The Effect of miR-129-5p on the Proliferation and Osteogenic Differentiation of Human Dental Pulp Stem Cells

Highlights

• •miR-129-5p knockdown enhances hDPSCs proliferation and osteogenic/odontogenic differentiation in vitro.
• •Targeting miR-129-5p offers a novel strategy to optimize hDPSCs for pulp-dentin complex regeneration.
• •This study identifies a key molecular brake in hDPSCs biology, with translational potential for regenerative endodontics.

Abstract

Objective

To investigate the role of microRNA-129-5p (miR-129-5p) in the proliferation and osteogenic differentiation of human dental pulp stem cells (hDPSCs).

Materials and Methods

Differential expression analysis was performed using the GEO dataset GSE138180 to identify differentially expressed genes during the osteogenic differentiation of hDPSCs. Primary hDPSCs were isolated and cultured using the tissue block method combined with enzymatic digestion, and their stemness was characterized by alizarin red staining, oil red O staining, and flow cytometry. The expression dynamics of miR-129-5p at different stages of osteogenic induction were detected by quantitative real-time PCR (qRT-PCR). hDPSCs were transiently transfected with miR-129-5p mimic, negative control (mimic-NC), miR-129-5p inhibitor, or negative control (inhibitor-NC), and the transfection efficiency was verified by qRT-PCR. Cell proliferation was assessed by the CCK-8 assay. The expression of osteogenic-related genes (alkaline phosphatase [ALP], collagen type I [COL1], runt-related transcription factor 2 runt [RUNX2]) and proteins (ALP, osteopontin [OPN]) was measured using qRT-PCR, immunofluorescence, and Western blot, while mineral deposition was evaluated by alizarin red and alkaline phosphatase staining.

Results

Differential expression analysis revealed that miR-129-5p expression was significantly downregulated after 14 days of osteogenic induction compared with the control group. The primary cultured cells formed mineralized nodules and lipid droplets, were positive for CD90 and CD73, and were negative for CD45 and CD34. The expression of miR-129-5p continued to decrease after 7 and 14 days of osteogenic induction. Overexpression of miR-129-5p suppressed hDPSC proliferation, downregulated the expression of ALP, COL1, RUNX2, and OPN, and reduced mineral deposition. Conversely, inhibition of miR-129-5p promoted cell proliferation, enhanced the expression of osteogenic-related genes and proteins, and increased mineral deposition.

Conclusion

Inhibition of miR-129-5p promotes the proliferation and osteogenic differentiation of hDPSCs, suggesting that reduced miR-129-5p expression is associated with enhanced osteogenic potential and may have implications for pulp tissue engineering.

Clinical Relevance

This study investigated how miR-129-5p modulates the proliferation and osteogenic differentiation of hDPSCs. The findings elucidate its potential role in the regeneration of the pulp-dentin complex and indicate its therapeutic potential for dental tissue repair.

Introduction

Dental pulp diseases and periapical diseases are common oral conditions that can cause irreversible damage to the dental pulp. The dental pulp is a highly vascularized and innervated connective tissue responsible for various physiological functions.¹ Loss of pulp leads to a loss of tooth vitality and function. Furthermore, traditional root canal therapy, which involves dentin removal and lacks the pulp’s stress-perception capability, increases the risk of tooth fracture.² To achieve functional pulp regeneration, Murray et al³ proposed the concept of ‘regenerative endodontic therapy’ (RET) in 2007, which aims to regenerate the pulp-dentin complex using odontogenic stem cells, biomaterial scaffolds, and growth factors. Although the clinically applied revitalization procedure can promote the formation of tissues such as cementum, bone, and periodontal ligament,⁴ it remains challenging to achieve complete regeneration of the pulp-dentin complex.⁵ In recent years, stem cell transplantation strategies have successfully regenerated the pulp-dentin complex in animal studies and some clinical trials.⁶ However, clinical translation is still hampered by difficulties in stem cell isolation and expansion, as well as the attenuation of stemness during storage.⁷ Therefore, selecting appropriate stem cells and optimizing their post-transplantation biological performance are crucial for pulp regeneration.

Human dental pulp stem cells (hDPSCs) were first isolated from permanent human teeth by Gronthos et al⁸ in 2000. They exhibit high proliferative capacity and multidirectional differentiation potential, capable of differentiating into odontoblasts, osteoblasts, adipocytes, chondrocytes, neural cells, and endothelial cells, among others.⁹ Their unique neuro-vascular differentiation characteristics enable them not only to secrete proangiogenic factors but also to directly differentiate into pericytes and endothelial cells, thereby facilitating the formation of vasculature essential for pulp regeneration.¹⁰ Sourced widely with easy access and free from ethical concerns, hDPSCs overcome the limitations in self-renewal capacity associated with bone marrow mesenchymal stem cells and adipose-derived stem cells,¹¹ making them ideal seed cells for regenerating the pulp-dentin complex.

MicroRNAs (miRNAs) are a class of endogenously encoded, noncoding single-stranded RNA molecules approximately 22 nucleotides in length,¹² involved in various processes including cell differentiation, proliferation, migration, and apoptosis.¹³ Previous studies have shown that miRNAs play significant roles in regulating the self-renewal and differentiation of DPSCs. For instance, downregulation of miR-145 and miR-143 promotes odontogenic differentiation¹⁴; downregulation of miR-143-3p facilitates odontoblast formation and induces apoptosis via the OPG/RANKL/RANK pathway¹⁵; inhibition of miR-140-5p also enhances odontogenic differentiation capacity¹⁶; and in inflammatory conditions, upregulation of miR-21 cooperates with STAT3 to promote the odontogenic differentiation of DPSCs.¹⁷ miR-129-5p is expressed in various tissues and is closely associated with tumorigenesis and stem cell differentiation. It can promote the osteogenic differentiation of bone marrow mesenchymal stem cells by inhibiting Dkk3,¹⁸ and its inhibition can ameliorate postmenopausal osteoporosis.¹⁹ Concurrently, miR-129-5p is involved in regulating cell proliferation, migration, immunosuppression, and stemness maintenance.20, 21, 22, 23

While the involvement of miR-129-5p in osteogenesis has been documented across various stem cell lineages, its specific functional role in human dental pulp stem cells (hDPSCs) remains to be fully elucidated. Notably, hDPSCs exhibit superior neurovascular and odontogenic potential compared to other mesenchymal stem cell types, making them a cornerstone for pulp–dentin complex regeneration.

It remains an open question whether miR-129-5p exerts congruent or cell-type-specific regulatory effects within the unique biological niche of hDPSCs. Consequently, verifying whether established miR-129-5p-mediated mechanisms are applicable to hDPSCs is essential for understanding their regenerative capacity.

To explore this, we performed a bioinformatic analysis using GEO datasets to evaluate the impact of miR-129-5p on hDPSC proliferation and osteogenesis. Through a combination of expression profiling and functional validation, this study aims to clarify the miRNA-mediated regulatory landscape in hDPSCs and assess its potential for clinical pulp–dentin tissue engineering.

Materials and methods

Microarray data source

The microarray expression profile data were obtained from the GEO database (Accession: GSE138180), based on the GPL24741 Agilent-070156 Human_miRNA_V21.0_Microarray 046064 platform. The dataset included a total of 6 samples: 3 samples of human dental pulp stem cells (hDPSCs) after 14 days of osteogenic induction and 3 samples of noninduced hDPSCs as controls.

Screening of differentially expressed genes

Using the noninduced hDPSCs as the control group and the 14-day osteogenic-induced hDPSCs as the experimental group, the gene expression differences between the two groups were compared. Differential expression analysis was performed using the Limma package in R (version 4.1.0). A comparison matrix was constructed, missing values were removed, and multiple testing correction was applied using the Bayesian method. Screening criteria were set at |logFC| > 1 and P < .05, and the top 50 differentially expressed miRNAs were selected.

Isolation and culture of dental pulp cells

Impacted third molars or premolars extracted for orthodontic reasons were collected from donors at the Affiliated Stomatological Hospital of Fujian Medical University aged 16 to 25 years, with no caries and periodontal disease, both male and female donors were included, following informed consent and ethical approval. To ensure biological reproducibility, cells from at least three independent donors were used in all experiments. The extracted teeth were washed with phosphate-buffered saline (PBS) and antibiotics, and the periodontal tissues were carefully removed. The pulp tissue was extracted after splitting the teeth longitudinally, followed by digestion with a mixture of Collagenase I and Dispase for 20 to 40 minutes. The digestion was terminated, and the cells were collected by centrifugation, seeded in culture dishes, and maintained in Dulbecco’s modified eagle medium (DMEM) supplemented with 20% foetal bovine serum (FBS) at 37 °C in a 5% CO₂ incubator.

Identification of dental pulp stem cells

The expression of CD34, CD45, CD73, and CD90 was analysed by flow cytometry. After 21 days of osteogenic induction, mineralized nodules were visualized by Alizarin Red staining. Following 4 weeks of adipogenic induction, lipid droplets were observed using Oil Red O staining.

Transfection with miR-129-5p mimic/inhibitor

Cells were divided into miR-129-5p mimic, miR-129-5p inhibitor, and corresponding negative control groups. Transfection was performed when cell confluence reached 60% to 90%. Based on preliminary experiments, 10 nM miR-129-5p mimic and 20 nM inhibitor were used in subsequent experiments. miRNA stock solutions (20 μM) were prepared with diethylprocarbonate (DEPC) water. The miRNA and RNA transfection reagent (BBI, no. E607402) were separately mixed with serum-free DMEM, combined, and incubated at room temperature for 5 to 10 minutes to form complexes, which were then added to the culture plates and incubated at 37 °C for 24 hours. To reflect sustained miR-129-5p modulation during osteogenic differentiation, transfection efficiency was evaluated at day 7.

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted using Trizol Reagent according to the manufacturer’s instructions, with all steps performed on ice. Cells in six-well plates were washed three times with PBS, lysed with 1 mL Trizol for 10 minutes, and transferred to EP tubes. After adding 200 μL chloroform, samples were mixed, rested at room temperature for 10 minutes, and centrifuged at 12,000 revolutions per minute (rpm) and 4 °C for 15 minutes. The aqueous phase was collected, mixed with an equal volume of isopropanol to precipitate RNA, washed twice with 75% ethanol, and air-dried for 30 minutes. RNA was dissolved in 30 μL DEPC water, and the A260/A280 ratio was measured (optimal range: 1.8-2.0). Genomic DNA was removed using 5 × gDNA Wiper Mix (42 °C for 2 minutes). Reverse transcription was performed with stem-loop primers, 10 × reverse transcription (RT) Mix, and HiScript II Enzyme Mix under the following conditions: 25 °C for 5 minutes, 50 °C for 15 minutes, and 85 °C for 5 minutes. The qPCR reaction mixture contained 10.0 μL of 2 × miRNA Universal SYBR qPCR Master Mix, 0.4 μL each of forward and reverse primers, template RNA, and ddH₂O to a total volume of 20 μL. Amplification conditions were: 95 °C for 5 minutes; 40 cycles of 95 °C for 10 seconds and 60 °C for 30 seconds, followed by melt curve analysis. Relative expression was calculated using the 2^–ΔΔCt method, with glyceraldehyde phosphate dehydrogenase (GAPDH) as internal controls. Primer sequences are listed in Table.

Table.

Sequences of primers used for qRT-PCR.

Genes	Primer sequences (5′-3′)
ALP	Forward: CTGGACCTCGTTGACACCTG Reverse: TCCGTCACGTTGTTCCTGTT
COL1	Forward: GAGAGCATGACCGATGGATTC Reverse: CTTCTTGAGGTTGCCAGTCTG
RUNX2	Forward: AGGCAGTTCCCAAGCATTTCATCC Reverse: TGGCAGGTAGGTGTGGTAGTGAG
GAPDH	Forward: GGTGTGAACCATGAGAAGTATGA Reverse: GAGTCCTTCCACGATACCAAAG-3

Western blot analysis

Cells were washed twice with PBS and lysed on ice with RIPA buffer containing protease and phosphatase inhibitors for 30 minutes. Lysates were centrifuged at 12,000 rpm and 4 °C for 15 minutes, and the supernatant was collected for protein concentration determination using the BCA method. Equal amounts of protein were mixed with 5 × SDS loading buffer, denatured at 100 °C for 5 minutes, separated by 10% SDS-PAGE, and transferred to PVDF membranes. Membranes were blocked with 5% skim milk for 1 hour at room temperature, incubated with primary antibodies (diluted as recommended) overnight at 4 °C, washed three times with TBST (5 minutes each), incubated with HRP-conjugated secondary antibodies for 1 hour at room temperature, and washed again. Protein bands were visualized using an ECL chemiluminescence system, imaged, and analysed with ImageJ software. Protein samples were collected at Day 7 after osteogenic induction for Western blot analysis.

Immunofluorescence staining

Cells were seeded on coverslips, washed twice with PBS, fixed with 4% paraformaldehyde for 15 minutes, permeabilized with 0.3% Triton X-100 for 10 minutes at room temperature, and blocked with 5% BSA for 1 hour. After incubation with primary antibodies (diluted as recommended) overnight at 4 °C and washing three times with PBS, cells were incubated with fluorophore-conjugated secondary antibodies for 1 hour in the dark at room temperature. Nuclei were counterstained with DAPI for 5 minutes. Coverslips were mounted and imaged using a confocal laser scanning microscope. Fluorescence intensity was quantified using ImageJ software (NIH, USA). For each group, images from at least three independent experiments were analysed, and the mean fluorescence intensity was calculated for statistical analysis.

Cell proliferation assay

Cell proliferation was evaluated using the CCK-8 assay. Transfected hDPSCs were seeded in 96-well plates at 5 × 10³ cells per well, with five replicates per group. At 1, 3, 5, and 7 days post-transfection, 10 μL of CCK-8 reagent was added to each well, followed by incubation at 37 °C and 5% CO₂ for 2 hours. Absorbance at 450 nm was measured using a microplate reader to assess cell viability. The experiment was repeated three times, and average values were used for statistical analysis.

Alkaline phosphatase (ALP) staining

hDPSCs were seeded in 6-well plates at 1 × 10⁵ cells per well and osteogenically induced for 7 days. Cells were washed three times with PBS, fixed with 4% paraformaldehyde for 15 minutes, and incubated with BCIP/NBT working solution (prepared according to the kit instructions) at room temperature in the dark until purple or blue-purple precipitates appeared. The reaction was stopped with PBS, and staining results were observed and photographed under an inverted microscope. The experiment was repeated three times to ensure reliability.

Statistical analysis

Data were analysed using SPSS 20.0 software and are presented as mean ± standard deviation (x̄ ± s). For binary comparisons, independent t-tests were employed; for comparisons involving three or more groups, one-way ANOVA was utilized, followed by appropriate post hoc analysis for pairwise comparisons, and P < .05 was considered statistically significant.

Results

Analysis and validation of differentially expressed genes

Differential expression analysis of the GSE138180 dataset was performed using the Limma package in R. The results showed that miR-129-5p was significantly downregulated in hDPSCs after 14 days of osteogenic induction (|logFC| > 1, P < .05), with a downregulation fold change of 4.52 (Figure 1A and B). The expression dynamics of miR-129-5p during osteogenic differentiation were further validated by qRT-PCR. Consistent with the bioinformatics analysis, miR-129-5p expression progressively decreased with prolonged induction time. Significant downregulation was observed at both 7 days (3.18-fold) and 14 days (7.48-fold) postinduction (P < .05) (Figure 1C and D). These findings suggest that miR-129-5p may play an important regulatory role in the osteogenic differentiation of hDPSCs.

Fig. 1.

Analysis and validation of differentially expressed miRNAs in hDPSCs before and after osteogenic induction. (A) Volcano plot of differentially expressed miRNAs. (B) Heatmap of differentially expressed miRNAs. (C) Expression level of miR-129-5p at day 7. (D) Expression level of miR-129-5p at day 14. Data are presented as mean ± SD. ***P < .001.

Isolation, culture, and multidirectional differentiation identification of hDPSCs

hDPSCs were successfully isolated and cultured using the tissue explant method combined with enzymatic digestion. After 7 days in culture, the cells exhibited a typical fibroblast-like morphology, appearing as elongated spindle-shaped or polygonal cells that adhered to the culture surface with abundant cytoplasm (Figure 2A and B). Following 21 days of osteogenic induction, Alizarin Red staining revealed distinct orange-red mineralized nodules, confirming osteogenic differentiation potential (Figure 2C). After 21 days of adipogenic induction, Oil Red O staining demonstrated the presence of lipid droplets, indicating adipogenic potential (Figure 2D). Flow cytometric analysis further confirmed the mesenchymal stem cell characteristics of the isolated cells, showing high expression rates of the surface markers CD73 (97.3%) and CD90 (98.5%), while the hematopoietic markers CD34 and CD45 were minimally expressed (<1%) (Figure 2E).

Fig. 2.

Characterization of hDPSCs: morphology, multilineage differentiation potential, and surface marker analysis. (A) Morphology of primary hDPSCs, showing adherent cells with spindle or polygonal shapes. (B) Morphology of passage 2 (P2) hDPSCs, maintaining a consistent cellular shape. Scale bar: 100 μm. (C) Osteogenic differentiation potential assessed by Alizarin Red S staining, indicating calcium deposition in the extracellular matrix. (D) Adipogenic differentiation potential evaluated by Oil Red O staining, showing the formation of intracellular lipid droplets. (E) Flow cytometric analysis of mesenchymal stem cell surface markers in hDPSCs.

Effect of miR-129-5p on the proliferative capacity of hDPSCs

The impact of miR-129-5p on hDPSC proliferation was assessed using the CCK-8 assay following transfection with varying concentrations of miR-129-5p mimic or inhibitor. The results demonstrated that transfection with the miR-129-5p mimic significantly suppressed cell proliferation starting at a concentration of 10 nM, with this inhibitory effect exhibiting a concentration-dependent manner (Figure 3A). In contrast, transfection with the miR-129-5p inhibitor at a concentration of 20 nM promoted cell proliferation (Figure 3B).

Fig. 3.

Cell viability assay following transfection at different concentrations. (A) Cell proliferation activity in the miR-129-5p mimic (mimic) group. (B) Cell proliferation activity in the miR-129-5p inhibitor (inhibit) group. Data are presented as mean ± SD. *P < .05, **P < .01, ***P < .001, ns, not significant.

Effect of miR-129-5p on osteogenic differentiation

qRT-PCR analysis at 7 days post-transfection confirmed highly efficient transfection, showing a significant upregulation of miR-129-5p expression in the mimic group and a marked downregulation in the inhibitor group compared to their respective negative controls (P < .001) (Figure 4A). After 7 days of osteogenic induction, ALP staining intensity was reduced in the miR-129-5p mimic group and enhanced in the inhibitor group compared with their respective negative controls (mimic-NC and inhibitor-NC) (Figure 4B). Following 21 days of induction, Alizarin Red staining revealed a reduction in mineralized nodule formation in the mimic group, whereas the inhibitor group exhibited a substantial increase (Figure 4C).

Fig. 4.

Effect of miR-129-5p on the osteogenic differentiation of hDPSCs. (A) Transfection efficiency after transfection. (B) Alkaline phosphatase (ALP) staining results. Scale bar: 250 μm. (C) Alizarin Red S staining results. Scale bar: 250 μm. (D) mRNA expression levels of osteogenesis-related genes. *P < .05, ***P < .001. (E) Fluorescence imaging of osteogenesis-related protein expression and quantitative analysis of fluorescence intensity. Scale bar: 20 μm. (F) Western blot analysis of osteogenesis-related protein expression.

At the transcriptional level, qRT-PCR demonstrated that overexpression of miR-129-5p significantly suppressed the expression of key osteogenic genes (ALP, COL1, runt-related transcription factor 2 runt [RUNX2]), while its inhibition enhanced their expression (P < .05) (Figure 4D). Consistent with these findings, Western blot analysis indicated that downregulation of miR-129-5p increased the protein levels of ALP and osteopontin (OPN), whereas miR-129-5p overexpression suppressed the expression of both proteins (Figure 4F). Immunofluorescence staining further corroborated these results, showing diminished fluorescence intensity for ALP and OPN in the mimic group and enhanced intensity in the inhibitor group, and quantitative analysis of fluorescence intensity revealed statistically significant differences among groups (P < .05), consistent with the protein expression trends observed in Western blotting (Figure 4E).

Discussion

In the present study, we demonstrate that miR-129-5p functions as a negative regulator of osteogenic differentiation in human dental pulp stem cells (hDPSCs). Specifically, overexpression of miR-129-5p significantly suppressed osteogenic marker expression and mineralization, whereas its inhibition promoted differentiation. We also observed a dynamic expression pattern of miR-129-5p during osteogenic induction, suggesting a stage-dependent regulatory role. These findings, to our knowledge, provide the first evidence that miR-129-5p modulates osteogenesis in hDPSCs, thereby expanding the current understanding of miRNA-mediated control in dental-derived stem cells.

Previous studies have highlighted the regulatory role of miR-129-5p in stem cell differentiation; however, its function appears to be context-dependent. For instance, Zhao et al¹⁸ reported that miR-129-5p promotes osteogenic differentiation in bone marrow-derived mesenchymal stem cells (BMSCs), which contrasts with our findings in hDPSCs. This discrepancy suggests that the biological function of miR-129-5p may vary according to cellular origin and the microenvironment. One possible explanation lies in the intrinsic differences between these stem cell populations. hDPSCs are derived from the neural crest and possess unique odontogenic and neurovascular differentiation potential. In contrast, BMSCs originate from the mesodermal lineage and are more inherently committed to skeletal tissue formation.²⁴ These lineage-specific characteristics may influence miRNA-target interactions and downstream signalling pathways, ultimately leading to divergent functional outcomes. Consequently, our findings underscore the importance of accounting for cell-type specificity when interpreting miRNA functions.

Proliferation and differentiation have traditionally been considered to exhibit a reciprocal relationship, our findings indicate that inhibition of miR-129-5p promotes both proliferation and osteogenic differentiation of hDPSCs. This phenomenon is not unique; accumulating evidence suggests that these processes may coexist depending on the signalling context and temporal dynamics. For instance, TGF-β has been shown to simultaneously enhance proliferation and osteogenic differentiation of dental pulp stem cells.²⁵ In addition, microRNAs function as multitarget regulators that can modulate both cell cycle progression and differentiation pathways.²⁶ It is also possible that enhanced proliferation provides a larger pool of progenitor cells that subsequently undergo differentiation.

Although the precise molecular mechanisms were not experimentally validated in this study, bioinformatic predictions and existing literature suggest that miR-129-5p may regulate osteogenesis by modulating the Wnt/β-catenin signalling pathway. Potential targets include transcription factors such as TCF4 and signalling modulators such as Dkk3, both of which are critical components of Wnt signaling.²⁷ By targeting these molecules, miR-129-5p may inhibit the activation of downstream osteogenic programs, including RUNX2 and other key regulators of mineralization. Future studies are warranted to experimentally confirm these interactions and elucidate the underlying regulatory network.

In addition to direct miRNA–mRNA interactions, emerging evidence suggests that miR-129-5p may function within a broader noncoding RNA regulatory network. Recent studies have demonstrated that circular RNAs (circRNAs) can modulate osteogenic differentiation by acting as competing endogenous RNAs (ceRNAs), thereby sponging specific miRNAs and regulating downstream targets. For instance, circFKBP5 has been shown to promote osteogenic differentiation in hDPSCs by modulating apoptosis and inflammatory responses through miRNA-mediated pathways, ultimately enhancing the expression of osteogenic markers such as RUNX2 and ALP.²⁸ Similarly, circ_0003764 was reported to negatively regulate osteogenesis in periodontal ligament stem cells, possibly through interactions with miRNAs and regulation of proliferation-related pathways.²⁹

These findings highlight that miR-129-5p may not act in isolation but rather as part of a complex regulatory network involving multiple layers of noncoding RNAs. Such interactions may further contribute to the context-dependent effects observed across different stem cell types and microenvironments.

From a biological perspective, the identification of miR-129-5p as a negative regulator of osteogenesis contributes to the growing evidence that miRNAs are essential for fine-tuning stem cell differentiation. In hDPSCs, such regulation may be vital for maintaining the balance between proliferation and differentiation, which is critical for tissue homeostasis and repair.

From a translational perspective, inhibiting miR-129-5p presents a promising strategy for augmenting osteogenic differentiation. However, regenerative endodontics necessitates the coordinated restoration of the entire pulp–dentin complex—encompassing vascularization and innervation—rather than isolated mineralized tissue formation. Indeed, excessive or dysregulated mineralization risks inducing pulp calcification or canal obliteration, thereby compromising functional outcomes. Consequently, the application of miR-129-5p in this field must be approached with caution. Translating these findings into clinical practice also hinges on overcoming several hurdles, most notably achieving efficient, localized delivery. While biomaterial-based scaffolds, hydrogels, and exosome-mediated systems offer potential solutions, the pleiotropic nature of miRNAs necessitates a rigorous evaluation of off-target effects and overall safety. Future research should prioritize the development of controlled delivery platforms to optimize therapeutic efficacy while mitigating systemic risks.

This study has several limitations. First, all experiments were conducted in vitro, which lacks the physiological complexity of in vivo microenvironments or pulp chamber systems to fully evaluate regenerative potential. Second, because odontogenic markers (eg, DSPP, DMP1) were not assessed, our conclusions are confined to osteogenic differentiation rather than definitive odontogenesis. Furthermore, the downstream targets of miR-129-5p were not experimentally validated, rendering the proposed mechanisms speculative. The transient nature of miRNA transfection also constrains long-term assessment; thus, mineralization observed at day 21 likely reflects early-stage downstream cascades rather than sustained miRNA activity. Finally, the absence of untreated controls and incomplete protein-level characterization may further limit the definitive interpretation of these findings.

Conclusion

In conclusion, this study identifies miR-129-5p as a negative regulator of osteogenic differentiation in hDPSCs and suggests its involvement in modulating stem cell fate. These findings provide a foundation for further mechanistic insights and translational applications in regenerative medicine. Future studies should focus on validating the direct molecular targets of miR-129-5p, investigating its role in odontogenic differentiation using specific markers, and confirming its function in more physiologically relevant models, such as tooth slice cultures or animal systems. In addition, strategies for controlled and localized delivery of miRNA modulators should be explored to further assess their potential application in regenerative endodontics.

Authors’ contributions

Conceptualization, Methodology, Software, Validation: Fan Yang

Supervision, Writing – Original draft preparation, Formal analysis: Zonghao Zhang

Software, Validation, Supervision: Xufang Qiu

Project administration, Writing – Reviewing and Editing, Funding acquisition: Hongbing Lv

Ethics statement

The study protocol was submitted to the Medical Ethics Committee of Affiliated Stomatology Hospital, Fujian Medical University, for approval ([2022] Fujian Medical University Stomatological Ethics Review No. (61)). All participants or their families were provided with informed and voluntary consent for the study.

Funding

This study was supported by the Fujian Provincial Natural Science Fund [grant no. 2026J01122919], Fujian Provincial Health Technology Project [grant no. 2025CX01010047], Fujian Medical University Sailing Fund [grant no. 2024QH1165].

Conflict of interest

None disclosed.

Data availability

All data generated or analysed during this study are included in this article.

Further inquiries can be directed to the corresponding author.