Skip to main content
NCBI home page
Frontiers in Immunology logoLink to Frontiers in Immunology
. 2026 May 28;17:1850953. doi: 10.3389/fimmu.2026.1850953

Generation of human-induced pluripotent stem cell-derived lung organoids for modeling respiratory syncytial virus infection and pulmonary injury

Yongli Li 1,†, Yong Chen 2,3,*,†, Naiwen Cui 4, Xiaoli Du 2, Daishun Liu 2,5,6, Fuxun Yu 2,3,6,*
PMCID: PMC13254702  PMID: 42292414

Abstract

Background

Respiratory syncytial virus (RSV) is one of the common causes of lower respiratory infections in infants. Cell lines and animals are major models for studying RSV, but single cell type and species differences make them difficult to mimic human physiological features. Stem cell-derived organoids contain multiple cell types similar to native organs and model the physiological conditions of native organs.

Methods

We used human lung organoids (HLOs) to investigate RSV infection. Immunofluorescent (IF) staining performed at 48 and 96 h post-infection to verified RSV target cells. Pro-inflammatory factor expression was assessed by RT-qPCR and ELISA. TUNEL+ apoptotic cells, Ki67+ proliferating cells, filopodia-like structures, and CDH1 (E-cadherin) expression were quantified at 96 h post-infection.

Results

RSV-infected cells included epithelial cells and PDGFRβ+ cells. RSV induced pro-inflammatory factors and elicited significant changes in cell fate: increased TUNEL+ cells indicating enhanced apoptosis, and decreased Ki67+ cells reflecting impaired cell proliferation. Furthermore, morphological changes were evident in the infected HLOs. F-actin staining revealed a marked increase in filopodia-like structures, whereas CDH1 expression was significantly reduced. These observations indicate that RSV infection affects both cytoskeletal integrity and cadherin-mediated cell junctions in HLOs.

Conclusion

Our findings confirm HLOs provide a valuable model for studying RSV infection in vitro. HLOs infected with RSV have a similar cell distribution to native lung and provide evidence of actin cytoskeleton remodeling and impaired cell adhesion.

Keywords: hiPSC, lung organoids, RSV, target cells, injury

1. Introduction

Respiratory syncytial virus (RSV) is a major pathogen responsible for upper and lower respiratory tract infections, contributing to increased morbidity and mortality in children (1). Severe RSV infection results in necrosis, epithelial cell shedding, and peribronchiolar inflammation leading to shortness of breath and respiratory failure (2). The prevalence of RSV infection surged in 2021 following the coronavirus disease 2019 (COVID-19) pandemic, contributing to the global burden of this disease (3).

Generally, cell lines and animals are major models to study RSV infection and injury. These models have enormously enriched our understanding of RSV infection and pathogenesis. However, traditional two-dimensional (2D) cell lines do not fully simulate the complex in vivo environment. Additionally, species differences prevent animal models from accurately reproducing the natural biological processes after RSV infection in humans (4). The air–liquid interface (ALI) system mimics in vivo airway epithelium and contains several epithelial cell types—ciliated cells, goblet cells, secretory cells, and basal cells (5)—whereas the ALI system usually lacks mesenchymal, alveolar, and endothelial cells, thereby limiting the information obtainable from RSV infection studies.

In recent years, human-induced pluripotent stem cell (hiPSC) and human embryonic stem cell (hESC)-derived human lung organoids (HLOs) have been shown to possess different cell types (6), such as ciliated cells, club cells, basal cells, and goblet cells. Although HLOs do not include the vascular system, immune cells, and nervous system, airway cell populations are intrinsic components of HLOs and functionally relevant to RSV infection. For instance, mesenchymal cells in HLOs have been shown to exhibit an altered expression of key molecules such as the TRPV1 calcium channel following RSV exposure, highlighting their role in mediating host–virus interaction (7). Owing to their physiological relevance and multicellular complexity, HLOs have already been used to study RSV infection and injury (7, 8).

Our study generated HLOs containing lung epithelial cells (ciliated cells, basal cells, club cells, goblet cells, AT1 cells, and AT2 cells), mesenchymal cells, and vascular progenitors (KDR+). Immunofluorescent staining (IF) results indicated that ciliated cells (Ace-tubulin+), alveolar type 2 (AT2) cells (Pro-SPC+), club cells (CC10+), and mesenchymal cells (PDGFRβ+) were susceptible to RSV. Quantitative real-time polymerase chain reaction (RT-qPCR) and enzyme-linked immunosorbent assay (ELISA) results showed that infected HLOs upregulated IL-8, IL-6, and IFN-β, mimicking in vivo innate immune response upon RSV infection. In addition, RSV infection induced apoptosis and inhibited cell proliferation. Furthermore, RSV infection promoted filopodia-like structures and reduced E-cadherin expression. Collectively, these results suggest that HLOs are a valuable model for studying RSV infection and associated epithelial injury.

2. Materials and methods

2.1. Cells and viruses

hiPSCs were purchased from ATCC (Cat#ACS-1007) and were maintained in Matrigel (BD Biosciences, Cat#354277) in mTeSR1 medium (STEMCELL Technologies, Cat#85850). The use of hiPSCs was approved by Ethics Committees of Guizhou Provincial People’s Hospital (approval number: 2023136). The RSV/A strain was isolated from nasopharyngeal secretions, and the procedures for sample collection have been described in a previous study (9). The use of RSV/A was approved by the Ethics Committees of Guizhou Provincial People’s Hospital (approval number: 202044).

2.2. HLO generation

HLOs were generated according to protocols described in previous studies (10, 11). Briefly, hiPSCs were treated with 100 ng/mL Activin A (R&D Systems, Cat#338-AC-050) and 2 μmol/L CHIR99021 (Tocris Bioscience, Cat#4423-10) to induce the definitive endoderm (DE) stage. The DE cells were incubated in Advanced DMEM/F12 medium (Life Technologies, Cat#12634010) with 200 ng/mL Noggin (R&D Systems, Cat#6057-NG-100), 10 μmol/L SB431542 (Tocris Bioscience, Cat#1614-10MG), 500 ng/mL FGF4 (PeproTech, Cat#100-31-250UG), 1% NEAA (Life Technologies, Cat#11140050), 1% GlutaMAX (Life Technologies, Cat#35050061), 1% B27 (Life Technologies, Cat#17504044), 1% N2 supplement (Life Technologies, Cat#A1370701), and 2 μmol/L CHIR-99021 (Tocris Bioscience, Cat#4423-10MG) to induce the anterior foregut endoderm (AFE) stage. AFE cells were embedded in 3D Matrigel (BD Biosciences, Cat#356237) with lung organoid medium containing 1% FBS, 1% NEAA, and 1% GlutaMAX to generate HLOs.

2.3. RSV infection

RSV/A was used in these experiments. HLOs were released from Matrigel and incubated with RSV (MOI = 0.2) for 4 h at 37°C in lung organoid medium. HLOs were washed three times to remove unbound viruses and cultured in suspension in lung organoid medium for 4 days. The supernatant was collected, and organoids were resuspended in 500 μL TRIzol reagent (Ambion, Cat#15596026). The supernatant RNA was extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Cat#52904) following the manufacturer’s protocol. Work with infectious viruses was performed in BSL-2.

2.4. RT-qPCR

cDNA was synthesized using 1 μg total RNA with RT Master Mix for qPCR II (MCE, Cat#HY-K0511A). cDNA was diluted 1:5 in RNAse-free water and used as a template for RT-qPCR using the Talent qPCR premix following the manufacturer’s protocol (TIANGEN, Cat#FP209-02) with primers (Table 1). RT-qPCR was performed on a Bio-Rad CFX96 system. Genes expression was normalized to GAPDH and compared with those in hiPSCs using the 2−ΔΔCT method. Viral RNA copy numbers were determined according to the standard curve method. Three or more biological replicates were performed for each assay, and the data bars represent mean ± SD.

Table 1.

Primers used in present study.

Gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC
SOX2 TACAGCATGTCCTACTCGCAG GAGGAAGAGGTAACCACAGGG
SOX17 GTGGACCGCACGGAATTTG GGAGATTCACACCGGAGTCA
P63 CCACCTGGACGTATTCCACTG TCGAATCAAATGACTAGGAGGGG
MUC5AC ACCAATGCTCTGTATCCTTCCC GTTTGGGTGGAGTAAGCCACA
NKX2.1 CTCATGTTCATGCCGCTC GACACCATGAGGAACAGCG
SFTPC AGCAAAGAGGTCCTGATGGA CGATAAGAAGGCGTTTCAGG
HOPX GCCTTTCCGAGGAGGAGAC TCTGTGACGGATCTGCACTC
PDGFRβ AGCACCTTCGTTCTGACCTG TATTCTCCCGTGTCTAGCCCA
SCGB1A1 TTCAGCGTGTCATCGAAACCC ACAGTGAGCTTTGGGCTATTTTT
RSV N CACAGAAGATGCAAATCATAAATTCA GTATCTTTATGGTGTCTTCTCTTCCTAACC
IL-8 ACTGAGAGTGATTGAGAGTGGAC AACCCTCTGCACCCAGTTTTC
IL-6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG
IL-1β AGCTACGAATCTCCGACCAC CGTTATCCCATGTGTCGAAGAA
TLR3 TCTGGAAACACGCAAACCCT GGGATCTCGTCAAAGCCGTT
Open in a new tab

2.5. IF staining

Samples were treated with 4% paraformaldehyde overnight at 4 °C. The organoids were rinsed three times with PBST (PBS (Solarbio, Cat#P1010) containing 0.1% Tween 20 (Solarbio, Cat#IT9010)). The samples were embedded in 3D Matrigel, covered with O.C.T. compound cryostat embedding medium (SciGen, 4583), and frozen at −80 °C. These samples were washed with PBST three times and subsequently permeabilized with 0.4% Triton X-100 (Solarbio, Cat#T8200). After 40 min at room temperature (RT), the samples were washed with PBST and blocked with 5% BSA at RT for 2 h. The samples were then incubated with primary antibodies overnight at 4 °C. Subsequently, they were washed and stained with PBST and incubated with secondary antibodies at RT for 1 h. Nuclei were counterstained with Hoechst (Invitrogen, Cat#H3570) for 3 min and then washed twice with PBST. VECTASHIELD antifade mounting medium was added (Vector Laboratories, Cat#H-1000-10) before covering with glass microscope slides. Imaging was performed on a Carl ZEISS LSM 980 system and analyzed with ZEN 2 software. Antibodies used in the present study are listed in Table 2.

Table 2.

Antibodies used in present study.

Antibodies Host Dilution Manufacture Catalog number
NKX2.1 Rabbit 1:200 Abcam Ab76013
NKX2.1 Rabbit 1:200 Cell Signaling Technology 12373S
P63 Rabbit 1:200 Abcam Ab12462
MUC5AC Rabbit 1:200 Abcam EPR16904
CC10 Rabbit 1:200 Invitrogen MA5-34625
Ace-tubulin Mouse 1:600 Sigma T7451
PDPN Hamster 1:200 Invitrogen MA5-16113
Pro-SPC Rabbit 1:200 Abcam Ab211326
PDGFRβ Rabbit 1:200 HUABIO ET1605-20
KDR Rabbit 1:200 Cell Signaling Technology 2479S
Ki67 Rabbit 1:200 Abcam Ab16667
Actin-Tracker Red-555 1:200 Beyotime C2203S
CDH1 Rabbit 1:200 Abcam Ab40772
RSV Polyclonal Antibody, FITC (2F7) Mouse 1:200 Santa Cruz Biotechnology sc-101362
RSV Polyclonal Antibody, FITC Goat 1:200 Invitrogen PA1-73017
Donkey anti-rabbit (Alexa 555) Donkey 1:500 Invitrogen Ab32794
Donkey anti-mouse (Alexa 488) Donkey 1:800 Invitrogen Ab32766
Donkey anti-mouse (Alexa 555) Donkey 1:500 Invitrogen A32773
Donkey anti-hamster (Alexa 568) Goat 1:500 Invitrogen A21112
Open in a new tab

2.6. TUNEL staining

A one-step TUNEL in situ apoptosis kit (Elabscience, Cat#E-CK-A320) was performed according to the manufacturer’s protocol. The samples were equilibrated to RT, immersed in 4% Triton X-100, and incubated at RT for 40 min. The samples were washed with PBS twice for 5 min (per wash). 100 μL of 1× Proteinase K working solution was added to each sample, incubated at 37 °C for 20 min, and washed with PBS three times for 5 min (per wash). 100 μL TdT Equilibration Buffer was added to each sample and incubated at 37 °C for 30 min. After this, 50 μL Labeling Working Solution was added to each sample and incubated in the dark (using a humidified light-excluding chamber) at 37 °C for 1 h. The samples were washed with PBS three times for 5 min (per wash) prior to adding diluted Hoechst solution and incubated at RT for 4 min in a light-tight box. The samples were washed with PBS four times for 5 min (per wash) before adding an antifade mounting medium to seal the slides. Imaging was performed on a Carl ZEISS LSM 980 system.

2.7. ELISA

Cytokine detection was performed using ELISA kits (Elabscience, E-EL-H6156, E-EL-H6008, and E-EL-H0085) following the manufacturer’s protocol. 100 μL per well of the prediluted standard, blank, and sample was plated before sealing. The plates were incubated for 90 min at 37 °C before the solution was decanted from each well and replaced with 100 μL Biotinylated Detection Ab working solution. The plates were incubated for 1 h at 37 °C, and the solution from each well was removed, replaced with 350 μL wash buffer, and dried. 100 μL of HRP conjugate working solution was added to each well and incubated for 30 min at 37 °C. Wells were decanted, washed, and dried before adding 90 μL Substrate Reagent to each well. After a 20-min incubation at 37 °C (protected from light), 50 μL of Stop Solution was added to each well and read using a 37°C preheated Biotek Synergy H1 system to determine the optical density (OD value) at 450 nm and analyzed with ELISACalc.

2.8. Statistical analysis

GraphPad Prism 9.5 was used to analyze the experimental data. Normality and homogeneity of variance were tested before statistical analysis. Independent-samples t-test was used for comparison between two groups, whereas one-way ANOVA with Tukey’s post-hoc test was applied for comparisons among three or more groups. Mean ± SD noted, *, P < 0.05, **, P < 0.01, ***, P < 0.001, and ****, P < 0.0001.

3. Results

3.1. Generation of HLOs from hiPSCs

Lung development progresses through a series of stages: from the definitive endoderm (DE), anterior foregut endoderm (AFE), and lung progenitor to the mature lung. Brightfield microscopy revealed morphological changes in cells during stepwise HLO induction (Figure 1A). By day 40, epithelial cells had existed into well-formed 3D spherical HLOs with distinct, stable morphology. RT-qPCR analysis revealed the temporal expression dynamics of differentiation marker genes. SOX17 was upregulated during the DE stage, whereas SOX2 and NKX2.1 were upregulated in the lung progenitor stage. As HLO differentiation progressed, markers of epithelial cell types, including P63, SCGB1A1, MUC5AC, SFTPC, HOPX, and PDGFRβ showed gradual increases in expression in mature stage HLOs (Figure 1B).

Figure 1.

Panel A displays four phase-contrast microscopy images of cell differentiation stages labeled hiPSCs, DE, lung progenitor, and HLOs, each depicting morphological changes. Panel B contains nine bar charts showing gene expression fold changes (SOX2, SOX17, NKX2.1, P63, MUC5AC, SCGB1A1, SFTPC, HOPX, PDGFRβ) at days 0, 3, 21, and 40 of differentiation. Panels C to K show nine immunofluorescence images, each with blue-stained nuclei and red marker staining (NKX2.1, P63, MUC5AC, CC10, Ace-tubulin, PDPN, Pro-SPC, PDGFRβ, KDR), with a yellow star marking a central structure in each.

Open in a new tab

Generation of HLOs derived from hiPSCs. (A) Brightfield field for hiPSCs (day 0), DE (day 3), lung progenitor organoids (day 21), and mature stage HLOs (day 40), scale bar: 100 μm. (B) Fold change of lineage marker genes from day 0 to day 40 over undifferentiated hiPSCs by quantitative RT-qPCR (2−ΔΔCt). hiPSCs and proximal tracheal progenitor cell (SOX2), definitive endoderm marker (SOX17), lung progenitor cells (NKX2.1), basal cell (P63), goblet cell (MUC5AC), club cell (SCGB1A1), AT2 cells (SFTPC), AT1 cells (HOPX), and mesenchymal cell (PDGFRβ). Normalized to GAPDH (N = 3). Data are presented as mean ± SD, and statistical analysis was assessed using one-way ANOVA. (C–K) IF staining of lung epithelial cells: lung progenitor cells (NKX2.1), basal cells (P63), goblet cells (MUC5AC), club cells (CC10), ciliated cells (Ace-tubulin), AT1 cells (PDPN), AT2 cells (Pro-SPC), mesenchymal cells (PDGFRβ), and vascular progenitor (KDR) at day 40. Nuclei staining with Hoechst. The asterisk indicates the lumen of organoids. Scale bar: 20 μm.

In the early stage of differentiation, lung progenitor cell marker NKX2.1 was expressed (Figure 1C). Additionally, IF staining revealed the presence of epithelial cell markers in day 40 HLOs, including ciliated cells (Ace-tubulin+) with cilia existing in the lumen and outer layer of HLOs, basal cells (P63+), club cells (CC10+), goblet cells (MUC5AC+), alveolar type 2 cells (AT2) (Pro-SPC+), and alveolar type 1 cells (AT1) (PDPN+) (Figures 1D–I). Beyond lung epithelium, PDGFRβ was detected in HLOs, confirming the presence of PDGFRβ+ mesenchymal cells (Figure 1J). Furthermore, a small population of differentiating cells expressed KDR (Figure 1K), a marker of vascular progenitors. However, these KDR+ cells failed to form vessel-like structures.

3.2. RSV infects lung epithelial cells and mesenchymal cells in HLOs

Next, day 40 HLOs were exposed to RSV (MOI = 0.2) to identify the cellular distribution of RSV infection. RT-qPCR results showed the transcriptional level of RSV mRNA was significantly elevated, indicating efficient viral replication in the infected HLOs during the RSV culture period (Figure 2A). Then, we performed co-staining for lung epithelial markers and RSV F protein to determine which cell types were infected. IF staining results showed that no RSV+ cells were observed in goblet cells (MUC5AC+), basal (P63+), and AT1 cells (PDPN+) (Figures 2B–D). Further analysis revealed that RSV-infected ciliated cells (Ace-tubulin+) and AT2 cells (Pro-SPC+) (Figures 3A, B). Among RSV+ cells, ciliated cells accounted for the highest proportion (Table 3). Additionally, club cells (CC10+) and mesenchymal cells (PDGFRβ+) were also susceptible to RSV (Figures 3C, D). RSV F protein was detected in epithelial cells (Ace-tubulin+, CC10+, Pro-SPC+), and mesenchymal cells (PDGFRβ+) distributed across different regions of HLOs at both 48 hpi (Figure 4) and 96 hpi (Figure 3). Infected epithelial cells were observed in luminal-facing structures and more peripheral regions, whereas infected mesenchymal cells were located in deeper, sub-epithelial areas. Since only a small population of KDR+ vascular progenitors was observed in HLOs, whether RSV could infect these cells remains unknown.

Figure 2.

Panel A shows a bar chart comparing viral RNA levels in copies per microliter before infection and at 96 hours post-infection, with a significant increase observed at 96 hours. Panel B presents fluorescence microscopy images showing co-staining for MUC5AC (red), RSV (green), and nuclei (blue) in mock and RSV-infected samples, with increased RSV and altered MUC5AC localization in infection. Panel C displays similar images for PDPN (red), RSV (green), and nuclei (blue), highlighting changes in expression and RSV presence post-infection. Panel D shows P63 (red), RSV (green), and nuclei (blue), documenting altered staining patterns and viral presence after infection.

Open in a new tab

Infection of HLOs with RSV. (A) Comparison of RSV N mRNA expression in HLOs pre- and 96 h post-RSV infection was determined by RT-qPCR assays (N = 3). Data are presented as mean ± SD. and statistical significance was assessed using a two-tailed t-test. ****, P < 0.0001. (B–D) Confocal immunofluorescence microscopy of cells within RSV-infected HLOs (MOI = 0.2) post-96 h infection: RSV F and epithelial cell lineage marker expression. Goblet cells (MUC5AC), AT1 cells (PDPN), and basal cells (P63). Scale bars: 20 μm.

Figure 3.

Four panels labeled A, B, C, and D compare mock and RSV-96 hours post-infection (hpi) lung tissue immunofluorescence. Markers Ace-Tub, Pro-SPC, CC10, and PDGFRβ appear in red, RSV in green, and nuclei in blue. Each panel contains main and split channels showing marker co-localization with RSV, highlighting cellular marker changes after infection.

Open in a new tab

Infection of HLOs with RSV for 96 h. (A–D) Confocal immunofluorescence microscopy of cells within RSV-infected HLOs (MOI = 0.2) post-96 h infection: RSV F and epithelial cell lineage marker expression. Ciliated cells (Ace-tubulin), AT2 cells (Pro-SPC), club cells (CC10), and mesenchymal cells (PDGFRβ). Scale bars: 20 μm.

Table 3.

Cell composition of RSV-positive cells.

Cell type Marker/RSV
AT1 (PDPN) 0/416 (0%)
AT2 (Pro-SPC) 89/416 (21.4%)
Basal cell (p63) 0/416 (0%)
Club cell (CC10) 35/416 (8.4%)
Goblet cell (MUC5AC) 0/416 (0%)
Ciliated cell (Ace-tubulin) 187/416 (45%)
Mesenchymal cell (PDGFRβ) 105/416 (25.2%)
Open in a new tab

Percentages indicate the proportion of each marker-positive cell type among all RSV F-positive cells within HLOs. Marker and Hoechst-positive cells were counted in randomly selected view fields within a section.

Figure 4.

Multipanel figure showing immunofluorescence images of lung tissue with markers Ace-Tub, Pro-SPC, CC10, PDGFRß, MUC5AC, P63, and PDPN, nuclei in blue, RSV in green, and marker in red, comparing mock-infected and RSV-48 hours post-infection groups, with marker and RSV signal co-localization visible in infected samples.

Open in a new tab

Infection of HLOs with RSV for 48 h. (A–G) Confocal immunofluorescence microscopy of cells within RSV-infected HLOs (MOI = 0.2) post-48 h infection: RSV F and epithelial cell lineage marker expression. Ciliated cells (Ace-tubulin), AT2 cells (Pro-SPC), club cells (CC10), and mesenchymal cells (PDGFRβ) were susceptible to RSV, goblet cells (MUC5AC), basal cells (P63) and AT1 cells (PDPN) were not susceptible to RSV. Scale bars: 20 μm.

3.3. RSV-infected HLOs mimic several aspects of lung injury

Toll-like receptors (TLRs) sense viral particles and virus-derived nucleic acids during RSV infection (12). RT-qPCR confirmed the upregulation of TLR3 expression in RSV-infected HLOs (Figure 5A). Next, we confirmed that cytokine expression was elevated in RSV-infected HLOs compared with uninfected controls (Figures 5B, C). Additionally, our data showed that IL-1β mRNA expression was upregulated after RSV infection (Figure 5D). Furthermore, ELISA assays revealed that IL-8 increased 82-fold, IL-6 increased 26-fold, and interferon-β (IFN-β) increased 3-fold 96 h post-infection (Figures 5E–G).

Figure 5.

Bar graphs labeled A–G compare mock and RSV groups, showing significant increases in TLR3, IL-8, IL-6, IL-1β, IFN-β mRNA expression, and IL-8, IL-6, IFN-β protein concentrations for RSV. Fluorescence microscopy in panels H and J shows TUNEL (apoptosis marker) staining and Ki67 (proliferation marker) staining, respectively, with more TUNEL-positive nuclei and fewer Ki67-positive nuclei in RSV-infected samples. Bar graphs I and K quantify increased apoptosis and decreased proliferation in RSV compared to mock controls.

Open in a new tab

Immune cytokine/chemokine profile and apoptosis for HLOs after RSV infection. (A–D) Quantifying TLR3, IL-8, IL-6, and IL-1β for RSV-induced HLOs using RT-qPCR (N = 3). (E–G) IL-8, IL-6, and IFN-β ELISA profile for RSV-infected HLOs (N = 4). (H) TUNEL staining for RSV-infected HLOs and the mock group. (I) A statistical analysis for the percentage of apoptotic cells in RSV-infected HLOs and the mock group (N = 6). (J) IF staining for Ki67 in RSV-infected HLOs and the mock group. (K) Statistical analysis for the percentage of proliferative cells in RSV-infected HLOs and the mock group (N = 5). Scale bars: 10 μm. Data are presented as mean ± SD, and statistical significance was assessed using a two-tailed t-test. *, P < 0.05, **, P < 0.01, ***, P < 0.001, and ****, P < 0.0001.

Apart from immune responses, programmed cell death is another way host cells protect themselves (13). We verified apoptosis in HLOs upon RSV infection. TUNEL staining of RSV-infected HLOs showed that the structure of RSV-infected HLOs was affected compared with the mock group, and apoptosis increased approximately 5-fold (Figures 5H, I). Meanwhile, IF staining showed that the Ki67 proliferation marker was reduced in RSV-infected HLOs (Figures 5J, K). The actin cytoskeleton and adherens junctions are essential for maintaining epithelial barrier function and epithelial homeostasis. RSV infection increased the number of filopodia-like structures (Figures 6A, B). Moreover, syncytia were also observed (Figure 6C). E-cadherin (CDH1), an important protein for maintaining lung epithelial integrity, was downregulated in RSV-infected HLOs (Figures 6D, E). These results indicate that RSV infection can induce an innate immune response and apoptosis, inhibit proliferation, promote filopodia-like structures, and downregulate E-cadherin in HLOs.

Figure 6.

Panel A shows fluorescent microscopy images comparing F-actin (red), RSV (green), and nuclei (blue) staining in mock and RSV-infected samples, with mock displaying intact structures and RSV showing disrupted morphology and more filopodia-like structures. Panel B is a bar graph quantifying increased filopodia-like structures per field in RSV versus mock samples. Panel C presents a merged fluorescent image highlighting a region with disrupted F-actin and RSV signal, circled in yellow. Panel D displays fluorescent microscopy images of CDH1 (red), RSV (green), and nuclei (blue), showing loss of CDH1 organization in RSV-infected samples compared to mock. Panel E is a bar graph quantifying significantly reduced fluorescence intensity per field in RSV-infected samples relative to mock.

Open in a new tab

RSV infection affects F-actin structure and E-cadherin (CDH1) expression. (A) IF for F-actin in RSV-infected HLOs and the mock group 96 h post-infection. White arrowheads pointing to filopodia-like structures. (B) Statistical analysis for the number of filopodia-like structures in HLOs (N = 4). (C) IF of RSV-infected HLOs showing syncytia formation. Scale bars: 10 μm. (D) IF for CDH1 in RSV-infected HLOs and mock group. (E) Statistical analysis for the relative fluorescence intensity of CDH1 (N = 3). Scale bars: 10 μm. Data are presented as mean ± SD, and statistical significance was assessed using a two-tailed t-test. *, P < 0.05, **, P < 0.01.

4. Discussion

This study generated HLOs to investigate RSV infection patterns and epithelial injury. The native lung contains multiple types of epithelial, mesenchymal, immune, and vascular cells (14). In the present study, HLOs contained epithelial cells, mesenchymal cells, and a small population of KDR+ vascular progenitors. Previous studies have successfully established vascularized human lung progenitor organoids and adopted vascular induction cocktails to construct spatially organized and branched vascularized cardiac organoids (15, 16). Nevertheless, no study has yet generated HLOs containing vascular endothelial cells via the differentiation of hiPSCs. Therefore, we hypothesize that co-differentiating hiPSCs can be applied to generate HLOs with vascular endothelial cells, providing a more physiologically relevant model for investigating RSV infection in vitro.

In human lung, RSV is frequently detected in ciliated cells (17), and infected ciliated cells lacked cilia similar to those found in murine RSV-infection models with human lung implants (18). Consistent with previous studies (19–23), our results showed that ciliated cells (Ace-tubulin+), club cells (CC10+), and AT2 (Pro-SPC+) cells are susceptible to RSV, whereas basal (P63+) and goblet cells (MUC5AC+) are not observed. Mesenchymal cells are crucial in lung development and maintain physiological homeostasis. Harford et al. demonstrated that RSV can infect α-SMA+ and vimentin+ cells in HLOs (7). We further observed that PDGFRβ+ mesenchymal cells display susceptibility to RSV infection. However, as we did not perform co-staining with other mesenchymal lineage markers on PDGFRβ+ cells, the subsets of PDGFRβ+ cells susceptible to RSV remain to be defined. Further studies are therefore required to identify the exact mesenchymal cell subtypes vulnerable to RSV.

Innate immunity is the line of defense against viral infections. We observed an increased expression of TLR3 in RSV-infected HLOs. TLRs bind pathogen-related molecular patterns and activate transcription factors to upregulate antiviral and pro-inflammatory cytokines (24), such as IL-8 and IL-6 which were selected as well-established biomarkers of RSV-induced innate immunity (25). We demonstrated that RSV-infected HLOs exhibited increased secretion of IL-8 and IL-6, consistent with previous studies (19). The elevated production of these inflammatory cytokines reflects a typical host inflammatory response triggered by RSV infection but does not fully recapitulate complex immune cell recruitment seen in vivo.

TUNEL staining verified that apoptosis in RSV-infected HLOs increased. Welliver et al. (26) demonstrated that RSV increases bronchiolar epithelial cell death in fetal lung tissue. Apoptosis, which has been associated with less severe RSV infection in children, is thought to be related to better control of viral replication (27). In infant-derived nasal organoids, the level of cell death quantified by Caspase 3/7 activity was also increased upon RSV infection (28). Meanwhile, human bronchial epithelial cells are arrested in the G1 and G2/M phases of the cell cycle after RSV infection (29), suggesting that RSV may affect cell proliferation. Our results demonstrate that the number of Ki67+ proliferative cells decreased in RSV-infected HLOs. However, there were no statistically significant changes in the amount of cell proliferation in RSV/A or RSV/B-infected HNO-ALI (28). Whether such proliferative differences result from variations in viral titers or distinct experimental models requires further study. Collectively, these results indicate that HLOs can model the process of RSV infection, including the innate immune response, cell apoptosis, and cell proliferation.

Filopodia and syncytia are the core mechanisms of RSV cell-to-cell transmission (30). Syncytia are multinucleated structures induced by RSV F protein (31), allowing cytoplasmic exchange and rapid viral spread. This cell–cell fusion process is partially shielded from extracellular neutralizing antibodies (32). Concurrently, RSV induces host cells to form filopodia, creating direct channels for virus particle transport (33). F-actin composed filopodia enhance the uptake of virus by airway epithelial cells, and promote RSV invasion and intercellular transmission (34). In the present study, our IF staining results clearly captured these two mechanisms (Figures 6A, C), confirming active viral protein expression during membrane fusion. These mechanisms act synergistically: Filopodia mediate the delivery of viral particles to neighboring cells, whereas syncytia enable dissemination within the epithelial layer through direct cell-cell fusion.

The formation and function of filopodia depend on the actin skeleton and apical junction complexes (AJCs) of host cells, which are key to maintaining epithelial homeostasis and barrier function (35). E-cadherin mediates several physiological processes, including cell–cell adhesion, proliferation, and differentiation (36). There have been conflicting reports on the expression of E-cadherin after RSV infection. For example, OVA-RSV-challenged mice exhibited E-cadherin loss, and E-cadherin expression decreased in RSV-infected NCI-H292 cells (37, 38). While RSV infection did not change E-cadherin expression in A549 and normal human bronchial epithelial cells (NHBECs), it was shown to be increased in NHBECs cultured in a differentiating ALI system (39). Notably, RSV infection decreased E-cadherin expression in the present study. A key difference between the A549, NHBEC, and ALI systems and the HLOs in our study is that HLOs incorporate not only lung epithelial cells but also mesenchymal cells and a complex microenvironment. However, whether this complex structure and physiological environment promote the degradation of E-cadherin after RSV infection remains to be further studied. By utilizing cell structures closely related to epithelial barrier function, RSV can efficiently achieve cell-to-cell transmission, which not only avoids extracellular immune surveillance but also relies on the host’s own molecular mechanisms to enhance the spread of infection, providing support for understanding how RSV controls host cellular components to mediate pathogenesis. In this regard, our HLOs may provide valuable biological insights into RSV infection.

However, this study also has several limitations. Cilia were observed on both luminal and basal-facing surfaces. It is difficult to distinguish whether RSV entry cells through apical or basolateral side. Although HLOs better simulate physiological characteristics than traditional monolayer cell models, and our HLO model contains only a small population of KDR+ vascular progenitors, their microenvironment is far less complex than that of natural human lung tissue. Moreover, the model lacks several critical components of native lung tissue, including immune cells like macrophages, dendritic cells, and lymphocytes, as well neural cells. This restricts the study of immune-mediated pathogenesis and neuro-epithelial interactions during RSV infection. In addition, IF analysis using frozen sections can only reflect the status of specific cell populations at a single time point, lacking dynamic observation.

In the future, we will optimize culture conditions to establish stable apical–basal polarity and explore the approach of co-differentiation of HLOs and vascular structures. This will help to evaluate the sensitivity of endothelial cells to RSV. In addition, single-cell multi-omics and immune-biomarker frameworks that have been used in inflammatory diseases may help comprehensively characterize cell heterogeneity and determine RSV-targeted cell types.

Funding Statement

The author(s) declared that financial support was received for this work and/or its publication. This study was supported by the Guiyang Bureau of Science and Technology major special program ((2022)-4-1), the National Natural Science Foundation of China (81960001, 82060010, and 8236001), the Guizhou Provincial Respiratory Critical Disease Clinical Research and Prevention and Treatment Talent Base Project, China ((2020)8), the Doctoral Research Program of Guizhou Provincial People’s Hospital (GZSYBS (2021)02), and the Talents Program of Guizhou Provincial People’s Hospital ((2023)-8).

Footnotes

Edited by: Bingcheng Wang, Case Western Reserve University, United States

Reviewed by: Luc Mongeau, McGill University, Canada

Xin Wang, The First Affiliated Hospital of China Medical University, China

Dangdang Wang, The First Affiliated Hospital of Chongqing Medical University, China

Data availability statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Ethics statement

Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used.

Author contributions

YL: Investigation, Formal analysis, Visualization, Writing – original draft. YC: Formal analysis, Supervision, Funding acquisition, Writing – review & editing. NC: Formal analysis, Validation, Writing – review & editing. XD: Resources, Writing – review & editing. DL: Resources, Funding acquisition, Writing – review & editing. FY: Supervision, Funding acquisition, Writing – review & editing.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

  • 1. Baraldi E, Checcucci Lisi G, Costantino C, Heinrichs JH, Manzoni P, Ricco M, et al. RSV disease in infants and young children: Can we see a brighter future? Hum Vaccin Immunother. (2022) 18:2079322. doi:  10.1080/21645515.2022.2079322. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Gong L, Wu C, Lu M, Huang C, Chen Y, Li Z, et al. Analysis of incidence and clinical characteristics of RSV infection in hospitalized children: A retrospective study. Risk Manag Healthc Policy. (2021) 14:1525–31. doi:  10.2147/RMHP.S305370. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Gatt D, Martin I, AlFouzan R, Moraes TJ. Prevention and treatment strategies for respiratory syncytial virus (RSV). Pathogens. (2023) 12:154. doi:  10.3390/pathogens12020154. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Taylor G. Animal models of respiratory syncytial virus infection. Vaccine. (2017) 35:469–80. doi:  10.1016/j.vaccine.2016.11.054. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Silva S, Bicker J, Falcao A, Fortuna A. Air-liquid interface (ALI) impact on different respiratory cell cultures. Eur J Pharm Biopharm. (2023) 184:62–82. doi:  10.1016/j.ejpb.2023.01.013. PMID: [DOI] [PubMed] [Google Scholar]
  • 6. Du X, Dong Y, Li W, Chen Y. hPSC-derived lung organoids: Potential opportunities and challenges. Heliyon. (2023) 9:e13498. doi:  10.1016/j.heliyon.2023.e13498. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Harford TJ, Rezaee F, Dye BR, Fan J, Spence JR, Piedimonte G. RSV-induced changes in a 3-dimensional organoid model of human fetal lungs. PloS One. (2022) 17:e0265094. doi:  10.1371/journal.pone.0265094. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Hashimoto R, Watanabe Y, Keshta A, Sugiyama M, Kitai Y, Hirabayashi A, et al. Human iPS cell-derived respiratory organoids as a model for respiratory syncytial virus infection. Life Sci Alliance. (2025) 8:e202402837. doi:  10.26508/lsa.202402837. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Zhao T, Ye Z, Wang B, Cui Y, Nie Y, Yang B, et al. Virus isolation and genotype identification of human respiratory syncytial virus in Guizhou Province, China. Braz J Infect Dis. (2019) 23:427–34. doi:  10.1016/j.bjid.2019.10.007. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Chen Y, Feng J, Zhao S, Han L, Yang H, Lin Y, et al. Long-term engraftment promotes differentiation of alveolar epithelial cells from human embryonic stem cell derived lung organoids. Stem Cells Dev. (2018) 27:1339–49. doi:  10.1089/scd.2018.0042. PMID: [DOI] [PubMed] [Google Scholar]
  • 11. Han L, Zhao S, Yu F, Rong Z, Lin Y, Chen Y. Generation of human embryonic stem cell-derived lung organoids. STAR Protoc. (2022) 3:101270. doi:  10.1016/j.xpro.2022.101270. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Van Royen T, Rossey I, Sedeyn K, Schepens B, Saelens X. How RSV proteins join forces to overcome the host innate immune response. Viruses. (2022) 14:419. doi:  10.3390/v14020419. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Pickles RJ, Chen G, Randell SH. Enhanced susceptibility of pediatric airway epithelium to respiratory syncytial virus infection. J Clin Invest. (2024) 134:e185689. doi:  10.1172/JCI185689. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Barkauskas CE, Chung MI, Fioret B, Gao X, Katsura H, Hogan BL. Lung organoids: Current uses and future promise. Development. (2017) 144:986–97. doi:  10.1242/dev.140103. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Miao Y, Pek NM, Tan C, Jiang C, Yu Z, Iwasawa K, et al. Co-development of mesoderm and endoderm enables organotypic vascularization in lung and gut organoids. Cell. (2025) 188:4295-4313.e27. doi:  10.1016/j.cell.2025.05.041. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Abilez OJ, Yang H, Guan Y, Shen M, Yildirim Z, Zhuge Y, et al. Gastruloids enable modeling of the earliest stages of human cardiac and hepatic vascularization. Science. (2025) 388:eadu9375. doi:  10.1126/science.adu9375. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Talukdar SN, Osan J, Ryan K, Grove B, Perley D, Kumar BD, et al. RSV-induced expanded ciliated cells contribute to bronchial wall thickening. Virus Res. (2023) 327:199060. doi:  10.1016/j.virusres.2023.199060. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Wahl A, De C, Abad Fernandez M, Lenarcic EM, Xu Y, Cockrell AS, et al. Precision mouse models with expanded tropism for human pathogens. Nat Biotechnol. (2019) 37:1163–73. doi:  10.1038/s41587-019-0225-9. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Rajan A, Weaver AM, Aloisio GM, Jelinski J, Johnson HL, Venable SF, et al. The human nose organoid respiratory virus model: An ex vivo human challenge model to study respiratory syncytial virus (RSV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pathogenesis and evaluate therapeutics. mBio. (2021) 13:e0351121. doi:  10.1128/mbio.03511-21. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. da Silva RP, Thome BL, da Souza APD. Exploring the immune response against RSV and SARS-CoV-2 infection in children. Biol (Basel). (2023) 12:1223. doi:  10.3390/biology12091223. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Yu G, Mo S, Gao L, Wen X, Chen S, Long X, et al. Club cell 10-kDa protein (CC10) inhibits cPLA2/COX2 pathway to alleviate RSV-induced airway inflammation and AHR. Int Immunopharmacol. (2020) 83:106327. doi:  10.1016/j.intimp.2020.106327. PMID: [DOI] [PubMed] [Google Scholar]
  • 22. Tripp RA. Modeling respiratory syncytial virus cytopathogenesis in the human airway. Am J Respir Crit Care Med. (2013) 188:766–7. doi:  10.1164/rccm.201308-1491ED. PMID: [DOI] [PubMed] [Google Scholar]
  • 23. Johnson JE, Gonzales RA, Olson SJ, Wright PF, Graham BS. The histopathology of fatal untreated human respiratory syncytial virus infection. Mod Pathol. (2007) 20:108–19. doi:  10.1038/modpathol.3800725. PMID: [DOI] [PubMed] [Google Scholar]
  • 24. Bergeron HC, Tripp RA. Immunopathology of RSV: An updated review. Viruses. (2021) 13:2478. doi:  10.3390/v13122478. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Vazquez Y, Gonzalez L, Noguera L, Gonzalez PA, Riedel CA, Bertrand P, et al. Cytokines in the respiratory airway as biomarkers of severity and prognosis for respiratory syncytial virus infection: An update. Front Immunol. (2019) 10:1154. doi:  10.3389/fimmu.2019.01154. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Welliver TP, Garofalo RP, Hosakote Y, Hintz KH, Avendano L, Sanchez K, et al. Severe human lower respiratory tract illness caused by respiratory syncytial virus and influenza virus is characterized by the absence of pulmonary cytotoxic lymphocyte responses. J Infect Dis. (2007) 195:1126–36. doi:  10.1086/512615. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Mehta R, Scheffler M, Tapia L, Aideyan L, Patel KD, Jewell AM, et al. Lactate dehydrogenase and caspase activity in nasopharyngeal secretions are predictors of bronchiolitis severity. Influenza Other Respir Viruses. (2014) 8:617–25. doi:  10.1111/irv.12276. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Aloisio GM, Nagaraj D, Murray AM, Schultz EM, McBride T, Aideyan L, et al. Infant-derived human nasal organoids exhibit relatively increased susceptibility, epithelial responses, and cytotoxicity during RSV infection. J Infect. (2024) 89:106305. doi:  10.1016/j.jinf.2024.106305. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Bian T, Gibbs JD, Orvell C, Imani F. Respiratory syncytial virus matrix protein induces lung epithelial cell cycle arrest through a p53 dependent pathway. PloS One. (2012) 7:e38052. doi:  10.1371/journal.pone.0038052. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Gower TL, Pastey MK, Peeples ME, Collins PL, McCurdy LH, Hart TK, et al. RhoA signaling is required for respiratory syncytial virus-induced syncytium formation and filamentous virion morphology. J Virol. (2005) 79:5326–36. doi:  10.1128/JVI.79.9.5326-5336.2005. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Edmonds KR, Dutch R. Respiratory syncytial virus fusion activity syncytia assay. Methods Mol Biol. (2025) 2948:73–83. doi:  10.1007/978-1-0716-4666-3_5. PMID: [DOI] [PubMed] [Google Scholar]
  • 32. Zhang H, Zhang Z, Yang Y, Pei J. Exploring therapeutic targets from spreading patterns against respiratory syncytial virus. FASEB J. (2025) 39:e70858. doi:  10.1096/fj.202500509RR. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Cifuentes-Munoz N, Dutch RE, Cattaneo R. Direct cell-to-cell transmission of respiratory viruses: The fast lanes. PloS Pathog. (2018) 14:e1007015. doi:  10.1371/journal.ppat.1007015. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Kieser QJ, Granoski MJ, McClelland RD, Griffiths C, Bilawchuk LM, Stojic A, et al. Actin cytoskeleton remodeling disrupts physical barriers to infection and presents entry receptors to respiratory syncytial virus. J Gen Virol. (2023) 104:001923. doi:  10.1099/jgv.0.001923. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Tsukita K, Kitamata M, Kashihara H, Yano T, Fujiwara I, Day TF, et al. Phase separation of an actin nucleator by junctional microtubules regulates epithelial function. Sci Adv. (2023) 9:eadf6358. doi:  10.1126/sciadv.adf6358. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Saito M, Tucker DK, Kohlhorst D, Niessen CM, Kowalczyk AP. Classical and desmosomal cadherins at a glance. J Cell Sci. (2012) 125:2547–52. doi:  10.1242/jcs.066654. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Yang R, Tan M, Xu J, Zhao X. Investigating the regulatory role of ORMDL3 in airway barrier dysfunction using in vivo and in vitro models. Int J Mol Med. (2019) 44:535–48. doi:  10.3892/ijmm.2019.4233. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Liu JJ, Zhang T, Mi YM. Effects of respiratory syncytial virus infection on epidermal growth factor receptor, tight junction association proteins and mucin in airway epithelial cells. Zhongguo Dang Dai Er Ke Za Zhi. (2019) 21:294–9. doi:  10.7499/j.issn.1008-8830.2019.03.020. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Talukdar SN, McGregor B, Osan JK, Hur J, Mehedi M. Respiratory syncytial virus infection does not induce epithelial-mesenchymal transition. J Virol. (2023) 97:e0039423. doi:  10.1128/jvi.00394-23. PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Articles from Frontiers in Immunology are provided here courtesy of Frontiers Media SA

RESOURCES