Abstract
Background
Papillary thyroid carcinoma (PTC) accounts for the prevalent type of thyroid malignancy with increasing incidence. The underlying mechanism facilitating progression is largely unknown. Periostin (POSTN) has been demonstrated to be involved in many cancers, with no clear role of POSTN in PTC progression. This study aimed to explore the function of POSTN in PTC.
Methods
Gene expression data from The Cancer Genome Atlas (TCGA) database were analyzed, and tissue and serum samples were obtained from 30 PTC patients and 30 healthy controls. POSTN expression was evaluated using enzyme-linked immunosorbent assay (ELISA), immunohistochemistry (IHC), quantitative reverse transcription polymerase chain reaction (qRT-PCR), and Western blot. Transwell and wound healing experiments were performed to evaluate the function of POSTN in cell migratory abilities.
Results
TCGA data revealed elevated POSTN expression in PTC tissues, particularly in advanced stages. Serum POSTN levels were markedly elevated in patients with PTC. POSTN was upregulated in PTC cells, and silencing POSTN attenuated cell proliferation as well as migratory capabilities. POSTN inhibition promoted apoptosis and autophagy in parallel, with changes linked to the AKT/mTOR pathway.
Conclusions
POSTN is overexpressed in PTC and shows potential as a prognostic indicator. POSTN expression is associated with tumor progression by regulating AKT/mTOR signaling, which further leads to apoptosis and autophagy. POSTN may also be considered a valuable target for therapeutic strategies in PTC.
Keywords: Papillary thyroid carcinoma (PTC), periostin (POSTN), AKT/mTOR signaling, apoptosis, autophagy
Highlight box.
Key findings
• Periostin (POSTN) promoted papillary thyroid carcinoma (PTC) cell proliferation, migration, and survival, but impeded apoptosis and autophagy.
What is known and what is new?
• POSTN is upregulated in various solid cancers.
• We validated the upregulation of POSTN in PTC and confirmed the cancer-promoting roles.
What is the implication, and what should change now?
• POSTN is a promising candidate for both diagnosis and targeted treatment in PTC.
• Developing medicine targeting POSTN to prevent PTC progression.
Introduction
Papillary thyroid carcinoma (PTC) has been recognized as the dominant subtype of thyroid cancer, representing 80–85% of thyroid malignancies (1). The global incidence of PTC has been gradually increasing (2). Despite the high survival rates following surgical treatment, a subset of patients experiences recurrence or metastasis, which significantly affects prognosis. However, the molecular mechanisms driving PTC progression, metastasis, and resistance to treatments remain poorly understood.
The extracellular matrix (ECM) is essential in tumorigenesis by providing structural support to tissues and influencing cell behaviors (3,4). Periostin (POSTN), a secreted ECM protein, has been implicated in multiple tumor types such as breast, gastric, and ovarian cancers, where it contributes to cancer initiation and development (5-9). POSTN facilitates tumor cell adhesion, migration, invasion, and survival by interacting with integrins and various components of the ECM.
Amongst thyroid cancers, particularly PTC, the functions of POSTN remain underexplored. Preliminary research has indicated that POSTN expression was elevated in thyroid cancer tissues, but its specific function and underlying mechanisms in PTC progression have not been fully elucidated (10,11). While the prognostic significance of POSTN in other cancers has been established, its value in diagnosis and treatment strategies for PTC remains unclear. Furthermore, whether POSTN influences critical biological processes—such as cell migration, autophagy, and apoptosis—in PTC cells remains largely unexplored. The current study aimed to understand whether and how POSTN is involved in the promotion of PTC progression.
This study demonstrated elevated expression of POSTN in PTC tissues and serum samples. The enhancement was correlated with the aggressiveness of PTC and was functionally associated with proliferation, motility, apoptosis, and autophagy, which could be largely attributed to the altered AKT/mTOR pathway activation. This research may shed light on the molecular pathways underlying PTC development and identify possible treatment targets to enhance patient outcomes. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2452/rc).
Methods
Participant selection criteria and ethics
The inclusion criteria for PTC patients in this study were: (I) histopathologically confirmed diagnosis of PTC; (II) age between 18 and 60 years; (III) no prior treatment (such as surgery, radiotherapy, or chemotherapy); (IV) written informed consent obtained. The exclusion criteria were: (I) presence of severe cardiovascular, liver, renal, or other major diseases; (II) history of other malignancies; (III) inability to collect samples or cooperate with the study for any other reasons. The inclusion criteria for healthy controls were: (I) age and gender matched with the patient group; (II) no prior systemic treatment. The exclusion criteria were: (I) history of any other types of cancer; (II) presence of diseases affecting thyroid function. Thyroid tissues from healthy controls were obtained from surgically resected normal tissues adjacent to benign thyroid nodules. All participants gave informed consent, and the study was approved by Ethics Committee of The Second Affiliated Hospital of Qiqihar Medical University (Ethical approval No. 202502008-01). The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. All clinical data and samples were collected and used in strict accordance with ethical regulations.
Data and sample collection and analysis
Gene expression data was downloaded from The Cancer Genome Atlas (TCGA) database (https://portal.gdc.cancer.gov/), including whole-genome FPKM (fragments per kilobase of transcript per million mapped reads) matrix data from 510 PTC tissues and 58 adjacent normal tissues, along with corresponding clinical data. In addition, blood and papillary thyroid tissue samples were collected from 30 PTC patients and 30 healthy controls at The Second Affiliated Hospital of Qiqihar Medical University.
Enzyme-linked immunosorbent assay (ELISA)
Serum POSTN concentrations were measured with a commercial ELISA kit (EH0255, Wuhan Fine Biotech Co., Ltd.) as per the manufacturer’s instructions.
Immunohistochemistry (IHC)
Paraffin-embedded tissue sections were dewaxed, rehydrated, and exposed to citrate buffer (pH 6.0) for antigen retrieval. Sections were incubated with an anti-POSTN primary antibody (66491-1-Ig, ProteinTech, 1:200, Cranbury, USA), followed by HRP-conjugated secondary antibody (A0216, Beyotime, 1:500, Shanghai, China). Detection was achieved using DAB chromogen, and hematoxylin was used for nuclei counterstaining. Both staining intensity and positive cell frequency were semi-quantitatively analyzed.
Cell culture
TPC-1 cells were purchased from ChemicalBook (Catalog no. XG-X3297, Shanghai) and were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum, 50 U/mL penicillin and 50 µg/mL streptomycin. shRNA targeting POSTN (shPOSTN-1, CAGTCTTCAGCCTATT; shPOSTN-2, TCCATGGAGAGCCAAT) and control shRNA (shNC, GTGAACTCACGTCAGA) was cloned into pLL4.0 vector followed by transduction into TPC-1 cells using lipofectamine 2000. The stable cell line was obtained by treating the transfected cells with 1 µg/mL of TPC-1 for 5 days. For autophagy related assays, the TPC-1 cells were exposed to autophagy inhibitor 3-Methyladenine (3-MA, M9281-100MG, Merck) at 1 µM for 16 hours or to autophagy degradation inhibitor Bafilomycin A1 (Baf A1, SML1661, Merck) at 100 nM for 8 hours.
Quantitative reverse transcription polymerase chain reaction (qRT-PCR)
Total RNAs were extracted from indicated TPC-1 cells using TRIzol reagent (Kangwei Century, Beijing, China). One µg of total RNAs was reverse transcribed into cDNA using the PrimeScript™ RT reagent kit. POSTN expression was amplified using specific primers (F: GACCGTGTGCTTACACAAATTG, R: AAGTGACCGTCTCTTCCAAGG). β-actin served as an internal control. qPCR was analyzed on an ABI machine.
Western blot
Proteins were extracted using RIPA buffer with protease inhibitors (Thermo Fisher Scientific). 30 µg of protein were separated by SDS-PAGE and transferred to PVDF membranes. Membranes were probed with primary antibodies against POSTN (66491-1-Ig), AKT (60203-2-Ig), p-AKT (66444-1-Ig), mTOR (66888-1-Ig), p-mTOR (67778-1-Ig), Bax (60267-1-Ig), Bcl-2 (12789-1-AP), Cleaved Caspase-3 (68773-1-Ig), Caspase-3 (66470-2-Ig), ATG7 (67341-1-Ig), LC3B (14600-1-AP), and P62 (18420-1-AP). All antibodies were from ProteinTech with 1:1,000 dilution for Western blot. After treatment with a 1:5000 dilution of HRP-conjugated secondary antibody, detection was performed via enhanced chemiluminescence.
Cell Counting Kit-8 (CCK-8) assay
TPC-1 cells with shNC or shPOSTN expression were seeded in 96-well plates. CCK-8 assays were conducted to measure the cell proliferation.
Transwell assay
Cells were resuspended in plain DMEM medium (serum free) and were subsequently seeded in the inserts with 8 µm pore size. DMEM medium supplemented with 5% fetal bovine serum was added into the bottom chambers. After 16 hours, migrated cells were fixed with methanol, stained with crystal violet, and cell count per view was measured on bright field images.
Wound healing assay
TPC-1 cells expressing control shRNA or POSTN shRNA were seeded into 6-well plates when reaching 90% confluence. Scratches were made and further cultured in serum-free medium. Images were captured at 0 and 24 hours to assess cell migration via% of wound closure following the formula: (Width0h – Width24h)/Width0h × 100%.
Flow cytometry
Apoptosis of cells was measured using an Annexin V-FITC/PI apoptosis detection kit (640932, Biolegend, San Diego, USA) following the instructions and analyzed by flow cytometry to quantify apoptotic populations.
Fluorescence microscopy
TPC-1 cells were fixed using 4% PFA, permeabilized using 0.5% Triton X-100, blocked using 1% BSA, exposed to primary antibodies against LC3 (9868, Cell Signaling Technology, Danvers, USA), followed by incubated with AF488 conjugated secondary antibodies (R37118, Thermo Fischer, Waltham, USA) to visualize autophagosome formation. Green puncta were observed under a fluorescence microscope to assess autophagic flux.
Statistical analysis
Statistical analysis was carried out in R software (v4.3.2).
Statistical tests for two groups were selected following: (I) normality of each group was first assessed using the Shapiro-Wilk test; (II) if either group deviated from normal distribution, the Wilcoxon rank-sum test was applied; (III) if both groups were approximately normally distributed, a t-test was performed; (IV) Welch’s t-test was used when variances were unequal, whereas Student’s t-test was applied when variances were equal.
Statistical tests for multiple-group comparisons were selected following: (I) normality was assessed for each group; (II) if any group deviated from normal distribution, the Kruskal-Wallis test was used; (III) if all groups were approximately normally distributed, one-way analysis of variance (ANOVA) was performed.
Survival curves were analyzed using log-rank test with adjustment for age and sex, based on low/high POSTN expression stratified by median expression value of POSTN. RNA-seq expression data (FPKM) were log2-transformed prior to analysis. No additional batch correction was applied.
Data is presented as mean (technical triplicates) ± standard error of the mean (SEM) (biological triplicates). Statistical significance was considered as P value <0.05. All in vitro work was performed independently for at least 3 times with 3 technical replicates in each repeat. No data was excluded.
Results
POSTN expression was significantly enhanced in PTC
To investigate POSTN expression in PTC, we first analyzed transcriptomic data from the TCGA database. This dataset includes 510 PTC samples and 58 normal controls. The results indicated that POSTN expression was significantly higher in tumors compared to their normal counterparts (P<0.01) (Figure 1A). We further collected serum from PTC and healthy donors (n=30) for POSTN concentrations assessment. As shown in Table 1, no significant differences were observed in age (PTC: 49±10 vs. healthy: 44±13 years, P=0.051) or sex (PTC: 76.7% female vs. healthy: 83.3% female, P>0.99) between the two groups. For PTC patients, 76.7% had unilateral tumor involvement and 36.7% presented with lymph node (LN) metastasis at diagnosis. Patients with PTC exhibited markedly increased serum POSTN levels, compared to the control group (P<0.01) (Figure 1B). Immunohistochemical analysis further confirmed these findings. POSTN was strongly expressed in cancerous thyroid tissues, while minimal expression was observed in normal thyroid samples (Figure 1C).
Figure 1.
POSTN expression was elevated in PTC patients. (A) POSTN mRNA levels in PTC tissues (n=510) and normal controls (n=58) from TCGA database were analyzed. (B) Serum POSTN concentrations were measured by ELISA in 30 PTC patients and 30 healthy controls. (C) Representative immunohistochemical staining of POSTN in normal thyroid tissue and PTC tissue. The data are presented as median (IQR) (A) and mean ± SEM in (B). P value in (A) and (B) was calculated using Wilcoxon rank-sum test and unpaired Student t-test, respectively. ****, P<0.0001. ELISA, enzyme-linked immunosorbent assay; IQR, interquartile range; POSTN, periostin; PTC, papillary thyroid carcinoma; SEM, standard error of the mean; TCGA, The Cancer Genome Atlas.
Table 1. Clinical characteristics of the cohort population.
| Characteristics | PTC (n=30) | Healthy (n=30) | P value |
|---|---|---|---|
| Age (years) | 49±10.20 | 44±13.44 | 0.051 |
| Female | 23 (76.7) | 23 (83.3) | >0.99 |
| Single lobe | 23 (76.7) | N/A | N/A |
| LN metastasis | 11 (36.7) | N/A | N/A |
Data are presented as median ± standard deviation or n (%). LN, lymph node; N/A, not applicable; PTC, papillary thyroid carcinoma.
POSTN levels were associated with clinical features of PTC
To further investigate the association of POSTN to various clinical characteristics of PTC, we downloaded the whole-genome FPKM matrix data of 510 PTC and 58 adjacent non-cancerous tissues, along with clinical data, from the TCGA-THCA database. As shown in Figure 2A, expression of POSTN was significantly upregulated in patients at stage III–IV, compared to those at stages I–II (Figure 2A). In addition, enhanced POSTN expression was displayed in patients at T3 and T4 stages compared to those with earlier stages (Figure 2B). Regarding LN metastasis, compared with N0 stage patients, N1 stage patients exhibited significantly elevated POSTN expression (Figure 2C). However, marginal difference was observed in POSTN expression between M0 and M1 stage patients (Figures 2D). Further analysis showed a poorer survival rate in patients with higher POSTN expression (Figure 2E). These results together suggested the potential role of POSTN in the progression of PTC.
Figure 2.
Association between POSTN expression and clinicopathological features of PTC. (A-D) POSTN expression in patients at indicated general stages (A), tumor stages (B), node stages (C), and metastasis stages (D) were analyzed. (E) Survival curves of patients stratified using median expression of POSTN. The data are presented as median (IQR). P value was calculated using Kruskal-Wallis test (A), one-way ANOVA (B), Welch t-test (C) and unpaired Student t-test (D), and log-rank test in (E). ANOVA, analysis of variance; IQR, interquartile range; M, metastasis; N, node; POSTN, periostin; PTC, papillary thyroid carcinoma; T, tumor.
POSTN regulated proliferation and migration of PTC cells
To evaluate the impact of POSTN in PTC, we first knocked down the expression of POSTN using shRNA in TPC-1 cells. As shown in Figure 3A-3C and Figure S1A,S1B, the mRNA and protein levels of POSTN were effectively reduced by specific shRNAs, compared to control shNC. Furthermore, we assessed whether POSTN was involved in cell proliferation. CCK-8 assays confirmed that silencing POSTN significantly resulted in proliferation delay (Figure 3D and Figure S1C). Moreover, the migration ability was evaluated by transwell and wound healing assays. The migratory ability of TPC-1 cells expressing shPOSTN was largely attenuated, compared to the control group (Figure 3E,3F and Figure S1D,S1E).
Figure 3.
POSTN regulated proliferation and migration of TPC-1 cells. (A-C) qRT-PCR (A) and Western blot (B,C) was conducted to validate the knockdown efficiency of shPOSTN. (D) Proliferation of TPC-1 cells expressing shNC or shPOSTN were assessed by CCK-8 assay over 72 hours (n=3). (E,F) Transwell migration assay (E) and wound healing assay by counting crystal violet stained cell (F) was utilized to evaluate the migration of shNC cells and shPOSTN cells (n=5). The data is presented as mean ± SEM. P value was calculated using unpaired student t-test in (A), (C), (E) and (F) and two-way ANOVA in (D). **, P<0.01; ***, P<0.001; ****, P<0.0001. ANOVA, analysis of variance; CCK-8, Cell Counting Kit-8; NC, negative control; OD, optical density; POSTN, periostin; qRT-PCR, quantitative reverse transcription polymerase chain reaction; SEM, standard error of the mean.
The effect of POSTN expression on apoptosis and autophagy in PTC cells
We further investigated whether POSTN was involved in apoptosis and autophagy in PTC cells. Fluorescence microscopy observations revealed that, compared to the shNC group, the expression of LC3, recognized as increased fluorescence intensity, was notably enhanced in the shPOSTN group (Figure 4A and Figure S1F). We subsequently applied autophagy inhibitor 3-MA and found that 3-MA treatment effectively abrogated the enhanced autophagy in shPOSTN TPC-1 cells, shown as reduced expression of ATG7, LC3-II, and increased p62 (Figure 4B,4C), which together indicated that POSTN negatively regulated the autophagic flux. To fully evaluate whether shPOSTN involved in the induction of autophagy, we further utilized bafilomycin A1 (Baf A1) to inhibit the fusion of autophagosome with lysosome, thus blocking the degradation of LC3. As shown in Figure 4D,4E, compared to shNC alone, Baf A1 effectively increased the amount of LC3-II and p62 in shNC cells. While shPOSTN cells display increased LC3-II but decreased p62, both were further increased when shPOSTN cells exposed to Baf A1. Meanwhile, BafA1 barely affected the expression of ATG7 in both shNC and shPOSTN cells. These data indicated that POSTN knockdown regulated the initiation of autophagy rather than lead to the accumulation of autophagosome only.
Figure 4.
POSTN regulates apoptosis in PTC cells through autophagy. (A) Fluorescence microscopy showing increased LC3 expression in shPOSTN expressing TPC-1 cells. (B,C) The expression of ATG7, p62, and LC3B-II were detected using Western blot in shNC and shPOSTN expressing cells in the presence or absence of 3-MA (1 mM, 16 hours). (D,E) The expression of ATG7, p62, and LC3B-II were detected using Western blot in shNC and shPOSTN expressing cells in the presence or absence of bafilomycin A1 (Baf A1, 100 nM, 16 hours). (F) Flow cytometry analysis showing the percentage of apoptotic cells. (G) The expression of caspase 3, cleaved caspase 3, Bcl2, Bax was examined using Western blot in shNC and shPOSTN cells. The data are presented as mean ± SEM (n=3). P value was calculated using unpaired t-test in (C) and two-way ANOVA in (B) and (D). *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. ANOVA, analysis of variance; NC, negative control; POSTN, periostin; PTC, papillary thyroid carcinoma; SEM, standard error of the mean.
Moreover, flow cytometry was used to assess the apoptosis in TPC-1 cells. As shown in Figure 4F and Figure S1G, silencing POSTN promoted the apoptosis of TPC-1 cells, reflected by the upregulated Annexin-V+ cells. Additionally, apoptosis related markers were tested by Western blot. The ratio of cleaved Caspase-3 to intact Caspase-3 and the levels of Bax, a proapoptotic protein, were increased in shPOSTN group, while anti-apoptotic protein Bcl-2 expression was decreased (Figure 4G).
POSTN inhibited autophagy in PTC by regulating the AKT/mTOR pathway
Autophagy is recognized as a vital cellular process degrading and recycling macromolecules, contributing significantly to the preservation of cellular balance. In recent years, the AKT/mTOR pathway has been extensively investigated and is considered one of the key pathways regulating autophagy. Research has demonstrated that the AKT/mTOR pathway plays a pivotal role in cell growth, metabolism, apoptosis, and autophagy by regulating the phosphorylation status of autophagy-related proteins (12). In PTC, abnormal activation of the AKT/mTOR pathway has substantially contributed to cancer cell proliferation, migration, and autophagy (13). Therefore, we tested the effect of POSTN on the activation of AKT/mTOR signaling pathway. As shown in Figure 5A,5B, knockdown of POSTN effectively inhibited the activation of mTOR and AKT, reflected by the phosphorylated levels of the two molecules. Furthermore, we found that SC79, an AKT activator, was able to reverse the reduction induced by POSTN knockdown (Figure 5A,5B). These results indicated that the activation of AKT/mTOR axis was regulated by POSTN. We further examined the autophagy associated molecules. As shown in Figure 5A,5C, SC79 inhibited autophagy in shNC expressing TPC-1 cells, indicated by decreased ATG7 and LC3B and increased p62. Consistently, SC79 also attenuated the upregulated autophagy induced by knockdown of POSTN in shPOSTN expressing TPC-1 cells (Figure 5A,5C). All these data suggested the regulatory function of POSTN in autophagy by modulating AKT/mTOR activation in TPC-1 cells.
Figure 5.
POSTN regulates autophagy via the AKT/mTOR pathway in TPC-1 cells. (A-C) The levels of p-mTOR, p-AKT, ATG7, p62, and LC3B was examined by Western blot in shNC and shPOSTN TPC-1 cells with or without SC79. The data are presented as mean ± SEM (n=3). P value was calculated using two-way ANOVA in (B,C). ***, P<0.001; ****, P<0.0001. ANOVA, analysis of variance; NC, negative control; POSTN, periostin; SEM, standard error of the mean.
Discussion
As one of the most prevalent types of thyroid cancer, PTC accounts for complex pathogenesis involving multiple genes and signaling pathways. This study focused on the matrix protein POSTN, revealing the crucial role of POSTN in the progression of PTC, particularly in modulating AKT/mTOR pathway to alter cancer cell functions. Our results supported the pro-tumorigenic function of POSTN in PTC.
In specific, our analysis validated a substantial elevation of POSTN expression in PTC specimens at both mRNA and protein levels, closely associated with more malignant tumor stages, which was consistent with previous studies (14,15). In addition, it has been reported that POSTN was markedly upregulated in multiple other solid tumors, including breast cancer and ovarian cancer, where it was correlated with enhanced tumor cell migration and invasion (16-18). ELISA measurements revealed a notable elevation in circulating POSTN levels in the serum and in situ tissue of PTC patients when compared to healthy participants, providing evidence for its potential as a non-invasive biomarker. Furthermore, silencing POSTN in TPC-1 cells led to notable decreases in cell growth and motility, highlighting its potential contribution to PTC malignancy. Collectively, the data indicated that POSTN held promise as a therapeutic target in oncology.
POSTN, as an ECM secreted protein, contributes to various signaling pathways by anchoring by binding to ECM components and interact with cell surface receptors via the FAS1 domain (19,20). Previous studies have reported that POSTN regulated tumor cell behavior, enhancing the formation of blood and lymphangiogenesis, facilitating the interaction between tumor cells and metastatic foci (21,22). Evidence from our investigation indicated that POSTN exerted tumor-promoting functions in PTC primarily by engaging the AKT/mTOR signaling axis. The oncogenic function of POSTN might, in part, be explained by its regulatory effect on the AKT/mTOR signaling cascade. This pathway could represent a promising target for future therapies designed by inhibiting POSTN activity. Our results showed that lowering POSTN expression inactivated the AKT/mTOR pathway, thus leading to impaired proliferation and migration of PTC cells. Previous research has pointed out the pivotal role of the AKT/mTOR pathway in various cancers, and our POSTN knockdown assays validated similar effects of POSTN on the AKT/mTOR pathway, reflected by reduced level of phosphorylated AKT and mTOR in shPOSTN cells (23-26). This finding supported earlier research emphasizing the regulatory role of activated AKT/mTOR pathway in thyroid cancer and further confirmed that POSTN could promote tumorigenesis through regulating this signaling cascade (27-29). Moreover, POSTN could influence on collagen production and ECM remodeling, which indirectly triggered AKT/mTOR pathway by altering the tumor microenvironment. Notably, when the AKT activator SC79 was used, the inhibitory effects induced by POSTN knockdown were significantly reversed, directly confirming the hypothesis that POSTN functions through the AKT/mTOR pathway. This discovery provided new insights into how POSTN mediated PTC progression and suggested that the AKT/mTOR pathway could be an effective downstream target for POSTN-targeted therapies of PTC.
This study was for the first time to investigate the regulatory effect of POSTN on tumor cell autophagy. Since the AKT/mTOR pathway serves as a major suppressor of autophagy, we found that silencing POSTN enhanced the levels of autophagy-related proteins like LC3-II by inhibiting AKT-mTOR pathway. These findings align with earlier research highlighting the role of AKT/mTOR signaling in controlling autophagy in cancer cells (24). These data indicated that POSTN affected autophagy activity and survival via apoptosis by regulating AKT/mTOR pathway. However, these results did not elucidate the upstream factors through which POSTN influences AKT signaling remain to be elucidated. As an ECM component, POSTN is known to interact with integrins, thereby modulating intracellular signaling cascades such as FAK/PI3K/AKT pathway. It is therefore plausible that POSTN may regulate AKT/mTOR activity through integrin-mediated signaling. Further studies will be required to elucidate the precise upstream mechanisms and determine whether POSTN directly or indirectly regulates AKT/mTOR signaling in this context. In addition, whether POSTN directly influences tumor cell survival through autophagy remains to be further investigated.
Combining previous research with our findings, POSTN not only holds significant potential as a circulating indicator for early detection and outcome prediction in PTC but also suggests that its mechanism of promoting tumor progression via the AKT/mTOR pathway may make it a new avenue for treatment. Future studies could focus on exploring combination therapies targeting POSTN and the AKT/mTOR pathway to assess their effectiveness in inhibiting PTC progression. Additionally, further research on the distinct roles of POSTN across various thyroid cancer variants and its mechanisms in autophagy regulation may provide a more comprehensive basis for precision medicine.
However, there are certain limitations to this study. First of all, our research is primarily based on cell experiments and lacks further validation in in vivo animal models. Secondly, the specimen we used as a control in our current study was collected from the adjacent tissue of the benign tumor, which could still lead to the upregulation of POSTN in these samples. To investigate more accurately the different between non-tumor and PTC, harvesting tissues from healthy donors would be much more beneficial and conclusive. Additionally, the sample size is limited (n=30) in the current study, although we observed the association between the expression of POSTN and LN metastasis [odds ratio (OR) =1.27; 95% confidence interval (CI): 1.01–1.60, P=0.043] in univariable analysis, we were unable to comprehensively evaluate the expression differences and functions of POSTN across other factors. Furthermore, due to the absence of long-term follow-up data, multivariable survival analyses adjusting for established clinicopathological factors could not accurately reflect the real conclusion. As a result, the prognostic value of POSTN beyond traditional risk parameters need to be determined in larger, well-annotated, multi-center cohorts in future studies. Moreover, we only quantified total circulating POSTN levels without differentiating between POSTN isoforms. Given emerging evidence that distinct POSTN splice variants may exert differential biological functions, future investigations incorporating isoform-specific analyses may provide further mechanistic insight. Finally, research and utilize gene editing technologies such as CRISPR/Cas9 to further validate the functional mechanisms of POSTN.
Conclusions
This study systematically revealed the novel role of POSTN in PTC progression through the AKT/mTOR signaling pathway, emphasizing its function as a cancer-promoting gene and promising treatment target. This finding not only enriches the understanding of the pathogenesis of PTC but also provides new ideas and directions for precision medicine.
Supplementary
The article’s supplementary files as
Acknowledgments
None.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of The Second Affiliated Hospital of Qiqihar Medical University (Ethical approval No. 202502008-01) and informed consent was taken from all individual participants.
Footnotes
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2452/rc
Funding: This study was supported by Joint Guidance Project of Qiqihar City Science and Technology Program (No. LSFGG-2025061).
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2452/coif). The authors have no conflicts of interest to declare.
Data Sharing Statement
Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2452/dss
References
- 1.Jokhadze N, Das A, Dizon DS. Global cancer statistics: A healthy population relies on population health. CA Cancer J Clin 2024;74:224-6. 10.3322/caac.21838 [DOI] [PubMed] [Google Scholar]
- 2.Chen W, Zheng R, Baade PD, et al. Cancer statistics in China, 2015. CA Cancer J Clin 2016;66:115-32. 10.3322/caac.21338 [DOI] [PubMed] [Google Scholar]
- 3.Huang J, Zhang L, Wan D, et al. Extracellular matrix and its therapeutic potential for cancer treatment. Signal Transduct Target Ther 2021;6:153. 10.1038/s41392-021-00544-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Sleeboom JJF, van Tienderen GS, Schenke-Layland K, et al. The extracellular matrix as hallmark of cancer and metastasis: From biomechanics to therapeutic targets. Sci Transl Med 2024;16:eadg3840. 10.1126/scitranslmed.adg3840 [DOI] [PubMed] [Google Scholar]
- 5.Ryner L, Guan Y, Firestein R, et al. Upregulation of Periostin and Reactive Stroma Is Associated with Primary Chemoresistance and Predicts Clinical Outcomes in Epithelial Ovarian Cancer. Clin Cancer Res 2015;21:2941-51. 10.1158/1078-0432.CCR-14-3111 [DOI] [PubMed] [Google Scholar]
- 6.Tian Y, Choi CH, Li QK, et al. Overexpression of periostin in stroma positively associated with aggressive prostate cancer. PLoS One 2015;10:e0121502. 10.1371/journal.pone.0121502 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Kikuchi Y, Kunita A, Iwata C, et al. The niche component periostin is produced by cancer-associated fibroblasts, supporting growth of gastric cancer through ERK activation. Am J Pathol 2014;184:859-70. 10.1016/j.ajpath.2013.11.012 [DOI] [PubMed] [Google Scholar]
- 8.Lin S, Zhou M, Cheng L, et al. Exploring the association of POSTN(+) cancer-associated fibroblasts with triple-negative breast cancer. Int J Biol Macromol 2024;268:131560. 10.1016/j.ijbiomac.2024.131560 [DOI] [PubMed] [Google Scholar]
- 9.Zhao Z, Mak TK, Shi Y, et al. Integrative analysis of cancer-associated fibroblast signature in gastric cancer. Heliyon 2023;9:e19217. 10.1016/j.heliyon.2023.e19217 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Li CC, Ullah MHE, Lin X, et al. Identifying key genes of classic papillary thyroid cancer in women aged more than 55 years old using bioinformatics analysis. Front Endocrinol (Lausanne) 2022;13:948285. 10.3389/fendo.2022.948285 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Yang F, Lian M, Ma H, et al. Identification of key genes associated with papillary thyroid microcarcinoma characteristics by integrating transcriptome sequencing and weighted gene co-expression network analysis. Gene 2022;811:146086. 10.1016/j.gene.2021.146086 [DOI] [PubMed] [Google Scholar]
- 12.Peng Y, Wang Y, Zhou C, et al. PI3K/Akt/mTOR Pathway and Its Role in Cancer Therapeutics: Are We Making Headway? Front Oncol 2022;12:819128. 10.3389/fonc.2022.819128 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Cao C, Wang Y, Wu X, et al. The roles and mechanisms of circular RNAs related to mTOR in cancers. J Clin Lab Anal 2022;36:e24783. 10.1002/jcla.24783 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kim M, Kwon CH, Kim BH. The role of the tumor microenvironment in papillary thyroid microcarcinoma nodal metastasis. Endocr Relat Cancer 2024;31:e240040. 10.1530/ERC-24-0040 [DOI] [PubMed] [Google Scholar]
- 15.Condello V, Paulsson JO, Zedenius J, et al. Spatial Transcriptomics in a Case of Follicular Thyroid Carcinoma Reveals Clone-Specific Dysregulation of Genes Regulating Extracellular Matrix in the Invading Front. Endocr Pathol 2024;35:122-33. 10.1007/s12022-024-09798-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ratajczak-Wielgomas K, Kmiecik A, Grzegrzołka J, et al. Prognostic Significance of Stromal Periostin Expression in Non-Small Cell Lung Cancer. Int J Mol Sci 2020;21:7025. 10.3390/ijms21197025 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.De Oliveira Macena Y, Cezar MEN, Lira CBF, et al. The roles of periostin derived from cancer-associated fibroblasts in tumor progression and treatment response. Cancer Metastasis Rev 2024;44:11. 10.1007/s10555-024-10233-3 [DOI] [PubMed] [Google Scholar]
- 18.Yang N, Yu T, Zheng B, et al. POSTN promotes the progression of NSCLC via regulating TNFAIP6 expression. Biochem Biophys Res Commun 2024;736:150891. 10.1016/j.bbrc.2024.150891 [DOI] [PubMed] [Google Scholar]
- 19.Zhou W, Ke SQ, Huang Z, et al. Periostin secreted by glioblastoma stem cells recruits M2 tumour-associated macrophages and promotes malignant growth. Nat Cell Biol 2015;17:170-82. 10.1038/ncb3090 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Conway SJ, Izuhara K, Kudo Y, et al. The role of periostin in tissue remodeling across health and disease. Cell Mol Life Sci 2014;71:1279-88. 10.1007/s00018-013-1494-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.González-González L, Alonso J. Periostin: A Matricellular Protein With Multiple Functions in Cancer Development and Progression. Front Oncol 2018;8:00225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Chang W, Gao X, Han Y, et al. Gene expression profiling-derived immunohistochemistry signature with high prognostic value in colorectal carcinoma. Gut 2014;63:1457-67. 10.1136/gutjnl-2013-305475 [DOI] [PubMed] [Google Scholar]
- 23.Yu L, Wei J, Liu P. Attacking the PI3K/Akt/mTOR signaling pathway for targeted therapeutic treatment in human cancer. Semin Cancer Biol 2022;85:69-94. 10.1016/j.semcancer.2021.06.019 [DOI] [PubMed] [Google Scholar]
- 24.Xu Z, Han X, Ou D, et al. Targeting PI3K/AKT/mTOR-mediated autophagy for tumor therapy. Appl Microbiol Biotechnol 2020;104:575-87. 10.1007/s00253-019-10257-8 [DOI] [PubMed] [Google Scholar]
- 25.Utpal BK, Dehbia Z, Zidan BMRM, et al. Carotenoids as modulators of the PI3K/Akt/mTOR pathway: innovative strategies in cancer therapy. Med Oncol 2024;42:4. 10.1007/s12032-024-02551-x [DOI] [PubMed] [Google Scholar]
- 26.Mokhfi FZ, Al Amin M, Zehravi M, et al. Alkaloid-based modulators of the PI3K/Akt/mTOR pathway for cancer therapy: Understandings from pharmacological point of view. Chem Biol Interact 2024;402:111218. 10.1016/j.cbi.2024.111218 [DOI] [PubMed] [Google Scholar]
- 27.Dai B, Xu L, Rong S, et al. YTHDF2 promotes anaplastic thyroid cancer progression by activating the DDIT4/AKT/mTOR signaling pathway. Biol Direct 2024;19:122. 10.1186/s13062-024-00566-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Chen L, Zhuo D, Yuan H. Circ_100395 impedes malignancy and glycolysis in papillary thyroid cancer: Involvement of PI3K/AKT/mTOR signaling pathway. Immunol Lett 2022;246:10-7. 10.1016/j.imlet.2022.04.004 [DOI] [PubMed] [Google Scholar]
- 29.Jiang Q, Guan Y, Zheng J, et al. TBK1 promotes thyroid cancer progress by activating the PI3K/Akt/mTOR signaling pathway. Immun Inflamm Dis 2023;11:e796. 10.1002/iid3.796 [DOI] [PMC free article] [PubMed] [Google Scholar]





