Abstract
Background
The hyperplasia suppressor gene (HSG), a known tumor-inhibitory factor, remains poorly characterized in malignant meningioma. Given the frequent activation of the Wnt/β-catenin pathway in tumor progression, this study investigates the role of HSG and its regulatory effects on this signaling cascade.
Methods
HSG overexpression vectors and HSG-targeted small interfering RNAs (siRNAs) were transfected into IOMM-Lee or CH-157MN cells. Assessment of proliferation relied on Cell Counting Kit-8 (CCK-8) and clonogenic growth assays. Wound-healing and Transwell assays measured motility and invasiveness, and flow cytometry was further used to characterize apoptotic responses and cell-cycle distribution. Protein expression related to apoptosis, autophagy (LC3-I/II, p62), metastasis, and Wnt/β-catenin signaling was evaluated through Western blotting and quantitative real-time polymerase chain reaction (qRT-PCR).
Results
HSG overexpression significantly inhibited cell proliferation, migration, and invasion, while inducing G1-phase arrest, apoptosis, and autophagy. This was associated with decreased levels of Bcl-2, Cyclin D1, MMP-2, and MMP-9, and increased Bax expression. Additionally, HSG suppressed Wnt/β-catenin signaling, evidenced by reduced nuclear β-catenin, c-Myc, and Cyclin D1, alongside an increased p-GSK3β/GSK3β ratio. In contrast, HSG knockdown enhanced tumor cell growth, invasiveness, and pathway activation. Treatment with the Wnt/β-catenin activator SKL2001 partially reversed the inhibitory effects of HSG.
Conclusions
This study identifies HSG as a critical tumor suppressor in malignant meningioma that restrains tumor aggressiveness by dampening the Wnt/β-catenin cascade. These novel findings highlight the HSG-Wnt/β-catenin axis as a promising therapeutic target, offering new translational strategies for the management of this highly aggressive intracranial tumor.
Keywords: Malignant meningioma, hyperplasia suppressor gene (HSG), Wnt/β-catenin, proliferation, invasion
Highlight box.
Key findings
• Hyperplasia suppressor gene (HSG) overexpression inhibited malignant meningioma cell proliferation, migration, and invasion, while inducing apoptosis, autophagy, and G0/G1 cell-cycle arrest.
• HSG suppressed Wnt/β-catenin signaling, and pharmacological activation with SKL2001 partially reversed these antitumor effects.
What is known and what is new?
• Malignant meningioma is highly aggressive and has limited treatment options; aberrant Wnt/β-catenin activation contributes to tumor progression.
• This study identifies HSG as a tumor suppressor in malignant meningioma and links its antitumor activity to inhibition of the Wnt/β-catenin pathway.
What is the implication, and what should change now?
• The HSG-Wnt/β-catenin axis may represent a promising therapeutic target. Future studies should validate HSG expression and function in clinical samples and in vivo models to support translational development.
Introduction
Meningiomas constitute the most common primary tumors arising within the intracranial space, representing roughly 30–40% of all central nervous system neoplasms (1). Although most meningiomas exhibit benign behavior, a portion displays clearly aggressive growth tendencies, high recurrence rates, and poor clinical outcomes (2,3). The malignant subtype accounts for only 1–3% of all cases yet is distinguished by rapid expansion and extensive infiltration into surrounding brain tissue, making it particularly challenging to manage (4,5). Even with current multimodal treatment approaches—comprising maximal surgical removal, postoperative radiotherapy, and systemic chemotherapeutic strategies—patients with high-grade lesions still face poor prognoses, with 5-year survival rates ranging from 50% to 70%. These limitations highlight an urgent demand to clarify the molecular drivers of malignant transformation and to identify effective therapeutic targets (6,7).
The hyperplasia suppressor gene (HSG), also identified as mitofusin 2 (Mfn2), is a versatile polypeptide integrated into the mitochondrion’s outer envelope, where it coordinates diverse biological processes (8,9). Initially recognized for its role in suppressing vascular smooth muscle cell proliferation, HSG has since been established in maintaining mitochondrial dynamics, particularly mitochondrial fusion, bioenergetics, and cell-fate decisions (10,11). A growing body of evidence suggests that HSG exerts tumor-suppressive functions across multiple cancer types, such as lung, breast, and pancreatic malignancies (12-14). Its overexpression (OE) has been associated with reduced cancer cell growth, enhanced apoptosis, and diminished metastatic potential, largely through modulation of pathways including PI3K/Akt and Ras/Raf/ERK (15,16). Conversely, diminished HSG levels are frequently correlated with enhanced tumor aggressiveness and poor clinical outcomes. Despite these findings, the detailed expression pattern and mechanistic relevance of HSG in malignant meningioma are yet to be clarified.
The Wnt/β-catenin signaling cascade represents an evolutionarily conserved system essential for orchestrating embryonic morphogenesis and maintaining physiological stability in mature tissues (17). Aberrant activation of this pathway is a hallmark of many cancers, where it promotes uncontrolled cell proliferation, survival, and invasion (18). A key molecular event in canonical Wnt signaling is the stabilization and nuclear localization of β-catenin, enabling its cooperation with transcriptional regulators to drive oncogenic gene expression, including targets such as c-Myc and Cyclin D1 (19,20). Several studies have implicated dysregulated Wnt/β-catenin signaling in the progression of meningiomas. As an illustrative example, immunohistochemical analyses frequently reveal prominent β-catenin nuclear localization in advanced meningioma cases, demonstrating a significant correlation with elevated tumor proliferation rates and enhanced invasive behavior (21,22). Furthermore, various non-coding RNAs and signaling molecules have been found to promote meningioma malignancy by activating this pathway (2,23). Glycogen synthase kinase 3β (GSK3β), a key negative regulator in the Wnt pathway, is often inactivated in tumors, leading to β-catenin stabilization (24). These observations suggest that modulating the Wnt/β-catenin axis could offer a viable direction for developing new therapeutic strategies.
Considering that HSG exerts inhibitory effects in multiple cancers and that the Wnt/β-catenin cascade is pivotal in driving meningioma progression, we proposed that these two factors may be mechanistically connected. It is plausible that HSG exerts its anti-tumor effects in malignant meningioma by negatively regulating the Wnt/β-catenin signaling cascade. Emerging evidence in cancer research points to significant functional interplay between mitochondrial dynamics and nuclear signaling networks, although the underlying molecular details continue to be incompletely characterized. This study sought to elucidate the biological contribution of HSG in malignant meningioma and to define its putative tumor-suppressive mechanism via the Wnt/β-catenin signaling cascade. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0204/rc).
Methods
Cell culture and reagents
The human malignant meningioma cell lines IOMM-Lee and CH-157MN were sourced from Shanghai Institute of Cell Research (Shanghai, China). Cell cultures were propagated in DMEM containing 10% fetal bovine serum (FBS). All cultures were kept in 37 °C with 5% CO2. The Wnt/β-catenin pathway activator, SKL2001, was purchased from MedChemExpress (HY-101085, MCE, Monmouth Junction, NJ, USA).
Construction of HSG OE vector and transfection
The full-length coding sequence of the human HSG gene was retrieved from the National Center for Biotechnology Information (NCBI) database. Following polymerase chain reaction (PCR) amplification of the HSG sequence, the product was inserted into a pCDNA3.1(+) plasmid via standard molecular cloning techniques. Both the constructed HSG-pCDNA3.1(+) recombinant plasmid and the negative control empty vector [Nc-pCDNA3.1(+)] were confirmed through DNA sequencing. For loss-of-function experiments, small interfering RNAs (siRNAs) specifically targeting HSG (si-HSG) and a negative control siRNA (si-NC) were synthesized by GenePharma (Shanghai, China). For transfection experiments, IOMM-Lee cells were plated in 6-well plates and allowed to grow to about 80% density. Plasmid and siRNA delivery were carried out with Lipofectamine® 3000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA). Transfection efficiency was confirmed by quantitative real-time polymerase chain reaction (qRT-PCR) at 24, 48, and 72 hours post-transfection to determine the optimal time point for subsequent experiments.
Experimental groups
For the initial characterization of HSG function, cells were separated into three distinct treatment groups—(I) control group: non-transfected cells maintained in standard medium; (II) OE-NC group: cells receiving the empty Nc-pCDNA3.1(+) vector; (III) OE-HSG group: cells transfected with HSG-pCDNA3.1(+) to achieve HSG OE. For the loss-of-function experiments, a separate set of groups was established—(I) control group: non-transfected cells; (II) si-NC group: cells transfected with negative control siRNA; (III) si-HSG group: cells transfected with HSG-targeted siRNA. For the experiments designed to determine whether stimulating the Wnt/β-catenin cascade could counteract the impacts of HSG OE, an additional set of groups was established: (I) OE-NC group; (II) OE-HSG group; (III) OE-HSG + SKL2001 group: cells transfected with HSG-pCDNA3.1(+) and subsequently treated with 40 µM SKL2001 for 24 hours.
Cell viability assay
The Cell Counting Kit-8 (CCK-8, CK04, Dojindo Molecular Technologies, Kumamoto, Japan) was employed to assess cellular proliferation as per the supplier’s manual. IOMM-Lee cells from respective experimental conditions were dispensed into 96-well plates at 2×103 cells per well. After a 24-hour culture period, each well received 10 µL of CCK-8 reagent and was kept at 37 °C for another 2 hours. Absorbance readings at 450 nm were collected with a BioTek microplate reader. Viability measurements were adjusted to control levels and reported in percentage form. Each experimental setup was conducted in triplicate, with six replicate wells per group.
Colony formation assay
IOMM-Lee cells after transfection were distributed at 500 cells per well into 6-well dishes and allowed to grow for 14 days, during which the medium was renewed every third day. At the endpoint, after fixation in 4% paraformaldehyde (PFA) for 15 minutes, the colonies were stained with 0.1% crystal violet for an additional 10 minutes. Only clusters composed of more than 50 cells were considered valid colonies and subsequently counted. Each experimental set was repeated three times with three internal replicates per group.
Wound healing assay
Cellular migration capacity was determined by performing a scratch assay. Once transfected cells reached full confluence in 6-well plates, a linear wound was created with a sterile 200-µL tip. Loose cell debris was washed off with PBS, and the cells were subsequently cultured in low-serum Dulbecco’s Modified Eagle Medium (DMEM) [1% fetal bovine serum (FBS)]. Photographs of the wound were taken immediately after scratching and again at 24 hours. ImageJ software (NIH, Bethesda, MD, USA) was used to calculate wound closure. All experiments were repeated three times.
Transwell invasion assay
To assess invasive behavior, Matrigel-coated Transwell inserts (8-µm pore size; Corning, NY, USA) were used. Transfected cells (5×104) in serum-free DMEM were placed in the top chamber, whereas the bottom chamber contained 10% FBS-DMEM to generate a chemotactic gradient. After 24 hours, remaining non-invaded cells on the upper membrane surface were gently wiped away. Cells that had penetrated the Matrigel and adhered to the lower surface were fixed with 4% PFA and stained with 0.1% crystal violet. Invasive cells were counted in five randomly selected fields at 200× magnification using ImageJ. Each assay was carried out in triplicate.
Apoptosis and cell cycle analysis
Apoptosis was detected with an Annexin V-FITC/propidium iodide (PI) kit (BD Biosciences Franklin Lakes, NJ, USA). Cells were detached, chilled in PBS, and suspended in binding buffer at 1×106 cells/mL. A 100-µL sample was stained with Annexin V-FITC and PI (5 µL each) during a 15-minute dark incubation at ambient temperature. After adding 400 µL binding buffer, samples were analyzed within 1 hour using a BD FACSCalibur cytometer, and apoptotic rates were calculated with FlowJo software. Cell-cycle profiles were evaluated concurrently on the same flow cytometer, using samples prepared through the corresponding pretreatment workflow.
qRT-PCR
Cellular RNA was purified via TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and quantified on a NanoDrop 2000 system (Thermo Fisher, Waltham, MA, USA). Using 1 µg of RNA, complementary DNA (cDNA) was synthesized with a Takara kit (Takara Bio Inc., Shiga, Japan). qRT-PCR was then conducted with SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA). Relative transcript levels were normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and computed utilizing the 2−ΔΔCt algorithm. The primers for HSG, β-catenin, c-Myc, Cyclin D1, andGSK3β are summarized in Table 1.
Table 1. Primer sequences for qRT-PCR.
| Gene | Forward primer (5'→3') | Reverse primer (5'→3') |
|---|---|---|
| HSG | CTCTCGATGCAACTCTATCGTC | TCCTGTACGTGTCTTCAAGGAA |
| β-catenin | TGGTGACAGGGAAGACATCA | CCATAGTGAAGGCGAACTGC |
| c-Myc | TCAAGAGGCGAACACACAAC | TAACTACCTTGGGGGCCTTT |
| Cyclin D1 | CGAGGAGCTGCTGCAAATGG | CAGAGGGCAACGAAGGTCTG |
| GSK3β | CGTCGTTATCGTTATCGTTC | AATAACTCGAAAATACGACG |
| GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
qRT-PCR, quantitative real-time polymerase chain reaction.
Western blot analysis
Cell lysates were generated using ristocetin-induced platelet aggregation (RIPA) buffer containing protease inhibitors, and protein concentrations were measured with a bicinchoninic acid (BCA) kit. Equal protein amounts were loaded for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes. Membranes, pre-blocked for 1 hour in 5% milk/Tris-buffered saline with Tween 20 (TBST), were subsequently incubated with primary antibodies at 4 °C throughout the night. The following antibodies were used: anti-GAPDH (1:5,000, Proteintech, 60004-1-Ig, Rosemont, IL, USA), anti-HSG/Mfn2 (1:1,000, Abcam, ab56889, Cambridge, UK), anti-Bcl-2 (1:2,000, Abcam, ab182858), anti-Bax (1:20,000, Abcam, ab32503), anti-cleaved caspase-3 (1:5,000, Abcam, ab32351), anti-MMP-2 (1:1,000, Abcam, ab92536), anti-MMP-7 (1:1,000, Abcam, ab207299), anti-MMP-9 (1:5,000, Abcam, ab76003), anti-β-catenin (1:1,000, Abcam, ab32572), anti-c-Myc (1:1,000, Abcam, ab32072), anti-Cyclin D1 (1:10,000, Abcam, ab134175), anti-GSK3β (1:2,500, Proteintech, 82061-1-RR), and anti-phospho-GSK3β (Ser9) (1:5,000, Proteintech, 67558-1-PBS), anti-LC3B (1:1,000, Abcam, ab192890), and anti-p62/SQSTM1 (1:1,000, Abcam, ab109012). After TBST rinsing, membranes were exposed to HRP-linked secondary antibodies (anti-rabbit, 1:2,000, Abcam ab6789; anti-mouse, 1:2,000, Abcam ab150077) for 1 hour. Protein signals were developed using an enhanced chemiluminescence system (Millipore, Burlington, MA, USA) and recorded with a Bio-Rad ChemiDoc imager. Densitometric analysis was performed using ImageJ, with GAPDH as the loading control. All assays were repeated three times.
Statistical analysis
Each experiment was conducted in triplicate, and quantitative data are shown as mean ± SD. GraphPad Prism 10.1.2 (San Diego, CA) was utilized for statistical evaluations. Between-group comparisons employed Student’s t-test, whereas multiple-group differences were determined using one-way analysis of variance (ANOVA) with Tukey’s adjustment. Values with P<0.05 were regarded as statistically meaningful.
Results
HSG OE suppresses proliferative and metastatic behaviors in IOMM-Lee cells
To assess the impact of HSG on malignant meningioma cells, a stable OE-HSG model was established in IOMM-Lee cells (Figure 1). Real-time PCR (RT-qPCR) results indicated a significant upregulation of HSG messenger RNA (mRNA) in the OE-HSG group relative to both comparison groups (P<0.001; Figure 1A). CCK-8 assays revealed that HSG OE markedly reduced cell viability relative to the control groups (P<0.001; Figure 1B). Wound-healing experiments further demonstrated that OE-HSG cells exhibited a significantly lower healing rate at 24 h compared with controls (P<0.001; Figure 1C,1E), indicating a reduction in migratory capability. Similarly, Transwell analyses revealed that HSG upregulation significantly diminished invasive cell numbers (P<0.001; Figure 1D,1F). Overall, these data establish that elevated HSG expression inhibits proliferation, migration, and invasion in malignant meningioma cells.
Figure 1.
Functional impact of HSG OE on proliferative, migratory, invasive and apoptotic activities in IOMM-Lee cells. (A) HSG transcript levels following transfection were quantified by RT-qPCR. (B) Cellular viability was measured using CCK-8 assays. (C) Wound-healing assay showing representative images of migratory ability at 0 and 24 h (magnification 4×). (D) Cell invasion potential was examined via Transwell assays (0.1% crystal violet stained). (E,F) Statistical analysis of wound closure rates and counts of invading cells. (G) Representative flow cytometry plots of apoptotic cells. (H) Statistical analysis of apoptosis rates. (I) Western blot and densitometric quantification of apoptosis-related proteins (Bax, Bcl-2, and caspase-3). (J) Flow cytometric analysis of cell cycle distribution in each group. Data are presented as mean ± SD (n=3). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post-hoc test. ***, P<0.001; ns, not significant. ANOVA, analysis of variance; CCK-8, Cell Counting Kit-8; HSG, hyperplasia suppressor gene; mRNA, messenger RNA; NC, negative control; OE, overexpression; RT-qPCR, real-time polymerase chain reaction; SD, standard deviation.
HSG OE promotes apoptosis and alters cell-cycle distribution
The mechanisms underlying the observed growth inhibition were subsequently investigated. Flow cytometric assessment indicated a significant rise in apoptotic populations in OE-HSG cells relative to both comparison groups (P<0.001; Figure 1G,1H), indicating that HSG OE promotes apoptosis in IOMM-Lee cells. Consistent with this trend, Western blotting demonstrated elevated levels of pro-apoptotic Bax and cleaved caspase-3, accompanied by a reduction in the Bcl-2 (P<0.001; Figure 1I), supporting the enhancement of apoptosis. Additionally, OE-HSG expression produced a clear redistribution of cell-cycle phases (P<0.001; Figure 1J), characterized by more cells arrested in G0/G1 and fewer advancing to the S phase. This indicates that increased HSG expression triggers both apoptotic signaling and G0/G1-phase arrest. Overall, HSG-mediated growth suppression appears to result from both apoptosis activation and interruption of cell-cycle progression.
HSG limits IOMM-Lee cells aggressiveness via Wnt/β-catenin cascade inhibition
To explore whether the inhibitory effects of HSG on malignant meningioma progression are mediated through the Wnt/β-catenin cascade, we examined changes in its downstream mediators. Immunoblotting revealed that forced HSG expression sharply diminished the levels of MMP2, MMP7, and MMP9 relative to control and OE-NC groups (P<0.001; Figure 2A), indicating a suppression of extracellular matrix degradation and invasion-related factors. Parallel qRT-PCR measurements showed that overexpressing HSG led to strong reductions in β-catenin, c-Myc, and Cyclin D1 transcripts (P<0.001), while GSK3β mRNA expression remained unchanged (P>0.05; Figure 2B). Western blotting confirmed reduced β-catenin, c-Myc, and Cyclin D1 levels and a decline in phosphorylation of GSK3β, while total GSK3β levels remained stable (P<0.01; Figure 2C). These observations collectively suggest that HSG exerts its inhibitory effects on malignant meningioma cells by dampening Wnt/β-catenin cascade activation through enhanced β-catenin turnover and repression of downstream oncogenic targets.
Figure 2.
HSG suppresses Wnt/β-catenin signaling, downregulates invasion-associated proteins, and induces autophagy in IOMM-Lee cells. (A) Protein expression levels of MMP2, MMP7, and MMP9 were detected by Western blot after HSG OE. (B) Transcript abundances of β-catenin, c-Myc, Cyclin D1, and GSK3β were analyzed using RT-qPCR. (C) Western blot analysis and quantification of Wnt/β-catenin pathway-related proteins, including β-catenin, c-Myc, Cyclin D1, GSK3β, and p-GSK3β. (D) Western blot analysis and quantification of autophagy markers LC3-I, LC3-II, and p62. Data are presented as mean ± SD (n=3). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post-hoc test. *, P<0.05; **, P<0.01; ***, P<0.001; ns, not significant. ANOVA, analysis of variance; HSG, hyperplasia suppressor gene; mRNA, messenger RNA; NC, negative control; OE, overexpression; RT-qPCR, real-time polymerase chain reaction; SD, standard deviation.
Furthermore, because of the known interplay between mitochondrial dynamics and cellular stress responses, we evaluated autophagy markers. Western blot analysis demonstrated that HSG OE significantly increased the LC3-II/LC3-I ratio and concurrently decreased the protein expression of p62 (P<0.001; Figure 2D). These observations suggest that in addition to inducing apoptosis, HSG promotes autophagic flux in malignant meningioma cells. Collectively, these findings suggest that HSG exerts its inhibitory effects by dampening Wnt/β-catenin cascade activation and simultaneously engaging autophagic and apoptotic pathways.
Validation of HSG tumor-suppressive effects in CH-157MN cell line
To ensure that the observed effects were not limited to a single cell line, we validated our principal findings in a second malignant meningioma cell line, CH-157MN. Following transfection, HSG mRNA expression was significantly increased in CH-157MN cells (P<0.001; Figure 3A). HSG OE significantly suppressed cell viability and clonogenic growth (P<0.01; Figure 3B,3C). Furthermore, HSG OE induced a robust increase in apoptosis (P<0.001; Figure 3D). Western blot analysis showed increased Bax and decreased Bcl-2, β-catenin, c-Myc, and Cyclin D1 (P<0.001; Figure 3E). Cell-cycle analysis showed G0/G1 arrest (Figure 3F). These data confirm that the tumor-suppressive function of HSG is consistent across different malignant meningioma models.
Figure 3.
Validation of HSG tumor-suppressive effects in CH-157MN cells. (A) HSG mRNA expression levels in CH-157MN cells following transfection. (B) Cell viability measured by CCK-8 assay. (C) Representative images and quantification of colony formation (0.1% crystal violet stained). (D) Flow cytometric analysis of apoptosis rates. (E) Western blot analysis and quantification of Bax, Bcl-2, β-catenin, c-Myc, and Cyclin D1. (F) Flow cytometric analysis of cell cycle distribution. Data are presented as mean ± SD (n=3). **, P<0.01; ***, P<0.001; ns, not significant. CCK-8, Cell Counting Kit-8; HSG, hyperplasia suppressor gene; mRNA, messenger RNA; NC, negative control; OE, overexpression; SD, standard deviation.
Knockdown of endogenous HSG promotes malignant phenotypes and activates Wnt/β-catenin signaling
To further substantiate the tumor-suppressive role of endogenous HSG, we performed loss-of-function experiments using siRNA. Following the successful knockdown of HSG in IOMM-Lee cells, we observed that targeted depletion of HSG significantly promoted cell survival (P<0.001; Figure 4A). Moreover, Transwell assays demonstrated a significant enhancement in the invasive capacity of the cells (P<0.001; Figure 4B). Molecularly, the depletion of HSG led to the upregulation of key Wnt/β-catenin signaling proteins, including β-catenin, c-Myc, and Cyclin D1 (P<0.001; Figure 4C). These loss-of-function results corroborate our OE findings, confirming that endogenous HSG restrains the aggressive behavior of malignant meningioma cells by suppressing the Wnt/β-catenin pathway.
Figure 4.
Knockdown of endogenous HSG promotes malignant phenotypes and activates Wnt/β-catenin signaling. (A) HSG mRNA expression was confirmed by RT-qPCR after siRNA transfection, and cell viability was assessed by CCK-8 assay. (B) Representative images and quantitative analysis of the Transwell invasion assay (0.1% crystal violet stained). (C) Western blot analysis and corresponding quantification of Wnt/β-catenin signaling pathway proteins, including β-catenin, c-Myc, and Cyclin D1. Data are presented as mean ± SD (n=3). ***, P<0.001; ns, not significant. CCK-8, Cell Counting Kit-8; HSG, hyperplasia suppressor gene; mRNA, messenger RNA; RT-qPCR, real-time polymerase chain reaction; SD, standard deviation; si-HSG, siRNA targeting HSG; si-NC, siRNA targeting negative control; siRNA, small interfering RNA.
Reactivation of Wnt/β-catenin signaling counteracts the antitumor effects mediated by HSG in IOMM-Lee cells
To confirm the causal link between Wnt/β-catenin pathway inhibition and the tumor-suppressive functions of HSG, a pathway agonist, SKL2001, was utilized in rescue experiments. In HSG-overexpressing cells, SKL2001 treatment partially restored the clonogenic capacity (P<0.001; Figure 5A). Similarly, the impaired migratory and invasive abilities of these cells were significantly attenuated following Wnt pathway activation (P<0.001; Figure 5B-5E). Furthermore, SKL2001 treatment markedly counteracted the pro-apoptotic effect of HSG (P<0.001; Figure 5F) and reversed the G0/G1 cell cycle arrest (Figure 5G). Overall, these results confirm that HSG exerts its growth-suppressive and pro-apoptotic actions by dampening Wnt/β-catenin signaling, and that pharmacological reactivation of this pathway can negate the tumor-suppressive influence of HSG in malignant meningioma cells.
Figure 5.
Restoring Wnt/β-catenin pathway activity negates the tumor-inhibitory influence exerted by HSG on IOMM-Lee cells. (A) Assessment of clonogenic growth potential in IOMM-Lee cells after manipulation of HSG expression and pharmacologic activation with SKL2001. Representative images of crystal violet-stained colonies and quantitative analysis of colony formation rate are shown. (B) Assessment of IOMM-Lee cell migration at baseline and 24 h using a wound-healing assay. (C) Transwell invasion assay analyzing invasive potential in each group (0.1% crystal violet stained). (D,E) Statistical evaluation of wound-healing progression (D) and cell invasion counts (E). (F) Flow cytometric analysis of apoptosis with representative scatter plots and quantification of apoptotic rates. (G) Flow cytometric assessment of cell-cycle distribution and statistical comparison of the proportions of cells in G0/G1, S, and G2/M phases. Data are expressed as mean ± SD (n=3). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post-hoc test. ***, P<0.001; &&, P<0.01 vs. OE-NC group (G). ANOVA, analysis of variance; HSG, hyperplasia suppressor gene; NC, negative control; OE, overexpression; SD, standard deviation.
Reactivation of the Wnt/β-catenin axis abolishes the suppressive influence of HSG on the signaling network
Finally, the direct impact of Wnt pathway activation on the molecular effectors downstream of HSG was examined. HSG OE led to substantial reductions in MMP2, MMP7, and MMP9 protein levels, as confirmed by Western blotting, whereas SKL2001 treatment reversed these effects (P<0.001; Figure 6A). Furthermore, RT-qPCR together with Western blot analyses further revealed that HSG significantly downregulated β-catenin, c-Myc, and Cyclin D1 levels while increasing the p-GSK3β/GSK3β ratio (P<0.01), indicating inhibition of Wnt/β-catenin signaling. SKL2001 restored β-catenin signaling activity, counteracting HSG-induced suppression (P<0.001; Figure 6B,6C). Overall, the evidence demonstrates that HSG inhibits malignant meningioma progression by interfering with Wnt/β-catenin signaling cascade.
Figure 6.
Restoration of Wnt/β-catenin signaling mitigates HSG-induced inhibition of pathway components and invasion-related protein expression in IOMM-Lee cells. (A) Protein expression patterns of MMP2, MMP7, and MMP9 as determined by Western blot and quantitative analysis. (B) RT-qPCR assessment of β-catenin, c-Myc, Cyclin D1, and GSK3β transcript levels. (C) Western blot analysis and quantitative evaluation of β-catenin, c-Myc, Cyclin D1, GSK3β, and p-GSK3β protein levels. Data are presented as mean ± SD (n=3). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post-hoc test. ***, P<0.001; ns, not significant. ANOVA, analysis of variance; HSG, hyperplasia suppressor gene; mRNA, messenger RNA; NC, negative control; OE, overexpression; RT-qPCR, real-time polymerase chain reaction; SD, standard deviation.
Discussion
Malignant meningioma represents a formidable clinical challenge, characterized by aggressive growth, high recurrence rates, and limited therapeutic efficacy despite multimodal treatment approaches (1). The 5-year survival rate for World Health Organization (WHO) grade III meningiomas remains disappointingly low at approximately 50–70%, emphasizing the critical demand for alternative molecular strategies (25,26). Our work identifies HSG as a previously unrecognized tumor suppressor in malignant meningioma, capable of triggering apoptotic responses, imposing cell-cycle arrest, and diminishing cellular invasiveness. What distinguishes HSG from conventional tumor suppressors is its unique subcellular localization at the outer mitochondrial membrane, which positions it at the interface between mitochondrial bioenergetics and nuclear transcriptional regulation (27). Further investigation revealed that these suppressive effects depend on the blockade of the Wnt/β-catenin cascade, offering a promising mechanistic foundation for future targeted therapies.
The anti-proliferative effect of HSG observed in our study aligns with its established tumor-suppressive role in multiple cancer types. In lung adenocarcinoma, increasing HSG levels has been demonstrated to curb cell proliferation while activating apoptotic pathways in studies conducted in cultured cells and animal models (28,29). Similarly, in breast cancer, reduced HSG expression correlates with poor prognosis and enhanced tumor angiogenesis (30). Our data extend these observations to malignant meningioma, in which an increase in HSG levels led to a pronounced decline in both cellular viability and clonogenic growth capacity. The induction of G0/G1 phase arrest observed in our experiments is particularly noteworthy, as this effect coincided with substantial suppression of Cyclin D1, an essential driver of progression from G1 to S phase (31). Considering that Cyclin D1 is transcriptionally regulated as a classic effector of the Wnt/β-catenin cascade, its suppression by HSG provides a direct mechanistic link between mitochondrial dynamics and cell cycle regulation (32). Notably, similar regulatory mechanisms involving mitochondrial dynamics and Wnt/β-catenin signaling have been implicated in other central nervous system malignancies. In glioblastoma, for instance, mitochondrial fusion-fission balance has been shown to influence tumor cell migration and therapeutic resistance, and aberrant Wnt signaling is a well-established driver of tumor stemness and progression (33). These parallels suggest that HSG-mediated suppression of the Wnt/β-catenin pathway may represent a conserved anti-tumor mechanism across neuro-oncological contexts. At the same time, this connection is further supported by recent evidence demonstrating that mitochondrial fusion proteins, including HSG, can influence nuclear gene expression through retrograde signaling pathways (11,34).
Beyond cell cycle control, our study reveals that HSG promotes apoptosis through the intrinsic mitochondrial pathway. The coordinated rise in Bax and cleaved caspase-3, accompanied by diminished Bcl-2 levels, reflects a transition toward an apoptosis-favoring cellular environment induced by HSG (35). This observation matches the recognized positioning of HSG at the outer mitochondrial membrane, where it regulates mitochondrial dynamics and integrity (36). Disturbance of mitochondrial function represents a classical mechanism leading to Cytochrome C liberation and the subsequent initiation of caspase-dependent apoptosis (37,38). Interestingly, our evaluation of autophagy markers revealed an increased LC3-II/LC3-I ratio and decreased p62 levels upon HSG OE, indicating that HSG also induces autophagic processes. The concurrent induction of apoptosis and autophagy suggests a dual mechanism of cell death or stress response. Mitophagy, a selective form of autophagy that removes damaged mitochondria, has been implicated in restraining early tumor development by targeting and eliminating major intracellular sources of reactive oxygen radicals (39). Whether HSG-mediated apoptosis involves mitophagy or other mitochondrial quality control mechanisms warrants further investigation.
The invasive capacity of malignant meningioma is a primary determinant of patient prognosis and therapeutic resistance (40,41). Our findings demonstrate that HSG significantly suppresses both migration and invasion, which was associated with a profound downregulation of matrix metalloproteinases MMP2, MMP7, and MMP9. These enzymes are critical for extracellular matrix degradation, a prerequisite for tumor cell dissemination and invasion (42,43). High-grade meningiomas commonly exhibit increased MMP expression, which correlates with heightened invasiveness and a greater likelihood of recurrence (44). By reducing MMP levels, HSG appears to interfere with the extracellular matrix-modifying capacity of tumor cells, ultimately restricting their local invasive behavior. This anti-invasive effect is consistent with observations in pancreatic cancer, as HSG has been shown to inhibit angiogenesis, reduce lipid droplet accumulation, and attenuate tumor aggressiveness in gastric, clear cell renal carcinomas, and cutaneous head and neck melanomas (45-47). The consistency of these observations across multiple malignancies underscores the possibility that HSG functions as a tumor suppressor with broad applicability.
Mechanistically, this anti-invasive activity is further supported by the finding that Wnt/β-catenin signaling—an established driver of meningioma progression—functions as a critical downstream component under the control of HSG. Aberrant Wnt/β-catenin activation, including nuclear β-catenin accumulation, has been associated with poor outcomes in high-grade meningiomas (48). Here, elevated HSG levels diminished overall β-catenin expression and significantly lowered the levels of its downstream effectors, notably c-Myc and Cyclin D1. Given that β-catenin/TCF transcription complexes directly upregulate MMP2, MMP7, and MMP9, inhibition of this pathway by HSG provides a plausible explanation for the observed reduction in invasive capacity (49). Moreover, HSG diminished inhibitory phosphorylation of GSK3β at Ser9, suggesting enhanced GSK3β activity and promoting β-catenin degradation (50). As GSK3β inactivation is a hallmark of Wnt pathway activation, our findings indicate that HSG may reinforce the β-catenin destruction complex, thereby suppressing a broader pro-invasive transcriptional program. While a strong regulatory relationship between HSG and Wnt/β-catenin signaling is evident, how a mitochondrial outer-membrane protein modulates a pathway that largely functions in the cytoplasm and nucleus remains incompletely elucidated. One plausible explanation involves mitochondrial retrograde signaling, whereby changes in mitochondrial function or morphology can modulate nuclear gene expression and signaling pathways (51). Mitochondria are known to influence cellular calcium homeostasis, reactive oxygen species production, and metabolic flux, all of which can impact Wnt signaling (52,53). Additionally, HSG has been reported to interact with signaling molecules such as Ras and Akt, suggesting that it may function as a signaling scaffold that integrates mitochondrial status with oncogenic pathways (54,55). Future studies employing proteomics and protein-protein interaction analyses will be essential to delineate the direct or indirect molecular connections between HSG and the β-catenin destruction complex.
Several limitations of this study merit discussion. First, to ensure the robustness of our findings and address potential cell-line specific biases, we validated the principal results in a second malignant meningioma cell line, confirming that the tumor-suppressive role of HSG is broadly applicable. Furthermore, loss-of-function experiments via HSG knockdown demonstrated opposing effects—enhancing proliferation and invasion—which further substantiates its role as an endogenous tumor suppressor. However, validation in in vivo models such as orthotopic xenografts or patient-derived xenografts is still necessary to confirm the translational relevance of our findings (56). Second, the clinical significance of HSG expression in human meningioma specimens remains to be determined. A comprehensive analysis of HSG expression across a large cohort of meningioma patients, stratified by WHO grade, would be invaluable in establishing HSG as a prognostic biomarker. Further investigations may refine patient stratification to identify those with maximal therapeutic responsiveness to HSG-based interventions. Beyond Wnt/β-catenin signaling, our findings suggest HSG’s functional repertoire extends to modulating mitochondrial metabolism, redox homeostasis, and autophagic flux. A more holistic understanding of HSG’s multifaceted roles in meningioma biology will require integrative approaches combining transcriptomics, proteomics, and metabolomics. Additionally, the reliance on conventional two-dimensional cell cultures limits the evaluation of tumor-stroma interactions and the influence of the extracellular matrix. Future investigations utilizing advanced three-dimensional models, such as patient-derived meningioma organoids or sphere cultures, will be essential to validate the biological relevance of HSG within a more complex and physiologically representative tumor microenvironment. From a clinical perspective, the identification of the HSG-Wnt/β-catenin axis highlights its significant translational potential. Complementary therapeutic strategies—such as restoring HSG activity through gene therapy or small-molecule activators, or achieving concerted suppression of Wnt signaling using pathway-specific inhibitors—may yield innovative treatment paradigms. These approaches could offer new hope for managing this highly aggressive intracranial tumor, particularly for patients resistant to conventional therapies.
This study defines HSG as a functionally significant tumor suppressor in malignant meningioma. Our findings delineate a mechanism underlying its anti-oncogenic effects: HSG activation coordinately restricts proliferative, migratory, and invasive phenotypes while stimulating apoptosis and cell cycle arrest, primarily through negative regulation of Wnt/β-catenin transduction. These results provide new insights into meningioma biology and highlight the therapeutic potential of modulating this pathway. Complementary therapeutic strategies that either restore HSG activity or achieve concerted suppression of Wnt signaling may yield innovative treatment paradigms for this aggressive intracranial tumor.
Conclusions
In conclusion, HSG acts as a tumor suppressor in malignant meningioma. HSG overexpression restrains malignant phenotypes by inhibiting cell proliferation, migration, and invasion, while promoting apoptosis, autophagy, and G0/G1 cell-cycle arrest. Mechanistically, these effects are mediated at least in part through suppression of Wnt/β-catenin signaling, as pathway activation by SKL2001 attenuated the inhibitory effects of HSG. These findings identify the HSG-Wnt/β-catenin axis as a potential therapeutic target and provide a basis for future in vivo and clinical validation.
Supplementary
The article’s supplementary files as
Acknowledgments
None.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Footnotes
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0204/rc
Funding: This study was supported by the Yichang Science and Technology Innovation Fund (No. A24-2-028).
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0204/coif). The authors have no conflicts of interest to declare.
Data Sharing Statement
Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0204/dss
References
- 1.Shahbandi A, Shah DS, Hadley CC, et al. The Role of Pharmacotherapy in Treatment of Meningioma: A Systematic Review. Cancers (Basel) 2023;15:483. 10.3390/cancers15020483 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Li T, Ren J, Ma J, et al. LINC00702/miR-4652-3p/ZEB1 axis promotes the progression of malignant meningioma through activating Wnt/β-catenin pathway. Biomed Pharmacother 2019;113:108718. 10.1016/j.biopha.2019.108718 [DOI] [PubMed] [Google Scholar]
- 3.Cook WH, Khalil F, Gillespie CS, et al. Health-related quality-of-life outcomes in CNS WHO grade 2 and 3 meningioma: a systematic review. Neurosurg Rev 2025;48:268. 10.1007/s10143-025-03420-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Zhang Z, Li A, Liu J, et al. Giant Malignant Meningioma Penetrates the Skull. J Craniofac Surg 2023;34:e584-6. 10.1097/SCS.0000000000009436 [DOI] [PubMed] [Google Scholar]
- 5.Go KO, Kim YZ. Brain Invasion and Trends in Molecular Research on Meningioma. Brain Tumor Res Treat 2023;11:47-58. 10.14791/btrt.2022.0044 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Kent CL, Mowery YM, Babatunde O, et al. Long-Term Outcomes for Patients With Atypical or Malignant Meningiomas Treated With or Without Radiation Therapy: A 25-Year Retrospective Analysis of a Single-Institution Experience. Adv Radiat Oncol 2021;7:100878. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Rowbottom H, Šmigoc T, Ravnik J. Malignant Meningiomas: From Diagnostics to Treatment. Diagnostics (Basel) 2025;15:538. 10.3390/diagnostics15050538 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Wang W, Zhu F, Wang S, et al. HSG provides antitumor efficacy on hepatocellular carcinoma both in vitro and in vivo. Oncol Rep 2010;24:183-8. [PubMed] [Google Scholar]
- 9.Zhao GJ, Yao YM, Lu ZQ, et al. Up-regulation of mitofusin-2 protects CD4+ T cells from HMGB1-mediated immune dysfunction partly through Ca(2+)-NFAT signaling pathway. Cytokine 2012;59:79-85. 10.1016/j.cyto.2012.03.026 [DOI] [PubMed] [Google Scholar]
- 10.Wu L, Li Z, Zhang Y, et al. Adenovirus-expressed human hyperplasia suppressor gene induces apoptosis in cancer cells. Mol Cancer Ther 2008;7:222-32. 10.1158/1535-7163.MCT-07-0382 [DOI] [PubMed] [Google Scholar]
- 11.Joaquim M, Altin S, Bulimaga MB, et al. Mitofusin 2 displays fusion-independent roles in proteostasis surveillance. Nat Commun 2025;16:1501. 10.1038/s41467-025-56673-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Lou Y, Li R, Liu J, et al. Construction and efficacy identification of the lentiviral vector harboring RNAi based on the hyperplasia suppressor gene (HSG). J Clin Oncol 2014;32:e22177. [Google Scholar]
- 13.Xu K, Chen G, Li X, et al. MFN2 suppresses cancer progression through inhibition of mTORC2/Akt signaling. Sci Rep 2017;7:41718. 10.1038/srep41718 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Lin Z, Lin X, Chen J, et al. Mitofusin-2 is a novel anti-angiogenic factor in pancreatic cancer. J Gastrointest Oncol 2021;12:484-95. 10.21037/jgo-21-176 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Fang X, Chen X, Zhong G, et al. Mitofusin 2 Downregulation Triggers Pulmonary Artery Smooth Muscle Cell Proliferation and Apoptosis Imbalance in Rats With Hypoxic Pulmonary Hypertension Via the PI3K/Akt and Mitochondrial Apoptosis Pathways. J Cardiovasc Pharmacol 2016;67:164-74. 10.1097/FJC.0000000000000333 [DOI] [PubMed] [Google Scholar]
- 16.Zhang W, Shu C, Li Q, et al. Adiponectin affects vascular smooth muscle cell proliferation and apoptosis through modulation of the mitofusin-2-mediated Ras-Raf-Erk1/2 signaling pathway. Mol Med Rep 2015;12:4703-7. 10.3892/mmr.2015.3899 [DOI] [PubMed] [Google Scholar]
- 17.Xue C, Chu Q, Shi Q, et al. Wnt signaling pathways in biology and disease: mechanisms and therapeutic advances. Signal Transduct Target Ther 2025;10:106. 10.1038/s41392-025-02142-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Liu J, Xiao Q, Xiao J, et al. Wnt/β-catenin signalling: function, biological mechanisms, and therapeutic opportunities. Signal Transduct Target Ther 2022;7:3. 10.1038/s41392-021-00762-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Lecarpentier Y, Schussler O, Hébert JL, et al. Multiple Targets of the Canonical WNT/β-Catenin Signaling in Cancers. Front Oncol 2019;9:1248. 10.3389/fonc.2019.01248 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Sanjari M, Kordestani Z, Safavi M, et al. Enhanced expression of Cyclin D1 and C-myc, a prognostic factor and possible mechanism for recurrence of papillary thyroid carcinoma. Sci Rep 2020;10:5100. 10.1038/s41598-020-61985-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Bukovac A, Kafka A, Raguž M, et al. Are We Benign? What Can Wnt Signaling Pathway and Epithelial to Mesenchymal Transition Tell Us about Intracranial Meningioma Progression. Cancers (Basel) 2021;13:1633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Ahmed RA, Shebl AM, Habashy HO. Expression levels of β-catenin and galectin-3 in meningioma and their effect on brain invasion and recurrence: a tissue microarray study. Cancer Biol Med 2017;14:319-26. 10.20892/j.issn.2095-3941.2017.0024 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Saydam O, Shen Y, Würdinger T, et al. Downregulated microRNA-200a in meningiomas promotes tumor growth by reducing E-cadherin and activating the Wnt/beta-catenin signaling pathway. Mol Cell Biol 2009;29:5923-40. 10.1128/MCB.00332-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li C, Yang J, Lei S, et al. SKA3 promotes glioblastoma proliferation and invasion by enhancing the activation of Wnt/β-catenin signaling via modulation of the Akt/GSK-3β axis. Brain Res 2021;1765:147500. 10.1016/j.brainres.2021.147500 [DOI] [PubMed] [Google Scholar]
- 25.Singh RP, Kanjilal S, Mehrotra A, et al. Long-term follow-up in high-grade meningioma and outcome analysis. J Neurosci Rural Pract 2024;15:270-7. 10.25259/JNRP_573_2023 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Tosefsky K, Rebchuk AD, Wang JZ, et al. Grade 3 meningioma survival and recurrence outcomes in an international multicenter cohort. J Neurosurg 2024;140:393-403. 10.3171/2023.6.JNS23465 [DOI] [PubMed] [Google Scholar]
- 27.Emery JM, Ortiz RM. Mitofusin 2: A link between mitochondrial function and substrate metabolism? Mitochondrion 2021;61:125-37. 10.1016/j.mito.2021.09.003 [DOI] [PubMed] [Google Scholar]
- 28.Lou Y, Li R, Liu J, et al. HSG-MLF1IP axis as potential targets for lung adenocarcinoma treatment. J Clin Oncol 2015;33:e13591. [Google Scholar]
- 29.Zhang J, Pan L, Zhang Q, et al. MFN2 deficiency affects calcium homeostasis in lung adenocarcinoma cells via downregulation of UCP4. FEBS Open Bio 2023;13:1107-24. 10.1002/2211-5463.13591 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Li Y, Dong W, Shan X, et al. The anti-tumor effects of Mfn2 in breast cancer are dependent on promoter DNA methylation, the P21(Ras) motif and PKA phosphorylation site. Oncol Lett 2018;15:8011-8. 10.3892/ol.2018.8314 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Alao JP. The regulation of cyclin D1 degradation: roles in cancer development and the potential for therapeutic invention. Mol Cancer 2007;6:24. 10.1186/1476-4598-6-24 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Liu Q, Ran R, Song M, et al. LncRNA HCP5 acts as a miR-128-3p sponge to promote the progression of multiple myeloma through activating Wnt/β‐catenin/cyclin D1 signaling via PLAGL2. Cell Biol Toxicol 2022;38:979-93. 10.1007/s10565-021-09628-7 [DOI] [PubMed] [Google Scholar]
- 33.Lenzi P, Ferese R, Biagioni F, et al. Rapamycin Ameliorates Defects in Mitochondrial Fission and Mitophagy in Glioblastoma Cells. Int J Mol Sci 2021;22:5379. 10.3390/ijms22105379 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Joaquim M, Bulimaga MB, Mohn MA, et al. Charcot-Marie-Tooth type 2A variants of mitofusin 2 sensitize cells to apoptotic cell death. J Cell Sci 2025;138:jcs263691. 10.1242/jcs.263691 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Karbowski M, Lee YJ, Gaume B, et al. Spatial and temporal association of Bax with mitochondrial fission sites, Drp1, and Mfn2 during apoptosis. J Cell Biol 2002;159:931-8. 10.1083/jcb.200209124 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Zanfardino P, Amati A, Perrone M, et al. The Balance of MFN2 and OPA1 in Mitochondrial Dynamics, Cellular Homeostasis, and Disease. Biomolecules 2025;15:433. 10.3390/biom15030433 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Wang D, Yin Y, Wang S, et al. FGF1(ΔHBS) prevents diabetic cardiomyopathy by maintaining mitochondrial homeostasis and reducing oxidative stress via AMPK/Nur77 suppression. Signal Transduct Target Ther 2021;6:133. 10.1038/s41392-021-00542-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Zhao RZ, Jiang S, Zhang L, et al. Mitochondrial electron transport chain, ROS generation and uncoupling (Review). Int J Mol Med 2019;44:3-15. 10.3892/ijmm.2019.4188 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Kuo KL, Chang SJ, Tsai CY, et al. Circadian and autophagy markers correlate with poor prognosis in meningioma patients. Adv Med Sci 2025;70:103-8. 10.1016/j.advms.2025.01.006 [DOI] [PubMed] [Google Scholar]
- 40.Sokratous G, Burford C, Loh D, et al. Meningiomas: Brain invasion as a marker for classification. Neuro Oncol 2018;20:i12-i13. [Google Scholar]
- 41.Senglek K, Teerapakpinyo C, Jittapiromsak N, et al. Differential Expression of Proteins and Genes at the Tumor-Brain Interface in Invasive Meningioma. Genes Chromosomes Cancer 2024;63:e70007. 10.1002/gcc.70007 [DOI] [PubMed] [Google Scholar]
- 42.Rossi GR, Trindade ES, Souza-Fonseca-Guimaraes F. Tumor Microenvironment-Associated Extracellular Matrix Components Regulate NK Cell Function. Front Immunol 2020;11:73. 10.3389/fimmu.2020.00073 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Kudelski J, Tokarzewicz A, Gudowska-Sawczuk M, et al. The Significance of Matrix Metalloproteinase 9 (MMP-9) and Metalloproteinase 2 (MMP-2) in Urinary Bladder Cancer. Biomedicines 2023;11:956. 10.3390/biomedicines11030956 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Ibrahim HM, Abdelrahman AE, Elwan A, et al. Clinicopathological Impact of FOXM1 and MMP-9 Immunohistochemical Expression in Different Grades of Intracranial Meningioma. Appl Immunohistochem Mol Morphol 2024;32:292-304. 10.1097/PAI.0000000000001205 [DOI] [PubMed] [Google Scholar]
- 45.Yan T, Lu G, Shang R, et al. RACGAP1 drives proliferation, migration and invasion and suppresses autophagy of gastric cancer cells via inhibiting SIRT1/Mfn2. Physiol Int 2024;111:35-46. 10.1556/2060.2023.00235 [DOI] [PubMed] [Google Scholar]
- 46.Cai Z, Luo W, Wang H, et al. MFN2 suppresses the accumulation of lipid droplets and the progression of clear cell renal cell carcinoma. Cancer Sci 2024;115:1791-807. 10.1111/cas.16151 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Soares CD, Morais TML, Carlos R, et al. Prognostic importance of mitochondrial markers in mucosal and cutaneous head and neck melanomas. Hum Pathol 2019;85:279-89. 10.1016/j.humpath.2018.11.009 [DOI] [PubMed] [Google Scholar]
- 48.Eaton CD, Avalos L, Liu SJ, et al. Merlin(S13) phosphorylation regulates meningioma Wnt signaling and magnetic resonance imaging features. Nat Commun 2024;15:7873. 10.1038/s41467-024-52284-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Sogawa C, Eguchi T, Okusha Y, et al. A Reporter System Evaluates Tumorigenesis, Metastasis, β-catenin/MMP Regulation, and Druggability. Tissue Eng Part A 2019;25:1413-25. 10.1089/ten.TEA.2018.0348 [DOI] [PubMed] [Google Scholar]
- 50.Calvo B, Fernandez M, Rincon M, et al. GSK3β Inhibition by Phosphorylation at Ser(389) Controls Neuroinflammation. Int J Mol Sci 2022;24:337. 10.3390/ijms24010337 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Yin CF, Chang YW, Huang HC, et al. Targeting protein interaction networks in mitochondrial dynamics for cancer therapy. Drug Discov Today 2022;27:1077-87. 10.1016/j.drudis.2021.11.006 [DOI] [PubMed] [Google Scholar]
- 52.Wang SF, Tseng LM, Lee HC. Role of mitochondrial alterations in human cancer progression and cancer immunity. J Biomed Sci 2023;30:61. 10.1186/s12929-023-00956-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Suh HN, Choi GE. Wnt signaling in the tumor microenvironment: A driver of brain tumor dynamics. Life Sci 2024;358:123174. 10.1016/j.lfs.2024.123174 [DOI] [PubMed] [Google Scholar]
- 54.Liu X, Sun J, Yuan P, et al. Mfn2 inhibits proliferation and cell-cycle in Hela cells via Ras-NF-κB signal pathway. Cancer Cell Int 2019;19:197. 10.1186/s12935-019-0916-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Zhang X, Xu J, Zhuang G, et al. Circular RNA TAF4B targeting MFN2 accelerates cell growth in bladder cancer through p27 depression and AKT activation. Front Immunol 2024;15:1477196. 10.3389/fimmu.2024.1477196 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Zhang N, Shen X, Yu Y, et al. Lead exposure promotes NF2-wildtype meningioma cell proliferation through the Merlin-Hippo signaling pathway. Environ Health Prev Med 2025;30:8. 10.1265/ehpm.24-00216 [DOI] [PMC free article] [PubMed] [Google Scholar]






