Skip to main content
Poultry Science logoLink to Poultry Science
. 2026 Apr 18;105(9):106975. doi: 10.1016/j.psj.2026.106975

The effects of chromium yeast on lipid metabolism, antioxidant status, and meat development in broilers under high stocking density

Miaomiao Han a, Hao Zhang a, Ziang Chen a, Yuanyang Dong a, Zhiqiang Miao a,b, Chenxuan Huang a, Chengqiang Xia a, Jizu Ning c, Yan Guo c, Lei Yan d, Jianhui Li a,∗
PMCID: PMC13265682  PMID: 42235158

Abstract

The objective of this study was to investigate the effects of chromium yeast (Cr yeast) on lipid metabolism, antioxidant status, and gene expression related to meat development in broilers under high stocking density (HSD). A total of 480 22-day-old male Arbor Acre (AA) broilers with similar initial weight were randomly allocated to 6 groups, with 6 replicates per group. The groups consisted of a normal stocking density (14 broilers/m2, NSD) group fed a corn-soybean meal basal diet; high stocking density group (20 broilers/m2 , HSD) fed a basal diet; and four HSD groups fed basal diets supplemented with 200, 400, 800, or 1600 μg Cr/kg from Cr yeast. The experiment lasted from day 23 to 42. The results showed that compared to the NSD group, HSD elevated serum levels of insulin (INS), insulin-like growth factor-I (IGF-I), triglycerides, and high-density lipoprotein cholesterol (HDLC), increased hepatic activities of acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS), and decreased serum total cholesterol (TC) along with hepatic and breast muscle activities of hormone-sensitive lipase (HSL) and lipoprotein lipase (LPL) (P < 0.05). Compared with the HSD group, supplementation with 400 μg/kg Cr enhanced lipid breakdown in HSD-exposed broilers by elevating serum leptin content and increasing hepatic HSL and LPL activities, while simultaneously reducing serum INS, IGF-1, and TC levels, along with hepatic FAS activity (P < 0.05). HSD upregulated heat shock protein 70 (HSP70) mRNA expression while downregulated myostatin (MSTN) mRNA expression in breast muscle (P < 0.05), compared to the NSD group. Cr supplementation at 200, 800, and 1600 µg/kg significantly increased nuclear factor erythroid 2-related factor 2 (Nrf2) mRNA expression in breast muscle (P = 0.008) without affecting other antioxidant genes expression. Furthermore, supplementation with 800 and 1600 µg/kg Cr from Cr yeast elevated mRNA levels of both myogenic factor 6 (MyoF6) and MSTN, while downregulated fatty acid-binding protein 4 (FABP4) mRNA expression in breast muscle (P < 0.05). In summary, dietary Cr yeast alleviated HSD-induced metabolic stress by enhancing lipid breakdown and modulating the expression of key genes involved in muscle development and lipid metabolism, thereby supporting metabolic homeostasis and muscle function under HSD.

Keywords: Broiler, Chromium yeast, Lipid metabolism, Meat development, High stocking density

Introduction

Meat-type broiler chicken production plays a significant economic role. As demand for broiler meat increases, production to meet this demand has become more critical. High stocking density (HSD) has become more prevalent in modern commercial broiler production. However, HSD practices are often accompanied by occurrent welfare problems and health damages to the animals (Guinebretie, et al., 2024). Studies have indicated that HSD reduces the growth performance and modifies endocrinology, inflammation, and intestinal flora balance in broilers (Dong, et al., 2025; Zhang, et al., 2024a; Zhao, et al., 2025). Birds housed under HSD have limited space for movement and resting, as well as restricted air exchange. These factors are commonly associated with a higher incidence of contact dermatitis and impaired body heat dissipation (Abdallah, et al., 2024). According to Guo et al. (2025) and Mansouri et al. (2018), HSD decreases antioxidant status and promotes excessive lipids accumulation, which can damage mitochondrial function, including β-oxidation of fatty acid and oxidative phosphorylation, thereby causing metabolic disorders in carbohydrate, lipids and protein metabolism. Metabolic dysfunction and oxidative stress conditions in HSD affect muscle development and lead to the deterioration of meat and meat products (Falowo, et al., 2014; Wu, et al., 2020b). Therefore, nutritional strategies are required to mitigate the HSD-induced metabolic abnormalities.

Trivalent chromium (Cr) is a highly stable, non-toxic, and naturally occurring form of Cr that is safe for animal consumption. Cr supplementation is considered an effective anti-stress agent and modulator of glucose metabolism (Gül, et al., 2021; Kim, et al., 2025). Studies have shown that Cr can potentiate the insulin sensitivity by connecting with tyrosine kinase fragments on the insulin receptor, which promotes glucose uptake and utilization (Lin, et al., 2024; Mertz, 1993; Vincent, 2000). Therefore, Cr can regulate energy production, muscle development, and lipid metabolism to sustain a healthy state under stressful conditions. Organic Cr forms, such as Cr yeast, Cr methionine, Cr picolinate, have better bioavailability than inorganic forms (Haq, et al., 2016). Studies have indicated that supplementation with organic Cr can improve growth performance, antioxidant traits, and meat quality, and decrease intestinal pathogenic bacteria in broilers (Chen, et al., 2025; Han, et al., 2021; Safwat, et al., 2020; Zhang, et al., 2024b). In addition, supplemental organic Cr can alleviate glucose and lipid metabolism dysfunction through the PI3K/Akt or AMPK signaling pathways (Mackowiak, et al., 2010; Wang, et al., 2006; Zhao, et al., 2009). Under stress conditions, such as heat stress, transport stress, and dietary nutrient density descent stress, organic Cr has also shown superior improvement in alleviating stress-induced detrimental alterations in growth performance, the immune system, energy metabolism, and antioxidant capacity (Hamidi, et al., 2022; Perai, et al., 2015; Wang, et al., 2025; Yu, et al., 2025; Zhang, et al., 2024b).

Chromium yeast, a fermented organic chromium form, exhibits high bioavailability, which demonstrated by its rapid absorption in pharmacokinetics studies in rats (Sahin, et al., 2023). Under normal rearing condition, our previous study illustrated that dietary supplementation with organic Cr regulates lipid metabolism and improves breast muscle amino acid and fatty acid profiles in broilers, and we found that Cr yeast proved more effective in modulating serum lipid profiles and muscle amino acid compositions than other Cr forms, such as Cr methionine or Cr picolinate (Han et al., 2021). Under stress conditions, Cr yeast has superior effects in increasing milk protein yield in heat-stressed dairy cows (Shan, et al., 2025), offers protection to lambs under chronic heat stress (Sandoval-Lozano, et al., 2025), and improves the hepatic health of broilers raised under HSD (Xin, et al., 2022). Furthermore, stressed conditions would elevate Cr excretion via urine increases, thereby elevate the body’s requirement and potentially induce deficiency of broilers (Olayiwola and Adedokun 2025; Gül, et al., 2021). Consequently, Cr supplementation under stressful conditions may require higher doses. A meta-analysis reported that the optimum supplemental level of Cr for broilers under heat stress is 1100 µg/kg and the requirement may vary depending on the specific mechanism of action (Piray and Foroutanifar, 2022).

While the benefits of Cr yeast under heat stress are documented, its specific mechanism and optimal dosage in broilers under HSD remain underexplored. Given its bioavailability, stress-mitigating potential, and practical applicability, Cr yeast represents a promising candidate for regulating lipid metabolism and breast meat development in broilers under HSD. This study provides a targeted investigation of Cr yeast in the HSD model. Using a graded dose design and multi-parameter assessment, it seeks to define an effective and practical supplementation level for improving broiler metabolism and meat development under intensive rearing conditions. Therefore, the aim of this study was to investigate the effects of Cr yeast on lipid metabolism, antioxidant status, and meat development in broilers under HSD. This study provides a nutritional strategy to improve muscle development in HSD-stressed broilers and to alleviate the negative effects of environmental stressors in broilers.

Materials and methods

All animal management and experimental procedures were approved by the Animal Health and Care Committee of the Shanxi Agricultural University (approval code: SXAU-EAW-2022P0507001).

Birds, diets, and management

A total of 480 22-day-old male Arbor Acre (AA) broilers of similar weights were randomly allocated to six experimental groups, with six replicates per group. The experimental treatments include: (1) a normal stocking density (NSD; 14 broilers/m2) group fed a corn-soybean meal basal diet; (2) a HSD (20 broilers/m2) fed a corn-soybean meal basal diet; (3-6) four groups fed with corn-soybean meal basal diets supplemented with 200, 400, 800, and 1600 μg/kg element Cr in the form of Cr yeast (Alltech Co. Ltd., Tianjin, China) and kept at HSD, respectively. Each replicate comprised 10 birds in the CON group and 14 birds in the HSD groups. The basal diet was formulated to meet the nutritional recommendations for AA broilers during their growth period (Aviagen and Huntsville, 2018). The ingredients and nutrient levels are listed in Table 1. Cr yeast was premixed into corn flour and then added to each diet. The diets were fed in pelleted form, and the experiment lasted from day 23 to 42.

Table 1.

The ingredients and nutrient levels of the basal diet in grower phase (%, as fed basis).

Items Grower diets (23∼42 days of age)
Ingredients
  Corn 60.73
  Soybean meal 22.7
  Corn gluten meal 6.0
  Wheat bran 2.0
  Soybean oil 4.1
  DL- Methionine 0.22
  L-Lysine sulphate 0.6
  Threonine 0.03
  Sodium chloride 0.3
  Choline chloride (50%) 0.2
  Trace mineral premix1 0.2
  Vitamin premix2 0.02
  Dicalcium phosphate 1.7
  Limestone 1.2
Total 100
Nutrient levles3
  ME (kcal/kg) 3110
  Crude protein 19.05
  Lysine 1.12
  Methionine 0.53
  Threonine 0.71
  Tryptophan 0.19
  Calcium 0.93
  Available phosphorus 0.41
  Methionine + cysteine 0.80
1

The trace mineral premix provided per kg of diet: Cu, 16 mg; Zn, 110 mg; Fe, 80 mg; Mn, 120 mg; Se, 0.3 mg; I, 1.5 mg; Co, 0.5 mg.

2

The vitamin premix provided per kg of diet: vitamin A, 10,000 IU; vitamin D3, 2,400 IU; vitamin E, 20 mg; vitamin K3, 2 mg; vitamin B1, 2 mg; vitamin B2, 6.4 mg; vitamin B6, 3 mg; vitamin B12, 0.02 mg; biotin, 0.1 mg; folic acid, 1 mg; pantothenic acid, 10 mg; nicotinamide, 30 mg.

3

Metabolizable energy was calculated values and the others were analyzed values.

All broilers were raised in stainless-steel cages (100 cm L×70 cm W) in an environmentally controlled room. The initial temperature was maintained at 25°C, and gradually reduced until it reached at 21°C and then was maintained at this temperature until the end of the experiment. The relative humidity in the rearing room was kept between 50%–70%. All birds were exposed to 23 h light and 1 h darkness and feed and water was provided ad libitum throughout the study.

Plasma sample collection and biochemical measurements

On day 42, after a 12-h fast, one broiler in each replicate, close to the average body weight, was selected for blood sample collection. Blood samples were collected from the wing vein using 0.8-mm-diameter needles into 10-mL anticoagulant-free vacutainer tubes, then, clotted at room temperature for 30 min and centrifuged at 1500 × g for 10 min in a 4°C centrifuge. Subsequently, serum was stored at -80°C for further analysis. The serum was used to determined lipid metabolism profiles. Serum leptin (LEP), insulin (INS), insulin-like growth factor I (IGF-I), cholesterol (CHO), total triglyceride (TG), high-density lipoprotein cholesterol (HDLC), and low-density lipoprotein cholesterol (LDLC) levels were measured using the corresponding commercial kits (Shanghai Enzyme-Linked Biotechnology Co., Ltd, China) according to the manufacturer’s instructions.

Tissue sample collection and enzyme activities detection

After blood sampling, the broilers were euthanized via the carotid artery, then slaughtered, and dissected. Breast, liver, and abdominal fat were collected and stored at -80°C for further analysis. The enzyme activities of hormone sensitive lipase (HSL), lipoprotein lipase (LPL), acetyl-CoA carboxylase (ACC), and fatty acid synthetase (FAS) in liver and abdominal fat were detected using commercial kits (Shanghai Enzyme-Linked Biotechnology Co., Ltd, China) according to the manufacture’s protocol.

Quantitative real-time PCR (qPCR)

Total RNA was extracted from liver and breast tissues using TRIzol reagent (catalog number 9108, Takara, Dalian, China). The concentration and purity of the total RNA were evaluated by the ratio of 260 and 280 nm using a spectrophotometer (Implen, P330-31). Reverse transcriptions of mRNA was conducted using the PrimeScriptTM RT reagent kit with gDNA Eraser (catalog number RR047A; Takara Bio Inc., Otsu, Japan) according to the manufacturer’s instructions. Quantitative real-time PCR was performed in triplicate on a Step One Plus Real-Time PCR system using the SYBR ® Premix Ex TaqTM II (Tli RNaseH Plus) (catalog number RR802A; Takara Bio Inc., Otsu, Japan) according to the manufacturer’s instructions. The following procedure was used in the PCR program: one cycle at 95°C for 30 s, then 95°C for 5 s, 60°C for 30 s, then 45 cycles at 95°C for 5 s, 60°C for 30 s. The primers information is listed in Table 2. All gene sequences were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). Relative mRNA abundance was calculated using the 2−ΔΔCt method, with the quantity of the control group scaled to 1. The geometric mean of β-actin was selected as an internal reference gene to standardize the target gene expression.

Table 2.

Primer used for Real-time PCR of liver and breast in broilers.

Gene Primer sequence (5′-3′) Fragment length/bp Accession number
β-actin F: GCTACAGCTTCACCACCACA 90 NM_205518.2
R: TCTCCTGCTCGAAATCCAGT
HSP70 F: GGGCATTGACTTCTACACCTCCATC 258 NM_001006685.1
R: ACAGCGGCACCATAAGCAACAG
Nrf2 F: TTCGCAGAGCACAGATACTTC 188 NM_205117.1
R: TGGGTGGCTGAGTTTGATTAG
Keap1 F: CTGCTGGAGTTCGCCTACAC 96 XM_025145847.1
R: CACGCTGTCGATCTGGTACA
CAT F: TTGCTATACGGTTCTCCACTGTTGC 255 NM_001031215.2
R: GTAAAGACTCAGGGCGAAGACTCAAG
SOD F: GGTCATCCACTTCCAGCAGCAG 379 U28407.1
R: TAAACGAGGTCCAGCATTTCCAGTTAG
GPX F: GACCAACCCGCAGTACATCA 204 NM_001277853.3
R: GAGGTGCGGGCTTTCCTTTA
ATIC F: AGAGCAGAGGTCTCCAACGCCATCG 325 NM_001396547.1
R: GGTGGAACAGCCGAAGGTTGGTGTG
AMPD F: GGGGCCATCACACACCTGCTTGC 294 XM_040691581.2
R: GAGTTTGAAGACCTGGGCGGCGATG
CAPN1 F: CGGGCGAAGGCGTTGGGTTTGG 336 NM_001044672.2
R: GCGGTGCAGGATGGTCTCATTCAGC
MyoF6 F: CCCCTTCAGCTTCAGCCC 243 NM_001030746
R: CTCATTTCTCCACCGCCTCTTC
MSTN F: CGGTCCCGCAGAGATTTTGGCCTTG 225 NM_001001461.2
R: GCCTGCTGAGCCTCTGGGATTTGC
FABP4 F: TGAAAGAGCTGGGTGTGGGGTTTGC 239 NM_204290.2
R: GCCATCCCACTTCTGCACCTGCTTC

HSP70, heat shock protein 70; Nrf2, nuclear factor erythroid 2-related factor 2; Keap1, kelch-like ECH-associated protein 1; CAT, catalase ; SOD, superoxide dismutase; GPX, glutathione peroxidase; ATIC, 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; AMPD, adenosine monophosphate deaminase; CAPN1, calpain 1; MyoF6, myogenic factor 6; MSTN, myostatin; FABP4, fatty acid binding protein 4. F: forward; R: reverse.

Statistical analysis

Data from the NSD and HSD groups were analyzed using an independent sample t-test. Data from all HSD groups were analyzed by one-way analysis of variance (ANOVA) for a completely randomized design using the general linear model (GLM) procedure in SAS (v 8.0, Inst. Inc., Cary, NC, USA). Data differences among all HSD treatments were examined with Tukey's post hoc test. For all parameters, an individual bird was considered as the experimental unit. A probability level of P < 0.05 was considered statistically significant for all tests.

Results

Plasma lipid metabolism profiles

Serum lipid metabolism profiles are presented in Table 3. Compared with the NSD group, the HSD challenge increased the serum concentrations of INS, IGF-I, TG, and HDLC, while decreased the serum TC level in broilers (P < 0.05). In addition, compared with the HSD group, LEP contents increased, but TC levels decreased in the HSD + 200, 400, and 800 groups (P < 0.001). The levels of IGF-I decreased but TG increased in all Cr-treated groups under HSD (P < 0.001). Diets supplemented with 400 and 800 µg/kg Cr significantly decreased LDLC levels in broilers under HSD (P < 0.001). The concentrations of HDLC were increased in HSD + 200 group but decreased in HSD + 400, 800, and 1600 groups, compared with the HSD control group (P < 0.001).

Table 3.

Effects of chromium yeast on serum lipid metabolism parameters in broilers under high stocking density.

Items NSD HSD HSD
SEM P-value
200 400 800 1600
LEP (μg/L) 14.10 13.88d 14.97b 16.21a 14.23c 12.10e 0.211 < 0.001
INS (mU/L) 14.44 15.75⁎⁎c 16.92ab 13.90d 16.58b 17.43a 0.224 < 0.001
IGF-I (μg/L) 44.3 47.33⁎⁎a 39.02d 44.53b 41.51c 44.13b 0.448 < 0.001
TC (μmol/L) 1179.92⁎⁎ 1064.65a 955.84b 876.66c 935.91b 1039.33a 16.967 < 0.001
TG (μmol/L) 285.22 328.70**d 378.02c 420.58a 376.17c 402.60b 7.776 < 0.001
LDLC (μmol/L) 608.11 622.37a 633.29a 540.45b 436.39c 628.74a 12.041 < 0.001
HDLC (μmol/L) 279.09 352.35⁎⁎b 396.41a 341.93c 301.97e 312.90d 6.502 < 0.001

NSD, normal stocking density; HSD, high stocking density; SEM, standard error of mean. LEP, leptin; INS, insulin; IGF-I, insulin-like growth factor I; TC, total cholesterol; TG, total triglyceride; HDLC, high density lipoprotein cholesterol; LDLC, low-density lipoprotein cholesterol. Values are expressed as means of six replicates per group. *Means t-test results of independent samples in NSD and HSD groups (*P < 0.05, **P < 0.01).

a-e

Means in the same row without the same superscripts differ significantly in all HSD groups (P < 0.05).

Lipid metabolism enzyme activities in liver and abdominal fat

As shown in Fig. 1, liver HSL and LPL activities decreased, whereas ACC and FAS activities increased in the HSD group compared to those in the NSD group (P < 0.001). Compared to the HSD group, the HSD + 200 and HSD + 400 groups had higher HSL activitiy, whereas the HSD + 1600 group had the lowest HSL activity in the liver (P < 0.001). Diets supplemented with 200, 400, and 800 μg/kg Cr increased LPL activity, whereas the diet supplemented with 1600 μg/kg Cr decreased LPL activity compared to the HSD control group (P < 0.001). ACC activity decreased in the HSD + 200 group but increased in the HSD + 400, 800, and 1600 groups, whereas FAS activity increased in the HSD + 200 group but decreased in the HSD + 400, 800, and 1600 groups in the liver (P < 0.001). In abdominal fat, HSL, LPL, ACC, and FAS activities were lower in the HSD group than in the NSD group (P < 0.001). Compared with the HSD group, the activities of HSL and LPL were reduced in the HSD + 200 group, but improved in the HSD + 400, 800, and 1600 groups (P < 0.001). Diets supplemented with 400 and 800 µg/kg Cr significantly elevated the ACC activity in broilers under HSD compared with the HSD group (P < 0.001). The groups of HSD + 200, 400, and 800 had higher FAS activity, whereas the HSD + 1600 group had lower FAS activity than the HSD group (P < 0.001).

Fig. 1.

Fig 1 dummy alt text

Effects of chromium yeast on lipid metabolism related enzymes in liver and abdominal fat in broilers under high stocking density. NSD, normal stocking density; HSD, high stocking density; ACC, acetyl-CoA carboxylase; FAS, fatty acid synthetase; HSL, hormone sensitive lipase; LPL, lipoprotein lipase. Values are expressed as means±SE of six replicates per group. *Means t-test results of independent samples in NSD and HSD groups (*P < 0.05, ⁎⁎P < 0.01). a-cMeans without the same letters differ significantly in all HSD groups (P < 0.05).

HSP70 mRNA expression in liver and breast

As shown in Fig. 2, no differences were observed in the hepatic heat shock protein 70 (HSP70) mRNA expression; however, the HSD group showed significantly higher HSP70 mRNA expression in the breast (P = 0.037). In addition, diets supplemented with different levels of Cr had no effects on HSP70 mRNA expression in the liver and breast compared to the HSD group.

Fig. 2.

Fig 2 dummy alt text

Effects of chromium yeast on liver and breast HSP70 mRNA expression in broilers under high stocking density. NSD, normal stocking density; HSD, high stocking density; HSP70, heat shocked protein 70. Values are expressed as means±SE of six replicates per group. *Means t-test results of independent samples in NSD and HSD groups (*P < 0.05). a,bMeans without the same letters differ significantly in all HSD groups (P < 0.05).

Antioxidant capacity and meat development related genes mRNA expressions in breast

The mRNA expressions levels of antioxidant capacity-related genes in the breast are shown in Fig. 3. The groups of HSD + 200, 800, and 1600 had significantly higher nuclear factor erythroid 2-related factor 2 (Nrf2) mRNA expression in breast tissue than the HSD group (P = 0.008). Stocking density and dietary Cr content had no significant effects on the mRNA expression of Kelch-like ECH-associated protein 1 (Keap1), glutathione peroxidase (GPX), superoxide dismutase (SOD), or catalase (CAT) in the breast. mRNA expression of meat development-related genes in the breast is shown in Fig. 4. There were no differences in 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC), AMP deaminase (AMPD), calpain 1 (CAPN1), myogenic factor 6 (MyoF6), or fatty acid-binding protein 4 (FABP4) mRNA expressions in the breast between the NSD and HSD groups. Myostatin (MSTN) mRNA expression in the breast was significantly decreased in the HSD group than that in the NSD group (P = 0.042). Dietary Cr treatment did not affect ATIC, AMPD, and CAPN1 mRNA expressions in the breast of broilers under HSD. However, compared to the HSD group, the HSD + 800 and 1600 groups elevated the MyoF6 (P = 0.044) and MSTN (P = 0.017) mRNA expressions, whereas diets supplemented with 200, 400, 800, and 1600 µg/kg Cr significantly decreased the breast FABP4 mRNA expression in the breast of broilers under HSD (P < 0.001).

Fig. 3.

Fig 3 dummy alt text

Effects of chromium yeast on breast antioxidant gene mRNA expression in broilers under high stocking density. NSD, normal stocking density; HSD, high stocking density; Nrf2, nuclear factor erythroid 2-related factor 2; Keap1, kelch-like ECH-associated protein 1; GPX, glutathione peroxidase; SOD, superoxide dismutase; CAT, catalase. Values are expressed as means±SE of six replicates per group. a,bMeans without the same letters differ significantly in all HSD groups (P < 0.05).

Fig. 4.

Fig 4 dummy alt text

Effects of chromium yeast on breast muscle development related gene mRNA expression in broilers under high stocking density. NSD, normal stocking density; HSD, high stocking density; ATIC, 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; AMPD, adenosine monophosphate deaminase; CAPN1, calpain 1; MyoF6, myogenic factor 6; MSTN, myostatin; FABP4, fatty acid binding protein 4. Values are expressed as means±SE of six replicates per group. *Means t-test results of independent samples in NSD and HSD groups (*P < 0.05). a-cMeans without the same letters differ significantly in all HSD groups (P < 0.05).

Discussion

In the current study, stocking density was defined as the number of broilers per unit area. The optimum stocking density is 14–18 birds/m2, which was affected by the age of bird, type of environments, and production systems (Gül et al., 2021). In our previous studies, it was determined that a HSD of 20 birds/m², compared with a NSD of 14 birds/m², led to impaired growth performance, reduced antioxidant capacity, lower nutrient digestibility and dysbiosis of the intestinal microbiota in broilers (Dong, et al., 2025; Han, et al., 2023; Miao, et al., 2021). However, there were no significant differences in BW, BWG and FCR among all groups of broilers on day 23–42 in the current study reported by Xin et al. (2022). The similar results were also reported by Rajalekshmi et al. (2014), who illustrated that supplementation with different organic Cr forms had no effects in broilers under normal condition, and Ebrahimzadeh et al. (2012) found that different levels of Cr methionine did not improve the growth performance of heat-stressed broilers. Consequently, these results suggest that the primary effect of organic Cr may be subtle, operating through the modulation of stress and metabolic pathways rather than through direct improvements in conventional growth metrics such as BWG or feed efficiency.

An HSD of 22 birds/m2 impaired broiler lipid metabolism by inducing the production of prostaglandin E2 and leukotriene B4. This in turn promoted hepatic lipid accumulation and compromised ATP production, ultimately disrupting lipid homeostasis (Guo, et al., 2025). Lipid metabolism is a complex physiological process that is regulated by the coordinated actions of multiple hormones, lipid components, and key enzymes. The hormones LEP, INS, and IGF-I act as central regulators. LEP promotes lipolysis and reduces appetite, while INS primarily stimulates lipid synthesis and storage. IGF-I supports the anabolic processes that influence both growth and fat deposition. This balance determines the metabolic state between fat breakdown and storage (Barrios, et al., 2021). Hormonal signaling directly controls the activity of rate-limiting enzymes. HSL is activated by LEP signaling during energy needs to hydrolyze stored TG in the adipose tissue, releasing free fatty acids. Conversely, LPL acts on circulating lipoprotein TG to facilitate fatty acid uptake into tissues for storage or oxidation. For lipid synthesis, ACC and FAS are key enzymes that are promoted by INS. ACC produces malonyl-CoA, which inhibits fat oxidation, and FAS uses this to synthesize new fatty acids (Vanherle, et al., 2025). The outcomes of these regulated processes are reflected in the blood lipid profiles. TC and TG represent the core lipid pools for structural and energy functions, respectively. Their transport is mediated by HDLC and LDLC. HDLC removes excess cholesterol via reverse transport, whereas LDLC delivers it to peripheral tissues (Vanherle, et al., 2025). Dysregulation of the hormone-enzyme axis can disrupt lipid homeostasis by elevating TG levels, increasing LDLC contents, and reducing HDLC concentrations.

In the present study, broilers in the HSD group showed significant alterations in lipid metabolism compared to those in the NSD group. Specifically, the serum levels of INS, IGF-1, and TG were markedly elevated, and the hepatic activities of ACC and FAS were significantly increased. In contrast, the activities of hepatic HSL and LPL were notably decreased. The increase in serum INS and IGF-1 levels reflects a pronounced enhancement of systemic anabolic signaling. These hormonal changes were accompanied by clear reprogramming of hepatic lipid metabolism, as evidenced by the altered activities of key rate-limiting enzymes. The suppression of HSL and LPL indicates reduced lipid breakdown and fatty acid uptake during oxidation. Conversely, the marked increase in ACC and FAS activities strongly suggests the activation of the hepatic de novo lipogenesis pathway. Collectively, these results demonstrate that HSD promotes lipid deposition in broilers, which is consistent with previous reports indicating that HSD (18 birds/m2) disrupts broiler glycolipid metabolism (Wu, et al, 2020b). However, in the HSD group, serum levels of TG, LDLC, and HDLC elevated, while TC content decreased. This result indicates not a uniform increase in all lipid profiles, but a stressed specific repartitioning of lipid metabolism. The increasing in TG and LDLC levels reflects liver lipid deposition. While the rise in HDLC level likely suggests a protective, compensatory response that facilitates TC clearance, while the decrease in TC content likely results from accelerated cholesterol conversion to bile acids and steroid hormones. Therefore, a comprehensive analysis incorporating other relevant biomarkers is required to interpret these unexpected metabolic changes. Consequently, further investigation into the effects of Cr yeast on lipid metabolism in broilers under HSD stress condition is warranted.

Dietary trivalent Cr is absorbed via passive diffusion through the digestive tract and enters the bloodstream, whereas it binds to transferrin and moves from the blood to the tissues (Vincent, 2001). In tissues, Cr is released to generate holochromodulin, which binds to insulin-stimulated receptors to amplify insulin signaling (Vincent, 2000). Thus, Cr functions as an insulin cofactor in vivo and participates in carbohydrate, lipid, and protein metabolism (Pechova and Pavlata, 2007). Dietary Cr supplementation has been shown to modulate lipid profiles of broilers. Kroliczewska et al. (2004) reported that supplementation with 500 μg/kg Cr as Cr yeast reduced serum TG levels, which was consistent with the results of Norri et al. (2012) using Cr methionine at 200 to 800 μg Cr/kg under normal condition. Generally, supplemental Cr reduces serum TC and LDLC levels whereas elevated HDLC levels in broilers (Moeini, et al., 2011). These results align with those of Aslanian et al. (2011), who observed similar lipid-modulating effects with diet supplementation with Cr methionine. In the current study, compared with the HSD group, dietary supplementation of 400 μg/kg Cr enhanced lipid breakdown in HSD-exposed broilers by elevating serum LEP content and increasing hepatic activities of HSL and LPL, while simultaneously reducing serum levels of INS, IGF-1, and TC, along with hepatic FAS activity. These findings are consisted with earlier reports that 400 μg/kg Cr picolinate can reduce fat deposition under heat stress condition (Yu, et al., 2025). The strong correlation in these indicators illustrates that Cr yeast can regulate lipid metabolism in broilers under HSD, but the direct causality and the underlying molecular mechanism requires further investigation.

Heat shock proteins (HSPs) function as crucial molecular chaperones and play vital roles in organisms under stressful conditions (Liu, et al., 2024). In the present study, HSP70 mRNA expression was upregulated in the breast muscle of broilers in the HSD group compared to the NSD group, which is consistent with previous reports (Balakrishnan, et al., 2023). HSPs modulate physiological stress responses and promote cell survival, thereby enhance stress tolerance. In contrast, liver HSP70 mRNA expression remained unaffected by stocking density, whereas it increased in the breast tissue. This tissue-specific response is likely due to differences in basal stress defenses and functional priorities between organs. As a central metabolic and detoxifying organ, the liver maintains high constitutive levels of molecular chaperones (Zhen, et al., 2006), which may provide sufficient protection under moderate stress without requiring further upregulation of HSP70 mRNA. In contrast, skeletal muscles, such as breast tissue, are highly sensitive to physical and metabolic stressors, and therefore rapidly induces HSP70 expression as an acute protective measure to preserve protein integrity and contractile function. This reflects a coordinated, energy-efficient strategy in which tissues prioritize different defense mechanisms according to their physiological roles and vulnerabilities to specific stressors. Previous studies have indicated that dietary supplemental organic Cr, such as Cr methionine (Dalólio, et al., 2024), Cr yeast (Rajkumar, et al., 2018), and Cr histidine (Akdemir, et al., 2015), could down-regulate the HSP70 mRNA expression in heat-stressed broilers. In this experiment, although dietary supplementation with 200–1600 μg Cr/kg from Cr yeast did not significantly affect HSP70 mRNA expression in broilers under HSD, expression levels did not exceed those in HSD group, indicating that Cr might may confer mild protective effects by enhancing stress tolerance.

The Nrf2-Keap1 pathway serves as a central orchestrator of the antioxidant response (Motohashi and Yamamoto, 2004). Oxidative stress induces the gene expression of key enzymes including SOD, CAT, and GPX. In this cooperative defense system, SOD catalyzes the conversion of superoxide radicals into hydrogen peroxide, which is subsequently eliminated by CAT and GPX. This enzymatic cascade effectively neutralizes reactive oxygen species, thereby maintaining cellular redox balance. Our previous study showed that dietary supplementation with different organic Cr forms at 400 μg/kg did not affect breast tissue antioxidant capacity under normal condition (Han, et al., 2021). Under HSD condition, dietary Cr methionine or Cr yeast supplementation can increase the antioxidant capacity of stressed hens and broilers (Jahanian and Mirfendereski, 2015; Xin, et al., 2022). However, in the present study, dietary supplementation with Cr yeast upregulated Nrf2 mRNA expression in the breast tissue of broilers under HSD but did not alter the mRNA levels of Keap1, GPX, SOD, or CAT. This selective upregulation of Nrf2, without corresponding changes in Keap1 or its downstream antioxidants (GPX, SOD, and CAT), suggests that Cr acts primarily at the post-translational level. It likely stabilizes Nrf2 by inhibiting Keap1-mediated degradation, resulting in a compensatory increase in Nrf2 mRNA expression (Motohashi and Yamamoto, 2004). Such moderate activation may enhance basal the cellular defense without initiating a full-scale transcriptional antioxidant program, representing an energy-efficient adaptation to stress.

HSD, as an environmental stressor, likely interferes with muscle growth and development, and alters energy metabolism and fat deposition, thereby influencing meat quality at the molecular level. For meat quality or development, previous studies have reported that HSD has been shown to impair meat quality by increasing cooking loss, reducing water-holding capacity, and altering muscle biochemistry (Bahrampour, et al., 2026; Ludwiczak, et al., 2025; Rahbari, et al., 2026; Wu, et al., 2020a). In addition, transcriptomic analysis revealed that the expression of genes involved in proteolysis, glycolysis, and immune stress was upregulated, whereas the expression of muscle development, cell adhesion, cell matrix, and collagen was downregulated in the muscles of HSD (18.6 birds/m2) -stressed broilers, compared with low stocking density (14 birds/m2) (Wu, et al., 2020b). The effects of organic Cr supplementation remain controversial (Huang, et al., 2016; Xiao, et al., 2017; Zhang, et al., 2024b). In the current study, it was determined that compared to the NSD group, HSD significantly downregulated MSTN mRNA expression, a response that may reflect a compensatory adaptation to stress-induced growth suppression. Moreover, supplementation with 800 and 1600 μg Cr/kg from Cr yeast upregulated the MyoF6 and MSTN mRNA expression, while downregulated the FABP4 mRNA expression relative to the HSD group. The upregulation of MyoF6 suggests an enhanced myogenic differentiation process; the concurrent increase in MSTN, following its initial stress-induced decline, may help restore a balanced and controlled growth regulation; and the downregulation of FABP4 suggests a potential shift in energy partitioning, possibly redirecting resources away from fat deposition toward supporting muscle protein synthesis (Carnac, et al., 2007; Song, et al., 2025; Wu, et al., 2020a). Together, these changes imply that Cr yeast does not merely counteract stress but also fine-tunes key regulatory nodes in muscle development and metabolism, thereby promoting efficient lean tissue growth under challenging conditions, which is consistent with the observed reduction in the activities of enzymes in lipid deposition.

Conclusion

In conclusion, HSD disrupts lipid metabolism and meat development-related gene expression in broilers, whereas dietary Cr yeast supplementation can effectively counteract these adverse effects. Supplementation with 400 μg/kg Cr yeast enhanced lipid breakdown by elevating serum LEP contents and HSL and LPL activities in liver and abdominal fat while reducing serum INS, IGF-I, and TC levels. At the molecular level, higher doses of Cr yeast at the level of 800 and 1600 µg/kg upregulated Nrf2, MyoF6, and MSTN mRNA expression and downregulated FABP4 in the breast, which indicating Cr yeast improved antioxidant capacity and muscle development. These findings suggest that Cr yeast supports metabolic homeostasis and promotes favorable muscle physiology in broilers under HSD.

CRediT authorship contribution statement

Miaomiao Han: Data curation, Formal analysis, Investigation, Methodology, Conceptualization, Resources, Visualization, Writing – original draft, Writing – review & editing. Hao Zhang: Data curation, Investigation, Methodology. Ziang Chen: Investigation, Data curation. Yuanyang Dong: Investigation, Formal analysis. Zhiqiang Miao: Visualization, Investigation, Resources. Chenxuan Huang: Data curation, Investigation. Chengqiang Xia: Formal analysis. Jizu Ning: Investigation, Methodology. Yan Guo: Investigation. Lei Yan: Formal analysis. Jianhui Li: Conceptualization, Project administration, Resources, Writing – review & editing.

Disclosures

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Jianhui Li and Zhiqiang Miao reports financial support was provided by the earmarked fund for Modern Agro-industry Technology Research System (2025CYJSTX15), Shanxi Province’s Special Project for Guiding the Transformation of Scientific and Technological Achievements(202404021301047). Miaomiao Han reports financial support was provided by the Shanxi Agricultural University Science and Technology Innovation Fund under Grant (2020BQ21). No reports a relationship with No that includes:. No has patent No pending to No. All authors have read and agreed to the published version of the manuscript. The authors declare that they have no conflict of interest. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

This research was supported by the earmarked fund for Modern Agro-industry Technology Research System (2025CYJSTX15), Shanxi Province's Special Project for Guiding the Transformation of Scientific and Technological Achievements (202404021301047), Shanxi Agricultural University Science and Technology Innovation Enhancement Project (CXGC2026008).

References

  1. Abdallah N., Kursun K., Baylan M. Environmental enrichment/improvement: effect on performance of commercial broiler strains. Braz. J. Poult. Sci. 2024;26:1–16. doi: 10.1590/1806-9061-2023-1894. [DOI] [Google Scholar]
  2. Akdemir F., Sahin N., Orhan C., Tuzcu M., Sahin K., Hayirli A. Chromium-histidinate ameliorates productivity in heat-stressed Japanese quails through reducing oxidative stress and inhibiting heat-shock protein expression. Br. Poult. Sci. 2015;56:247–254. doi: 10.1080/00071668.2015.1008992. [DOI] [PubMed] [Google Scholar]
  3. Aslanian A., Noori K., Dizaji A.A., Shahryar H.A., Rouhnavaz S., Sis N.M. Evaluate the effect of chromium methionine on performance and serum metabolite in growing-finishing male broiler. J. Basic Appl. Sci. Res. 2011;1:2442–2448. [Google Scholar]
  4. Aviagen A.J.A.G., Huntsville A.L. Aviagen; 2018. Arbor Acres Broiler Management Handbook. [Google Scholar]
  5. Bahrampour K., Afzali N., Hosseini-Vashan S.J. Arginine amino acid, nano particles of zinc oxide, and stock density: effect on growth performance, intestinal morphology, blood indices, and meat quality in broiler chickens. Poult. Sci. 2026;105 doi: 10.1016/j.psj.2025.106148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Balakrishnan K.N., Ramiah S.K., Zulkifli I. Heat shock protein response to stress in poultry: a review. Animals. 2023;13:317. doi: 10.3390/ani13020317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Barrios V., Frago L.M., Canelles S., Guerra-Cantera S., Arilla-Ferreiro E., Chowen J.A., Argente J. Leptin modulates the response of brown adipose tissue to negative energy balance: implication of the GH/IGF-I axis. Int. J. Mol. Sci. 2021;22:2827. doi: 10.3390/ijms22062827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Carnac G., Vernus B., Bonnieu A. Myostatin in the pathophysiology of skeletal muscle. Curr. Genom. 2007;8:415–422. doi: 10.2174/138920207783591672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen K., Lv J.R., Luo Z., Liu Z., Cen M.Z., Li B.K., Ou J.C., Zhang H.H. The effect of amylase, chromium propionate and their combination supplementation on growth performance, carcass traits, serum parameters, antioxidant capacity and intestinal health in yellow feathered broilers. Poult. Sci. 2025;104 doi: 10.1016/j.psj.2025.105229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dalólio F.S., Albino L.F.T., de Oliveira H.C., Fireman A., Junior A.B., Busanello M., Junior N.R., Tesser G.L.S., Nunes R.V. Dietary chromium-methionine supplementation and broiler (22-43 days) responses during heat stress. 2-physiological variables, and heat shock protein 70 and insulin-like growth factor-1 gene expression. Anim. Prod. Sci. 2024;64 doi: 10.1071/an23354. [DOI] [Google Scholar]
  11. Dong Y., Zheng Y., Liu H., Wang Y., Cui J., Wu Y., Yan L., Miao Z., Han M., Huang C.X., Li P., Su Y., Shen Y., Zhang J., Yuan J., Zhang B., Li J. Effects of high stocking density on the growth performance, intestinal health and bile salts composition of broiler chickens. Front. Microbiol. 2025;16 doi: 10.3389/fmicb.2025.1542059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ebrahimzadeh S.K., Farhoomand P., Noori K. Immune response of broiler chickens fed diets supplemented with different level of chromium methionine under heat stress conditions. Asian-Australas. J. Anim. Sci. 2012;25:256–260. doi: 10.5713/ajas.2011.11217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Falowo A.B., Fayemi P.O., Muchenje V. Natural antioxidants against lipid-protein oxidative deterioration in meat and meat products: a review. Food Res. Int. 2014;64:171–181. doi: 10.1016/j.foodres.2014.06.022. [DOI] [PubMed] [Google Scholar]
  14. Guinebretie M., Warin L., Moysan J.P., Meda B., Mocz F., Le Bihan-Duval E., Thomas R., Keita A., Mignon-Grasteau S. Effects of strain and stocking density on leg health, activity, and use of enrichments in conventional broiler chicken production. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2024.103993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gül E.T., Yildiz A., Olgun O. The importance of nutrition in alleviating high stocking density stress in poultry. Ann. Anim. Sci. 2021;3:855–863. doi: 10.2478/aoas-2021-0082. [DOI] [Google Scholar]
  16. Guo C., Zhang Y., Bai D., Zhen W., Ma P., Wang Z., Zhao X., Ma X., Xie X., Ito K., Zhang B., Yang Y., Li J., Ma Y. Aspirin eugenol ester alleviates energy metabolism disorders by reducing oxidative damage and inflammation in the livers of broilers under high-stocking-density stress. Int. J. Mol. Sci. 2025;26:1877. doi: 10.3390/ijms26051877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hamidi O., Chamani M., Ghahri H., Sadeghi A.A., Malekinejad H., Palangi V. Effects of supplemental chromium nanoparticles on IFN-γ expression of heat stress broilers. Biol. Trace Elem. Res. 2022;200:339–347. doi: 10.1007/s12011-021-02634-0. [DOI] [PubMed] [Google Scholar]
  18. Han M., Chen B., Dong Y., Miao Z., Su Y., Liu C., Li J. Evaluation of liquid organic acids on the performance, chyme pH, nutrient utilization, and gut microbiota in broilers under high stocking density. Animals. 2023;13:257. doi: 10.3390/ani13020257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Han M., Chen Y., Li J., Dong Y., Miao Z., Li J., Zhang L. Effects of organic chromium sources on growth performance, lipid metabolism, antioxidant status, breast amino acid and fatty acid profiles in broilers. J. Sci. Food and Agric. 2021;101:3917–3926. doi: 10.1002/jsfa.11053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Haq Z., Jain R.K., Khan N., Dar M.Y., Ali S., Gupta M., Varun T.K. Recent advances in role of chromium and its antioxidant combinations in poultry nutrition: a review. Vet. World. 2016;9:1392–1399. doi: 10.14202/vetworld.2016.1392-1399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Huang Y., Yang J., Xiao F., Lloyd K., Lin X. Effects of supplemental chromium source and concentration on growth performance, carcass traits, and meat quality of broilers under heat stress conditions. Biol. Trace Elem. Res. 2016;170:216–223. doi: 10.1007/s12011-015-0443-z. [DOI] [PubMed] [Google Scholar]
  22. Jahanian R., Mirfendereski E. Effect of high stocking density on performance, egg quality, and plasma and yolk antioxidant capacity in laying hens supplemented with organic chromium and vitamin C. Livest. Sci. 2015;177:117–124. doi: 10.1016/j.livsci.2015.04.022. [DOI] [Google Scholar]
  23. Kim H.W., Lee S.Y., Kim Y.B., Kim J.H. Influence of functional nutrients on poultry performance and health by reducing stress response under environmental stress. Worlds Poult. Sci. J. 2025;81:879–915. doi: 10.1080/00439339.2025.2506399. [DOI] [Google Scholar]
  24. Kroliczewska B., Zawadzki W., Dobrzanski Z., Kaczmarek-Oliwa A. Changes in selected serum parameters of broiler chicken fed supplemental chromium. J. Anim. Physiol. Anim. Nutr. 2004;88:393–400. doi: 10.1111/j.1439-0396.2004.00496.x. [DOI] [PubMed] [Google Scholar]
  25. Lin W.C., Hoe B.C., Li X.M., Lian D.Z., Zeng X.W. Glucose metabolism-modifying natural materials for potential feed additive development. Pharmaceutics. 2024;16:1208. doi: 10.3390/pharmaceutics16091208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Liu S., Liu Y., Bao E., Tang S. The protective role of heat shock proteins against stresses in animal breeding. Int. J. Mol. Sci. 2024;25:8208. doi: 10.3390/ijms25158208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ludwiczak A., Sztandarski P., Skladanowska-Baryza J., Szulc K., Cielen G., Jaszczyk A., Solka M., Pogorzelski G., Horbanczuk J.O., Marchewka J., Sell-Kubiak E. Role of extensification strategies in chicken meat quality. Poult. Sci. 2025;104 doi: 10.1016/j.psj.2025.105717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mackowiak P., Krejpcio Z., Sassek M., Kaczmarek P., Hertig I., Chmielewska J., Wojciechowicz T., Szczepankiewicz D., Wieczorek D., Szymusiak H., Nowak K.W. Evaluation of insulin binding and signaling activity of newly synthesized chromium(III) complexes in vitro. Mol. Med. Rep. 2010;3:347–353. doi: 10.3892/mmr_00000264. [DOI] [PubMed] [Google Scholar]
  29. Mansouri A., Gattolliat C.H., Asselah T. Mitochondrial dysfunction and signaling in chronic liver diseases. Gastroenterology. 2018;155:629–647. doi: 10.1053/j.gastro.2018.06.083. [DOI] [PubMed] [Google Scholar]
  30. Mertz W. Chromium in human nutrition: a review. J. Nutr. 1993;123:626–633. doi: 10.1093/jn/123.4.626. [DOI] [PubMed] [Google Scholar]
  31. Miao Z.Q., Dong Y.Y., Qin X., Yuan J.M., Han M.M., Zhang K.K., Shi S.R., Song X.Y., Zhang J.Z., Li J.H. Dietary supplementation of methionine mitigates oxidative stress in broilers under high stocking density. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Moeini M.M., Bahrami A., Ghazi S., Targhibi M.R. The effect of different levels of organic and inorganic chromium supplementation on production performance, carcass traits and some blood parameters of broiler chicken under heat stress condition. Biol. Trace Elem. Res. 2011;144:715–724. doi: 10.1007/s12011-011-9116-8. [DOI] [PubMed] [Google Scholar]
  33. Motohashi H., Yamamoto M. Nrf2-Keap1 defines a physiologically important stress response mechanism. Trends Mol. Med. 2004;10:549–557. doi: 10.1016/j.molmed.2004.09.003. [DOI] [PubMed] [Google Scholar]
  34. Noori K., Farhoomand P., Ebrahimzadeh S.K. Effects of the chromium methionine supplementation on performance, serum metabolites and carcass traits in broiler chickens. Iran. J. Appl. Anim. Sci. 2012;2:230–235. doi: 10.5713/ajas.2011.11217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Olayiwola S.F., Adedokun S.A. Heat stress in poultry: the role of nutritional supplements in alleviating heat stress and enhancing gut health in poultry. Front. Vet. Sci. 2025;12 doi: 10.3389/fvets.2025.1691532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Pechova A., Pavlata L. Chromium as an essential nutrient: a review. Vet. Med. 2007;52:1–18. doi: 10.17221/2010-VETMED. Czech. [DOI] [Google Scholar]
  37. Perai A.H., Kermanshahi H., Moghaddam H.N., Zarban A. Effects of chromium and chromium + vitamin C combination on metabolic, oxidative, and fear responses of broilers transported under summer conditions. Int. J. Biometeorol. 2015;59:453–462. doi: 10.1007/s00484-014-0860-2. [DOI] [PubMed] [Google Scholar]
  38. Piray A., Foroutanifar S. Chromium supplementation on the growth performance, carcass traits, blood constituents, and immune competence of broiler chickens under heat stress: a systematic review and dose-response meta-analysis. Biol. Trace Elem. Res. 2022;200:2876–2888. doi: 10.1007/s12011-021-02885-x. [DOI] [PubMed] [Google Scholar]
  39. Rahbari S., Sharifi S.D., Salehi A., Najafi A., Honarbakhsh S. Dietary omega-3 fatty acids modulate meat quality and intestinal histology in high-density broiler production. J. Appl. Poult. Res. 2026;35 doi: 10.1016/j.japr.2025.100627. [DOI] [Google Scholar]
  40. Rajkumar U., Vinoth A., Reddy E.P.K., Shanmugam M., Rao S.V.R. Effect of supplemental trace minerals on hsp-70 mRNA expression in commercial broiler chicken. Anim. Biotechnol. 2018;29:20–25. doi: 10.1080/10495398.2017.1287712. [DOI] [PubMed] [Google Scholar]
  41. Rajalekshmi M., Sugumar C., Chirakkal H., Ramarao S.V. Influence of chromium propionate on the carcass characteristics and immune response of commercial broiler birds under normal rearing conditions. Poult. Sci. 2014;93:574–580. doi: 10.3382/ps.2013-03373. [DOI] [PubMed] [Google Scholar]
  42. Safwat A.M., Elnaggar A.S., Elghalid O.A., El-Tahawy W.S. Effects of different sources and levels of dietary chromium supplementation on performance of broiler chicks. Anim. Sci. J. 2020;91 doi: 10.1111/asj.13448. [DOI] [PubMed] [Google Scholar]
  43. Sahin K., Sahin E., Deeh P.B.D., Kayri V., Orhan C., Sahin N. Role of the antioxidant defence system and transcription factors in preventing heat stress in poultry: a dietary approach. Worlds Poult. Sci. J. 2023;19:4. doi: 10.1080/00439339.2023.2234380. [DOI] [Google Scholar]
  44. Sandoval-Lozano E., Barragan I.S.R., Sandoval-Lozano A., Castaneda-Serrano R.D. Effects of chromium yeast supplementation on serum hsp60 and hsp70, mRNA expression in heat-stressed lambs. Vet. Sci. 2025;12:801. doi: 10.3390/vetsci12090801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Shan Q., Ma F., Huang Q., Wo Y., Sun P. Chromium yeast promotes milk protein synthesis by regulating ruminal microbiota and amino acid metabolites in heat-stressed dairy cows. Anim. Nutr. 2025;20:120–130. doi: 10.1016/j.aninu.2024.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Song J., Lv Z., Guo Y. Research advances in intramuscular fat deposition and chicken meat quality: genetics and nutrition. J. Anim. Sci. Biotechnol. 2025;16:100. doi: 10.1186/s40104-025-01234-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Vanherle S., Loix M., Miron V.E., Hendriks J.J.A., Bogie J.F.J. Lipid metabolism, remodelling and intercellular transfer in the CNS. Nat. Rev. Neurosci. 2025;26:214–231. doi: 10.1038/s41583-025-00908-3. [DOI] [PubMed] [Google Scholar]
  48. Vincent J.B. The biochemistry of chromium. J. Nutr. 2000;130:715–718. doi: 10.1093/jn/130.4.715. [DOI] [PubMed] [Google Scholar]
  49. Vincent J.B. The bioinorganic chemistry of chromium (III) Polyhedron. 2001;20:1–26. doi: 10.1016/S0277-5387(00)00624-0. [DOI] [Google Scholar]
  50. Wang G.J., Li X.M., Yu M., Huang Z.W., Feng J.H., Zhang M.H. Impact of chromium picolinate on breast muscle metabolomics and glucose and lipid metabolism-related genes in broilers under heat stress. Animals. 2025;15:2897. doi: 10.3390/ani15192897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wang Z.Q., Zhang X.H., Russell J.C., Hulver M., Cefalu W.T. Chromium picolinate enhances skeletal muscle cellular insulin signaling in vivo in obese, insulin-resistant JCR:LA-cp rats. J. Nutr. 2006;136:415–420. doi: 10.1093/jn/136.2.415. [DOI] [PubMed] [Google Scholar]
  52. Wu Y., Wang Y., Wu W., Yin D., Sun X., Guo X., Chen J., Mahmood T., Yan L., Yuan J. Effects of nicotinamide and sodium butyrate on meat quality and muscle ubiquitination degradation genes in broilers reared at a high stocking density. Poult. Sci. 2020;99:1462–1470. doi: 10.1016/j.psj.2019.10.070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Wu Y., Wang Y., Yin D., Mahmood T., Yuan J. Transcriptome analysis reveals a molecular understanding of nicotinamide and butyrate sodium on meat quality of broilers under high stocking density. BMC Genomics. 2020;21:412. doi: 10.1186/s12864-020-06827-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Xiao F., Ao D., Zhou B., Spears J.W., Lin X., Huang Y. Effects of supplemental chromium propionate on serum lipids, carcass traits, and meat quality of heat-stressed broilers. Biol. Trace Elem. Res. 2017;176:401–406. doi: 10.1007/s12011-016-0852-7. [DOI] [PubMed] [Google Scholar]
  55. Xin X., Han M., Wu Y., Dong Y., Miao Z., Zhang J., Song X., Jia R., Su Y., Liu C., Bai R., Li J. Dietary supplemental chromium yeast improved the antioxidant capacity, immunity and liver health in broilers under high stocking density. Animals. 2022;12:2216. doi: 10.3390/ani12172216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yu M., Li X.M., Zhao X., Feng J.H., Zhang M.H. Chromium picolinate alleviates heat stress-induced breast muscle glucose and lipid metabolism disorders in broiler chickens. Poult. Sci. 2025;104 doi: 10.1016/j.psj.2025.105704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Zhang H., Zhang Y., Bai D., Zhong J., Hu X., Zhang R., Zhen W., Ito K., Zhang B., Yang Y., Li J., Ma Y. Effect of dietary aspirin eugenol ester on the growth performance, antioxidant capacity, intestinal inflammation, and cecal microbiota of broilers under high stocking density. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2024.103825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zhang Q., Zhang H., Jiang Y., Wang J., Wu D., Wu C., Che L., Lin Y., Zhuo Y., Luo Z., Nie K., Li J. Chromium propionate supplementation to energy- and protein-reduced diets reduces feed consumption but improves feed conversion ratio of yellow-feathered male broilers in the early period and improves meat quality. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2023.103260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zhao P., Wang J., Ma H., Xiao Y., He L., Tong C., Wang Z., Zheng Q., Dolence E.K., Nair S., Ren J., Li J. A newly synthetic chromium complex-chromium (D-phenylalanine)3 activates AMP-activated protein kinase and stimulates glucose transport. Biochem. Pharmacol. 2009;77:1002–1010. doi: 10.1016/j.bcp.2008.11.018. [DOI] [PubMed] [Google Scholar]
  60. Zhao X., Zhang Y., Bai D., Zhen W., Guo C., Wang Z., Ma P., Ma X., Xie X., Ito K., Zhang B., Yang Y., Li J., Ma Y. Aspirin eugenol ester modulates the hypothalamus transcriptome in broilers under high stocking density. Animals. 2025;15:823. doi: 10.3390/ani15060823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Zhen F.S., Du H.L., Xu H.P., Luo Q.B., Zhang X.Q. Tissue and allelic-specific expression of hsp70 gene in chickens: basal and heat-stress-induced mRNA level quantified with real-time reverse transcriptase polymerase chain reaction. Br. Poult. Sci. 2006;47:449–455. doi: 10.1080/00071660600827690. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES