations of the present study should be acknowledged. First, the availability of truly normal human kidney tissue is inherently limited. Accordingly, control specimens were obtained from tumor adjacent renal parenchyma of renal cell carcinoma nephrectomy samples, whereas CaOx specimens included both pure nephrolithiasis associated end-stage non functioning kidneys and kidneys with concurrent nephrolithiasis and RCC. Although strict pathological criteria were applied to ensure that control tissues were obtained from areas as distant as possible from the tumor margin, were free of tumor infiltration or overt inflammation, subtle cancer associated field effects cannot be completely excluded and may represent a potential confounder. Nevertheless, this approach is widely adopted in renal translational research when non neoplastic control tissue is unavailable. Second, the Gly induced CaOx nephrolithiasis model primarily reflects an acute injury phase characterized by rapid crystal deposition and inflammatory activation. While this model is well suited for elucidating early initiating mechanisms such as GAS5-mediated macrophage polarization and inflammasome driven pyroptosis, it does not fully recapitulate the chronic or recurrent features of human nephrolithiasis, particularly long term immune remodeling and fibrosis. Future studies employing chronic stone models and alternative sources of human control tissue will be necessary to further validate and extend our findings.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

LZ, SY, and SQ conceived and designed the study. LZ, SY, and YQ performed the cell and mouse experiments. RY and CX provided clinical samples. LZ, SY, YQ, HZ, and SZ analyzed the data. LZ, SY, and YQ wrote the article. LZ, SY, and SQ revised the manuscript. LZ, SY, and YQ contributed equally to this study. SQ conceived and supervised the study. LZ, SY, YQ, HZ, SZ, and QL read and revised the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (82470797), the Science and Technology Project of Tianjin (23JCZDJC00650), the Education Commission Research Project of Tianjin (2023ZD008).

Data availability

Data will be made available on request.

Declarations

Ethical approval

This study had obtained approval by the Animal Ethics Committee at the Second Hospital of Tianjin Medical University (KY2024K242). Animal experiments were performed in accordance with the “China Guide for the Protection and Use of Laboratory Animals”.

Competing interests

The authors declare no competing interests.