Genome-wide identification and expression profiling of Na–K–Cl cotransporter 1 gene (Slc12a2) in Hilsa Shad across marine–freshwater transition

Abstract

The Hilsa Shad is an anadromous fish of major ecological and economic importance in Bangladesh. It migrates between marine and freshwater environments and faces substantial osmotic challenges. There is limited research on osmoregulatory gene expression during migration across diverse habitats. This study provides the first genome-wide identification of the Slc12a2 gene in Hilsa Shad and confirms the existence of two Slc12a2 gene paralogs. To evaluate their potential role in salinity adaptation, we further examined their expression across contrasting habitats. The Bay of Bengal where the fish originates, the genome-wide expression of Slc12a2 has not yet been investigated. The Surma River has been identified as a significant freshwater habitat for Hilsa Shad. However, the molecular information including gene expression data has not yet been reported for this population. In this study, RT-qPCR was used to analyze gill, kidney, liver, and muscle tissues of Hilsa Shad. The results showed that both Slc12a2 paralogs were significantly down-regulated during upstream migration from the Bay to Bengal to the Surma River. These findings demonstrate the essential role of Slc12a2 in maintaining osmotic balance during habitat transition. This genome-wide approach also gives an overall picture of how multiple Slc12a2 gene copies respond to environmental salinity changes and regulate homeostasis.

1. Introduction

The Hilsa Shad (Tenualosa ilisha) is the national fish of Bangladesh, and it was granted the prestigious Geographical Indication (GI) status in 2017. It is also considered the country's silver pride due to its cultural, nutritional, and economic importance.¹ This single species contributes 11% to the total fish production, 1% to the national GDP, 3% of the total export earnings. It also provides livelihoods for about 2.5 million people in Bangladesh who are directly dependent on Hilsa.² This anadromous fish migrates across diverse habitats for their reproduction, growth, and development, and constantly faces osmoregulatory challenges. To overcome these, T. ilisha expresses a wide range of osmoregulatory genes that play a vital role in maintaining ionic homeostasis.³ Remarkably, the electroneutral Na–K–Cl cotransporter 1 (NKCC1), encoded by the Slc12a2 gene, is a member of the sodium-dependent subgroup of the solute carrier 12 (SLC12) transporter family.⁴This osmoregulatory gene transports sodium, potassium, and chloride ions, and supports fish in regulating osmotic balance and fluid stability under changing environmental conditions.⁵ The protein abundance of NKCC1 has been reported under hypersaline conditions in numerous teleost, including brown trout (Salmo trutta), tilapia, killifish, striped bass, and several salmonids.⁶ Conversely, there is increasing evidence that under hyposaline conditions, seawater-type ionocytes expressing high levels of Slc12a2 at the basolateral membrane differentiate into freshwater-type ionocytes. Their Slc12a2 expression then declines substantially and it clearly reflects the functional transition to a freshwater-type transport phenotype.⁷

February is the secondary breeding period of Hilsa Shad, during which they migrate from the sea to the rivers of Bangladesh.⁸ The Meghna River serves as one of the major spawning sites and an important nursery ground for Hilsa juveniles.⁹ This river branches into two rivers, the Surma and the Kushiyara, which flow through Sylhet district of Bangladesh — in the northeastern area.¹⁰ Significantly, the Surma–Meghna system is the longest river system in the country, with a length of about 669 km.¹¹ It drains one of the world's rainiest areas, with Cherapunji in Meghalaya, India, receiving close to 1000 cm of rainfall annually.¹² Notedly, heavy monsoon precipitation in Sylhet and intense upstream rainfall in Meghalaya often exceed the capacity of the Surma–Meghna River system to contain runoff. As a result, recurrent flash floods have been observed in this region over the past three decades (June–August), with major events recorded in 1988, 2007, 2010, 2017, and 2022.¹³ These floods in Sylhet eventually discharge into the Meghna River through the Kushiyara. Due to this water flow, juvenile Hilsa migrate from the Meghna into the river networks of the northeastern region, notably the Surma River.¹⁴ This movement of juvenile Hilsa shad from the Meghna to the Surma River is considered part of the upstream migration of the same migratory population.¹⁵

In spite of its tremendous socio-economic importance, Hilsa Shad still lacks sufficient molecular and genomic information.² Further research is required to better understand its physiology and adaptive mechanisms in both marine and freshwater environments. Therefore, by focusing on the osmoregulatory gene, particularly the Slc12a2, our study provides valuable insights into the cellular responses of Hilsa Shad. These findings help to explain the physiological adaptability of this species across contrasting salinity environments. The Bay of Bengal, which is the only sea bordering Bangladesh, is a major habitat for adult Hilsa Shad.¹⁶ However, the osmotic stress responses mediated by ion transporters, including Slc12a2, in this marine environment remain poorly understood. In contrast, the Surma River in northeastern Bangladesh has recently become an important freshwater habitat for juvenile Hilsa Shad.¹⁷ Interestingly, this north-eastern riverine population is also recognized as the clear freshwater group of Hilsa Shad.¹⁸ Yet the osmoregulatory role of Slc12a2 in this riverine system remains largely unexplored. In addition to that, the whole genome of Hilsa Shad was first sequenced in 2018, with three assemblies available in the NCBI database.¹⁹ But its genetic database has not been well updated since then. To address these important knowledge gaps, a genome-wide screening of Slc12a2 in Hilsa Shad was conducted in the present study. For the first time, we determined the copy number (Slc12a2 paralogs) in Hilsa Shad using a molecular approach. Moreover, the expression of the gene paralogs in different tissues was investigated under natural physiological conditions across two distinct salinity habitats. The findings of this study will provide key evidence to support future conservation and sustainable commercial aquaculture initiatives, which remain underdeveloped for this valuable species.

2. Materials and methods

2.1. Genome wide prediction of Hilsa Shad Slc12a2 gene paralogs

The Slc12a2 gene sequence of the three-spined stickleback (Gasterosteus aculeatus) was retrieved from ENSEMBL (ID: ENSGACG00000018343) and used as the query sequence (https://asia.ensembl.org/index.html). The stickleback sequence was then applied in an NCBI Genome BLAST search against the complete genome of Hilsa Shad (Tenualosa ilisha) (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The BLAST search results were sorted by E-value, and the top hits with the lowest E-values were selected for further analysis. This approach yielded 100 candidate contigs that potentially contained Slc12a2 (Supplementary Information 1). All retrieved contigs were downloaded in FASTA format and analyzed using FGENESH, an HMM-based gene prediction tool, with three-spined stickleback selected as the reference organism (http://www.softberry.com/). The predicted coding DNA sequences (CDS) were subsequently validated by examining their conserved functional domains using the NCBI Conserved Domain Database (CDD) (NCBI/CDD/Search). The predicted Hilsa Slc12a2 gene sequences were retrieved in FASTA format from the contigs by extracting the regions defined by the CDS. The detected Slc12a2 gene copies (paralogs) were subsequently designated Slc12a2.1 and Slc12a2.2, in accordance with the three-spined stickleback ortholog (Slc12a2).

2.2. Ethics statement

The study adhered to institutional and national guidelines for the care and use of animals and received ethical approval from the Animal Experimentation Ethics Committee of Sylhet Agricultural University, Sylhet, Bangladesh (Approval No. AUP2023003). The institution ensures the highest standards of animal welfare in accordance with the regulations of the Bangladesh Veterinary Council.

2.3. Sample collection

The fish were collected alive using traditional gill nets at fishermen's daytime catch sites. Morphometric characterization was performed immediately after collection, and suitable individuals were identified based on size and Length–Weight Relationship criteria.²⁰ The marine habitat comprised individuals at various life stages—juveniles, pre-adults, and adults. However, only the adult fish of 30–40 cm in length were selected for tissue isolation. In contrast, the Surma River population exclusively consisted of juvenile Hilsa, with an average length of approximately 18 cm. Subsequently, the in situ aseptic isolation of gill, kidney, liver, and muscle tissues were completed by sterile surgical instruments. The samples were immediately cryopreserved in liquid nitrogen tank and stored at −80 °C until RNA extraction. The proper collection and preservation of tissues were ensured by careful handling to maintain sample integrity and suitability for downstream molecular analyses.

Marine specimens (n = 9) were collected in mid-February from the Bay of Bengal near the Kuakata coast. Freshwater samples (n = 9) were obtained in mid-September 2024 from the Surma River in the Sylhet district, which corresponds to the only period when the fish migrate to this habitat after flash flood (Fig. 1). Notably, at the Kuakata coast, water salinity (19.80 ± 0.8 ppt) and temperature (28.20 ± 0.3 °C) were reported between December and March.²¹ Conversely, in the Surma River, water temperature was recorded 30.00 ± 1.29 °C in September, with annual conductivity (172–306 μS/cm) equivalent to about 0.10–0.18 ppt salinity.22, 23

Fig. 1.

Map of Bangladesh indicating the sampling locations of Hilsa Shad. The red and black rectangles represent the locations of fish collection from Bay of Bengal and Surma River, respectively. Green sign indicates the formation of the Surma and Kushiyara rivers from the Meghna River in northeastern Bangladesh. Purple dots indicate the upstream migration route of juvenile Hilsa Shad from the Meghna River to the Surma River following flash floods. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

2.4. DNA extraction, PCR primer construction and PCR

TIANamp Genomic DNA Kit was used to extract genomic DNA from the muscle of Hilsa Shad according to the manufacturers' guideline. Briefly, the DNA extraction process started upon adding 20 μl of Proteinase K to the mechanically disrupted muscle tissue extract and mixed them thoroughly. The mixture was incubated at 56 °C for 1 h for complete lysis where samples were inverted after each ten minutes. Next, 200 μl of Buffer GB was added and incubated the mixture at 70 °C for 10 min which caused white precipitation within first few minutes. Afterward, 200 μl of ethanol (96–100%) was added for 15 s and briefly centrifuged the eppendorf. The mixture was then transferred to a spin column CB3 placed over a 2 ml collection tube and centrifuged at 12,000 rpm for 30 s. Later, the flow-through was discarded and run this step again with 500 μl of buffer GD followed by two step washings with 600 μl of Buffer PW. Furthermore, the spin column was centrifuged at 12,000 rpm for 2 min and dried at room temperature to completely remove the residual ethanol. It was then transferred to a clean 1.5 ml tube and incubated at room temperature for 2–5 min after adding 50–200 μl of buffer TE. Finally, the column was centrifuged for 2 min at 12,000 rpm to elute the DNA. After that, the NanoDrop™ One Spectrophotometer (Thermo Scientific™) was used to assess the quality of the extracted DNA. Only samples with good quality DNA showing an A260/A280 ratio between 1.8 and 2.0 were selected for further PCR analysis. For PCR amplification of the predicted genes, corresponding primers (Table 1) were designed using the Primer-BLAST tool.

Table 1.

Primer sequences for molecular detection of Hilsa Shad Slc12a2 paralogs.

Genes	Forward Seq	Reverse Seq	Amplicon
Slc12a2.1	GTGATGAGGGGTGAGAAGCC	AAACACAACGGCGGGATTTG	455
Slc12a2.2	CTGGAGGGACGGTGAAATGAA	TTTGGAGGAATCGCCGTCTG	499

The PCR profile (35 cycle) consisted of an initial denaturation at 95 °C for 3 min, followed by denaturation at 95 °C for 30 s, annealing at 62 °C for 30 s, extension at 72 °C for 60 s (35 cycles), and a final extension at 72 °C for 5 min. PCR products were visualized by agarose gel electrophoresis (1.2% agarose) using Promega blunt ended 1 Kb DNA ladder (https://worldwide.promega.com/results#q=ladder) and documented under a UV transilluminator.

2.5. RNA extraction, cDNA synthesis, RT-qPCR primer construction, and RT-qPCR

Total RNA was isolated from gill, kidney, liver, and muscle tissues of biological replicates (5×) using the RNAsimple Total RNA Kit (Tiangen, Shuangying West Road, Changping District, Beijing, China) according to the supplier's protocol. The overall yield of RNA obtained from the above tissues and their quality were assessed spectrophotometrically with a Thermo Scientific Nanodrop One (Thermo Fisher Scientific, Waltham, Massachusetts, USA). Only RNA samples with high integrity and purity (A260/A280 ratio ≥ 1.9) were used for cDNA synthesis. First-strand cDNA was synthesized using the PrimeScript II 1st Strand cDNA Synthesis Kit (Takara Bio Inc., Nojihigashi 7–4-38, Kusatsu, Shiga 525–0058, Japan) in accordance with the manufacturer's guidelines. Quantitative real-time PCR was performed in 10 μL reaction mixtures containing not more than 100 ng cDNA template, 0.3 μL each of forward and reverse primers, and 5 μL of TB Green Premix Ex Taq (Tli RNaseH Plus) SYBR master mix (Takara Bio Inc., Nojihigashi 7–4-38, Kusatsu, Shiga 525–0058, Japan. The primers used for gene expression analysis were designed using NCBI Primer-BLAST. The primer pair for Slc12a2.1 consisted of the forward primer (5′-GTGACTCCTCAAGCCTTCC-3′) and reverse primer (5′-GCCACCACACATCCACTGTA-3′). For Slc12a2.2, 5′-GCTGATGGTGTTTGCCTGTG-3′ and 5′-GTGGCAGCTTTTGGAGAGT-3′ were the forward and reverse primers.

And for the T. ilisha housekeeping gene eukaryotic translation elongation factor 1 alpha 1b, the primers were 5′-CCACTACCGGCAATCTCATC-3′ and 5′-CAGCACCCAGGCATACTTGA-3′. The expected amplicon sizes were 171, 122, and 116 bp, with annealing temperatures of 63.3 °C, 61.8 °C, and 62 °C, respectively. The RT-qPCR thermal cycling program consisted of an initial denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 61.8–63.3 °C for 30 s, and extension at 72 °C for 45 s. Each thermal cycling reaction with five biological replicates was run in triplicate to ensure reproducibility and accuracy24, 25 To verify amplification specificity, a melting-curve analysis was performed after each RT-qPCR run using diluted cDNA with the CFX Manager™ software (Bio-Rad). All reactions showed a single sharp peak, indicating specific amplification without primer-dimer formation or non-specific products, as shown in Fig. 2. Significantly, the reference gene Eef1a1b showed minimal variation in Ct values across different salinity conditions and tissue types (mean ± SD: 26.57 ± 0.55, CV% ≈ 0.61–2.8), as shown in Table S1 and Fig. 3. This indicates relatively stable expression and supports its suitability for normalization. Furthermore, the slight differences observed in Ct values among conditions are likely attributable to tissue-dependent transcriptional variations. This phenomenon is widely reported in housekeeping genes across different tissues and experimental conditions.26, 27

Fig. 2.

Melt curve analysis of the designed primers for (a) Slc12a2.1, (b) Slc12a2.2, and (c) Eef1a1b in Hilsa Shad.

Fig. 3.

Mean, standard deviation, and coefficients of variation of Eef1a1b Ct values across different tissues and habitats in Hilsa Shad (Tenualosa ilisha).

The quantitative variation among the biological replicates was assessed using the relative quantification method, specifically the ΔΔCt approach (2^^-ΔΔCt), where Ct represents the cycle threshold value. The relative expression of Slc12a2 gene paralogs was calculated using the following formulas:

$$\text{Calculation of}\mathrm{\Delta Ct}=\mathrm{Ct}\left(\text{gene of interest}\right)–\mathrm{Ct}\left(\text{housekeeping gene}\right)$$

$$\text{Calculation of ΔΔCt}=\mathrm{\Delta Ct}\left(\text{Sample}\right)–\mathrm{\Delta Ct}\left(\text{Control average}\right)$$

$$\text{Calculation of relative gene expression}=2^{}^{-\left(\text{ΔΔCt}\right)}$$

2.6. Statistical analysis

Technical replicates were performed to calculate the mean expression levels across habitats for all analyzed tissues. The Ct values for gene expression were obtained using Bio-Rad CFX Manager (version 3.1). Data processing, including statistical analyses and visualization, was conducted with GraphPad Prism 10. Differences among groups were assessed using a one-way ANOVA followed by Bonferroni's post hoc test (p ≤ 0.05). Statistically significant differences (p < 0.05) between the marine (control) and freshwater samples are denoted by asterisks.

3. Results

Genome BLAST resulted 100 Hilsa Shad contigs as potential Slc12a2 containing regions (Supplementary information 1). After gene prediction and conserved-domain verification, only two contigs were confirmed to carry Slc12a2 gene paralogs, as shown in Table 2. These two contigs showed sequence identities of 90.53% and 86.34%, with E-values of 9e⁻²⁵ and 4e⁻⁴⁵, respectively. Both predicted paralogs also contained the characteristic Na-K-Cl cotransporter conserved domain (solute carrier family 12).

Table 2.

Genome wide prediction of Slc12a2 gene paralogs in Tenualosa ilisha.

Predicted Genes	Contig No	Position		Query Coverage	E- Value	Percent Identity	Ascension No
		From	To
Slc12a2.1	2736	2,989,089	3,024,429	9%	9e−25	90.53%	PYXC01002733.1
Slc12a2.2	1891	2,294,713	2,306,264	7%	4e−45	86.34%	PYXC01001889.1

PCR amplification using the designed primers produced distinct single bands within the expected ∼500-bp range for the Slc12a2.1 (455 bp) and Slc12a2.2 (499 bp) gene paralogs (Fig. 4). There was no nonspecific products or primer–dimer formation was observed in any reaction. These results confirm the successful and specific amplification of the Slc12a2 paralogs and thereby validate the designed primers.

Fig. 4.

Genome-wide identification of Slc12a2.1 and Slc12a2.2 paralogs in Hilsa Shad. Each well contained genomic DNA from marine specimens (biological replicate, n = 9).

In addition to, the relative mRNA expression of two paralogs of Slc12a2 was quantified across four tissues gill, kidney, liver, and muscle after the migration of Hilsa Shad from the marine to the riverine environment. As shown in Fig. 5a, Slc12a2.1 mRNA transcript level was generally higher in the marine population compared to the riverine population across the examined tissues. Upon transition to freshwater conditions, expression decreased by 1.41-, 8.58-, 2.93-, and 1.97-fold in gill, kidney, liver, and muscle, respectively, with corresponding p-values of 0.0025, <0.0001, <0.0001, and < 0.0001.

Fig. 5.

Relative expression of Slc12a2 paralogs in Hilsa Shad between marine and fresh habitats (n = 5). The graph is presented as mean ± SD.

In Slc12a2.2 as shown in Fig. 5b, the marine group also persistently exhibited elevated expression across all tissues, whereas the riverine group exhibited pronounced down-regulation in gill (11.56-fold), kidney (6.34-fold), and liver (19.34-fold) with high statistical significance (p < 0.0001). Muscle tissue also demonstrated reduced expression in riverine individuals (1.79-fold down, p < 0.0001), accompanied by greater biological variability. Notably, both paralogs exhibited tissue-specific differences in expression under freshwater conditions relative to the marine population.

4. Discussion

The gene sequence of Slc12a2 of three-spined stickleback was used to predict the Hilsa Shad Slc12a2 in the current study. The three-spined stickleback comprises both marine/anadromous and freshwater ecotypes. It has emerged as a premier model system for investigating vertebrate adaptation, owing to its high-quality reference genome.²⁸ The strong sequence identities and extremely low E-values indicated that the detected matches were highly significant and unlikely to be random. Importantly, CDD confirmation of the solute carrier family 12 (SLC12) functional domain validated that the predicted genes were accurate Slc12a2 paralogs available in two separate contigs. Furthermore, the clear, sharp bands observed in the PCR products confirmed the high specificity of the designed primers and successful amplification of the target sequences. These findings supported the reliable molecular identification of two Slc12a2 gene paralogs in Hilsa Shad.²⁹ Besides that, in order to cope with fluctuating salinity during their migration, anadromous fishes enormously depend on NKCC1 (Slc12a2) transporters as key mediators of ion balance and osmoregulatory adaptation. In the gill tissue of Hilsa Shad, Slc12a2.1 and Slc12a2.2 exhibited an increasing trend in mRNA levels as salinity increased in the marine group. These results strongly indicate the important role of Slc12a2 encoded NKCC1 in ion regulation and osmoregulatory processes of Hilsa Shad in elevated salinity condition.⁵ They were significantly down-regulated after the fish entered the riverine habitat as part of their upstream migration. The biological basis of this reduction is consistent with the decreased activity of the NKCC1-mediated salt secretion pathway in freshwater and thereby facilitates ion uptake.³⁰ This finding also suggests that NKCC1 switches to the appropriate mode—ion uptake in freshwater to support hypo-osmotic regulation in Hilsa Shad during up-river migration.³¹ Afterwards, the higher Slc12a2.1 and Slc12a2.2 expression in the marine stage reflects the typical role of NKCC1 as part of the salt-secreting (excretory) pathway in the seawater kidney.³² In this context, NKCC1 likely contributes to transcellular Cl⁻ secretion by facilitating Cl⁻ entry through the basolateral side of the proximal tubule.³³ This pattern corresponds to their secondary role in renal ion uptake under freshwater conditions, where other transporters may be activated to mediate the primary absorption of ions from the river water. The predominance of one mechanism of ion uptake over the other is strongly influenced by environmental stimuli—such as ionic strength, salinity, and the particular species involved.³⁴ However, the observed reduction in Slc12a2.1 expression in riverine Hilsa Shad also suggests a successful functional shift from saltwater- to freshwater-type ionocytes.³⁵ Furthermore, in control marine condition, both of Slc12a2 paralogs showed significantly higher expression in liver. This pattern may be consistent with hepatic models in which hyperosmolarity drives NKCC1-mediated K⁺ uptake that supports regulatory volume increase (RVI) and helps prevent cell shrinkage. The induction of NKCC1 in the liver under chronic seawater hyperosmolarity likely supports hepatic cell adaptation to hyperosmotic stress.³⁶ Notedly, this stress is imposed by the rise in plasma osmolarity that occurs during seawater exposure.³⁷ After migration to freshwater, both Slc12a2 paralogs were markedly down-regulated in the hepatic tissue. Ru et al. (2023) reported that salinity stress affected hepatic ion-transporter genes and therefore Slc4a1a expression decreased under hypo-salinity. Although Slc12a2 belongs to the same solute carrier (SLC) superfamily, whether it exhibits a similar response under hypo-osmotic riverine conditions remains unclear. However, our results suggest that such conditions may influence hepatic ion-transport pathways involving Slc12a2.³⁸ Similar to other tissues, Hilsa Shad muscle Slc12a2 paralogs showed augmented expression under seawater conditions. Consequently, plasma osmolality increases and muscle water content decreases, as previously observed in anadromous brown trout (Salmo trutta) and Atlantic salmon (Salmo salar).³⁹ The resulting reduction in muscle water is consistent with osmotic-stress–induced cellular dehydration of white muscle in anadromous fish.⁴⁰ Under hyperosmotic conditions, Slc12a2 activity in skeletal muscle increases. It helps to counteract cellular dehydration by facilitating a regulatory volume increase (RVI).⁴¹ Therefore, the higher Slc12a2.1- Slc12a2.2 expression observed in the muscle of marine Hilsa Shad may play a significant role in supporting this volume-defense mechanism. On the other hand, the downshift of both Slc12a2 paralogs in riverine Hilsa Shad indicates a reduced requirement for active ion transport in the muscle tissue as osmotic stress diminishes. The reduced expression of both paralogs in the freshwater habitat across all four tissues also showed variation in the degree of downregulation compared to the marine control. This finding suggests potential tissue-specific physiological roles of Slc12a2 paralogs under salinity changes. This is associated with the activation of distinct molecular, biological, and cellular pathways in different tissues under osmotic stress.⁴² Additionally, this variation may be influenced by differences in signal transduction cascades.⁴³ These cascades may integrate and amplify signals from osmosensors and are differentially expressed in each tissue.⁴⁴ Such tissue-specific expression patterns of paralogs can arise following gene duplication, where processes such as subfunctionalization or neofunctionalization may contribute to the retention of both copies.⁴⁵ In addition, genes that are essential in particular cell types are often preferentially expressed in those cells, or have paralogs that show cell-type-specific expression.⁴⁶

Moreover, our results suggest that expression changes are associated with the migratory transition from marine to freshwater environments, though contributions from ontogenetic variation and seasonal effects cannot be excluded. As ontogenetic changes are known to influence ion transporter expression and osmoregulatory capacity in teleost,⁴⁷ the observed differences in Hilsa Slc12a2 expression may reflect not only environmental salinity but also developmental stage.⁴⁸ Future studies should aim to disentangle these matters by employing controlled experimental designs, such as common garden or reciprocal transfer experiments using individuals of the same age or developmental stage. However, as aquaculture techniques for Hilsa Shad are not yet fully developed, implementing such approaches may be challenging. In this context, alternative strategies such as short-term acclimation experiments with wild-caught individuals or improved captive rearing protocols could provide feasible pathways. These approaches may help to better separate ontogenetic and environmental influences on NKCC1 expression. Additionally, our further investigation is set to begin under controlled laboratory conditions across a range of in vitro salinity levels using cell lines derived from the tissues used in this study. The RNA-Seq will be performed further on these Hilsa Shad cell lines as well as the cDNA derived from the whole fish tissues in the current study. This will provide a detailed overview of gene expression changes associated with osmotic stress. It also aims to validate the observed transcriptomic responses and elucidate the underlying regulatory pathways.

5. Conclusion

This study provides the first genome-wide identification of the Slc12a2 gene in Hilsa Shad (Tenualosa ilisha) and reveals two paralogs, Slc12a2.1 and Slc12a2.2. The relative expression profiling across gill, kidney, liver, and muscle tissues exhibited a noticeable down-regulation of both paralogs after their migration to river from the sea. This significant differences in the level of mRNA transcript between habitats support the Slc12a2-mediated ion transportation in T. ilisha. Specifically, the expression of Slc12a2.1 was most reduced in the kidney, whereas Slc12a2.2 showed its largest decline in the liver and gill. These differences in expression reflect the tissue-specific response of Slc12a2 paralogs to osmotic shifts. The findings of the current study provide a foundational molecular understanding that may support future efforts in the conservation and potential domestication of this species in different ecosystem.

CRediT authorship contribution statement

Md. Toasin Hossain Aunkor: Writing – original draft, Methodology, Investigation, Formal analysis, Data curation. Md Jahangir Alam: Methodology. Musfiq Ahamed Zidan: Methodology. Mohammad Mehedi Hasan Khan: Supervision, Project administration. Muhammad Anamul Kabir: Supervision. Md. Faruque Miah: Supervision, Resources, Project administration, Funding acquisition, Conceptualization.

Financial support

This research was partially funded by the Bangladesh Ministry of Science and Technology (Project ID: SRG-221368) and SUST Research Center, Shahjalal University of Science and Technology, Sylhet, Bangladesh (Project ID: LS/2023/1/18).

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

Supplementary material 1

Genome BLAST results.

Supplementary material 2

Ct values of Eef1a1b across tissues and habitats.