A Wolbachia lineage likely representing a new supergroup (Y) dominates the microbiome of the quill mite Syringophilus bipectinatus Heller, 1880 (Acariformes: Syringophilidae)

Abstract

The microbiome plays a key role in animal biology, including host reproduction. Quill mites (Acariformes: Syringophilidae) are understudied ectoparasites of birds, with many species exhibiting strongly female-biased sex ratios. Previous studies have identified unique strains of Wolbachia and Spiroplasma in quill mites, both known to manipulate host reproduction in other arthropods. To further investigate this association, we analyzed the microbiome of Syringophilus bipectinatus Heller, 1880, a relatively early-diverging quill mite species parasitizing the Red Junglefowl (domestic type) (Galliformes: Phasianidae), using 16S rRNA gene profiling. We categorized mite specimens by sex and developmental stage to test for potential associations between microbiome composition and sex ratios. We report the first detection of Wolbachia in S. bipectinatus with a single amplicon sequence variant (ASV) consistently detected across all analyzed samples, accounting for 56–99% of total bacterial sequence reads. Phylogenetic analysis based on 16S rRNA gene and four protein-coding genes (fbpA, ftsZ, gatB, hcpA) recovered this strain as a deeply divergent Wolbachia lineage that does not cluster with any previously described supergroup. This lineage is therefore interpreted as likely representing a novel Wolbachia supergroup (Y), although its formal status requires further validation using genome-scale data. Its consistent presence across both sexes and all developmental stages suggests a stable and potentially obligate association, although its functional role remains to be determined. In addition, we identified bacterial taxa also reported from avian hosts, including potentially pathogenic genera such as Arcobacter, highlighting the complex microbial ecology of quill mites.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-48644-7.

The microbiome plays a crucial role in the physiological functions of animals, influencing a wide range of host traits. Bacterial symbionts can affect reproduction, immunity, and behaviour, including mate choice¹, and can also provide essential nutrients² or defense against pathogens³. Despite their importance, host-associated microbiomes remained poorly studied until the advent of high-throughput DNA sequencing technologies.

In invertebrates, microbiome research has focused primarily on arthropods of medical or economic importance, such as vectors of human and animal diseases⁴ or agricultural pests^5–7, whereas many parasitic mites remain poorly explored with respect to their microbial associates. Recent studies of endosymbionts in sap-feeding insects have shown that long-term associations can lead to obligate nutritional mutualisms^8,9,10, underscoring the evolutionary potential of intimate host-microbe interactions.

This study focuses on quill mites (Acariformes: Syringophilidae), which are obligate ectoparasites of birds. These mites inhabit feather quills, where heavy infestations may cause feather damage and negatively affect host condition¹¹. Their permanent association with avian hosts, combined with vertical and horizontal transmission routes and a feeding mode involving host tissue fluids, suggests that quill mites may act as reservoirs or vectors of microorganisms. Indeed, previous studies have detected potentially pathogenic bacteria in syringophilid mites, including Anaplasma, Brucella, and Bartonella^12,13. A striking feature of many quill mite species is their highly female-biased sex ratios, with males being rare or even absent in some taxa. This pattern has prompted hypotheses that reproductive manipulators such as Wolbachia may contribute to sex ratio distortion, as documented in other arthropods¹⁴. However, empirical evidence for such effects in quill mites remains limited and inconsistent.

Wolbachia is a maternally inherited genus of intracellular Alphaproteobacteria and represents one of the most widespread bacterial symbionts of arthropods and filarial nematodes^15,16. In arthropods, Wolbachia is best known for its ability to manipulate host reproduction through mechanisms such as cytoplasmic incompatibility, parthenogenesis induction, feminization, and male killing¹⁴. However, Wolbachia-host interactions span a continuum from parasitism to obligate mutualism, with some strains providing essential nutritional or physiological functions to their hosts^15,17.

The classification of Wolbachia is based primarily on molecular markers, including the 16S rRNA gene, five multilocus sequence typing (MLST) loci, and the Wolbachia surface protein gene (wsp)^18,19. Distinct evolutionary lineages are referred to as “supergroups,” which currently encompass more than twenty clades infecting diverse arthropod and nematode hosts²⁰. Some supergroups show broad host ranges (e.g., A and B), whereas others appear to be restricted to particular host lineages. Such host specificity complicates inference about Wolbachia function based solely on phylogenetic affiliation^21,20.

Previous studies of quill mites have revealed a remarkable diversity of Wolbachia lineages. Targeted PCR screenings detected Wolbachia across multiple syringophilid species, including representatives of supergroups F, P, and Q. Supergroup F is also known from nematodes, whereas P and Q appear to be restricted to quill mites²². Subsequent 16S rRNA gene amplicon sequencing demonstrated that Wolbachia and Spiroplasma dominate the microbiome of several quill mite species, although their presence was often inconsistent across individuals and populations¹². This heterogeneity has hindered robust inference about the biological role of Wolbachia in quill mites.

One approach to achieving greater resolution on this point is to examine mite taxa that occupy early-branching positions within Syringophilidae or parasitize hosts representing evolutionarily distinct avian lineages. Such systems may retain ancestral features of mite-microbe associations, although strict co-divergence between birds and quill mites has not been demonstrated. In this context, Syringophilus bipectinatus Heller, 1880 is of particular interest. This species parasitizes several galliform birds, including the red junglefowl (domestic type) (Gallus gallus domesticus), and exhibits a suite of morphological traits considered evolutionarily ancestral within Syringophilidae²³.

Taken together, these characteristics make quill mites an unusual and informative system for exploring host-symbiont evolution and raise fundamental questions about the origin, timing, and initial function of Wolbachia infections in these parasites. Addressing these issues requires an integrative framework that considers birds as primary hosts, quill mites as parasites, and bacterial symbionts as additional evolutionary partners. Most previous work on syringophilid microbiota has focused on mites associated with passerine birds, a relatively recent, species-rich avian clade that originated approximately 50 million years ago²⁴. In contrast, mites parasitizing hosts from early diverging avian lineages may provide deeper insight into the evolutionary origins of mite microbe associations, particularly given evidence that bird mite relationships extend back to the earliest stages of avian evolution^23,25. Syringophilid mites belong to the superfamily Cheyletoidea, with Syringophilidae forming a sister group to Cheyletidae²⁶, and are hypothesized to derive from cheyletid-like micro predators that later shifted to parasitism within feather quills^26,27. Syringophilus Heller 1880 represents an early-diverging lineage within the family . This is consistent with its retention of ancestral morphological traits²³. The genus currently comprises two species, including S. bipectinatus, a parasite of galliform birds worldwide (Żmudziński et al., 2023) ⁷³. Its hosts belong to one of the earliest diverging avian lineages, which originated in the Late Cretaceous approximately 82 million years ago^28,29, although the red junglefowl (domestic type) (Gallus gallus domesticus) itself represents a much more recent lineage within this clade, reflecting comparatively recent domestication processes²⁹.

Nevertheless, the presence of S. bipectinatus across multiple galliform hosts, including wild species, may point to a substantially older association between these taxa. Together with the accessibility of material, these features make S. bipectinatus a suitable model for investigating the evolutionary origins and potential functions of Wolbachia in quill mites.

In the present study, we used an unbiased 16S rRNA gene profiling approach to characterize the microbiome of S. bipectinatus across multiple populations, sexes, and developmental stages. We aimed to (i) determine whether Wolbachia infects this species and assess its prevalence and consistency, (ii) evaluate potential associations between microbiome composition and sex ratio variation, and (iii) place the detected Wolbachia strain within a broader phylogenetic framework using multilocus data. By integrating microbiome profiling with phylogenetic analyses, we sought to clarify both the distribution and evolutionary distinctiveness of Wolbachia associated with this quill mite species.

Materials and methods

Animal material

The mite material used in this study consisted of seven populations of S. bipectinatus collected from seven individuals of the red junglefowl (domestic type) (Gallus gallus domesticus) in Santok, Poland (collected by K. Ostrowska). (Gallus gallus domesticus). No live animals were subjected to experimental procedures for this study, therefore, ethical approval from an institutional or licensing committee was not required. All procedures were carried out in accordance with relevant national and institutional guidelines and regulations.

The feathers were preserved in 96% ethanol and stored at − 20 °C. Mite-infested feather quills were dissected using a stereo microscope (Olympus ZS30). Mites were sorted by sex and developmental stage into females, males, and immature instars. DNA was extracted from pooled samples, with each pool containing 11–21 individuals (mean = 15). A total of 96 samples were prepared, including 90 mite pools and six feather quill samples used as negative environmental controls.

To minimize external contamination, each mite specimen was washed twice in ethanol before DNA extraction. Blank DNA extractions were included as negative controls for PCR amplification and sequencing.

Morphological analysis

All morphological observations and species/instar identification were conducted using an Olympus BH2 microscope with differential interference contrast (DIC) optics and a camera lucida. Bird nomenclature follows Clements et al.³⁰.

DNA extraction

Before DNA isolation, pooled mite samples were homogenized using frosted microscope slides under a laminar flow cabinet. Samples were incubated overnight at 56 °C with 0.2 mg ml⁻¹ Proteinase K and 180 µl ATL buffer (Qiagen GmbH, Hilden, Germany). Total genomic DNA was extracted using DNeasy Blood & Tissue Kit (Qiagen) following Dabert et al.³¹. DNA from feather quill fragments and blank extractions was processed in parallel. All DNA samples are deposited in the Department of Animal Morphology, Faculty of Biology, Adam Mickiewicz University in Poznań, Poland.

Library preparation and sequencing

The V4 hypervariable region of the bacterial 16S rRNA gene was amplified using PCR primers V4F (GATCAGCAGCCGCGGTAATA) and V4R (GGACTACCAGGGTATCTAA)³² fused with Ion Torrent adapters and sample-specific indices, following Glowska et al.¹². For the PCRs, each 10 μl sample was prepared in two technical replicates containing HOT FIREPol Blend Master Mix (Solis BioDyne), 0.25 μM of each double-indexed fusion primer, and about 1 ng of template DNA. The PCR profile used was 12 min at 95 °C, 30 cycles of 15 s at 95 °C, 90 s at 50 °C, 30 s at 72 °C, and a final 5 min at 72 °C. After PCR, all samples were pooled, size-selected on a E-gel™ SizeSelect™ Agarose Gel, 2% (Invitrogen by Thermofisher Scientific, USA) according to the manufacturer’s protocols. DNA concentration and amplicon length were quantified using an Agilent 2200 TapeStation system (Agilent Technologies, Inc.). Clonal template amplification on Ion Sphere Particles (ISPs) was performed using the Ion Torrent One Touch System II and the Ion 540™ Kit-OT2 according to manufacturer’s instructions. Sequencing of the templated ISPs was conducted on the Ion 540™ Chip with the use of Ion 540™ Sequencing chemistry and Ion Gene Studio S5™ System (Ion Torrent, Thermo Fisher Scientific, Inc.) at the Molecular Biology Techniques Laboratory, Faculty of Biology, AMU. The data supporting this study are openly available in NCBI under BioProject accession number PRJNA1250786.

Read processing and statistical analyses

Raw sequencing data were prefiltered by Ion Torrent Suite software version 5.18.1 (Life Technologies, USA) to remove polyclonal and low-quality sequences. Further processing was conducted using fastq data and a custom workflow. Reads shorter than 180 bp were removed from the dataset using Geneious Prime 2023.1.2 (Biomatters Ltd.). FastX-Toolkit³³ was used to extract sequences with a minimum of 50% of bases having a quality score ≥ 25. Quality-filtered sequences were separated into individual combinations of indexes in Geneious Prime. Next, the sequences were trimmed at the 5’ and 3’ ends to exclude PCR primers. Then, sequences were denoised to generate amplicon sequencing variants (ASVs) using the DADA2 denoise-pyro method implemented in QIIME2 version 2024.2 (Bolyen et al. 2019, Callahan et al. 2016)^77,78. Potential cross-talk was removed using UNCROSS2, and ASVs detected in negative controls were excluded from downstream analyses³⁴. Then, ASVs were compared using the sklearn-based Naive Bayes classifier, trained on the SILVA database for ARB for small subunit ribosomal RNAs version 138.1 [www.arb-silva.de]^35,36,37, applying a 0.96 confidence threshold.

Wolbachia strain characterization

Given the known limitations of single-locus phylogenies in Wolbachia, evolutionary inference was primarily based on a concatenated multilocus dataset. For Wolbachia-positive samples, four protein-coding MLST loci (fbpA, ftsZ, gatB, hcpA) were amplified using locus-specific primers for representative samples from each mite population. PCRs were conducted in 10 μL reaction volumes, containing 5 μL of Type-it Microsatellite Kit (Qiagen), 0.5 μM of each primer (Table 1), and 4 μL of DNA template. The PCR cycling profile was as follows: 95 °C for 5 min, followed by 37 cycles of 30 s at 95 °C, 45 s at primer annealing temperature and 90 s at 72 °C, with a final elongation step of 10 min at 72 °C.

Table 1.

Primers used for PCR amplification and sequencing of Wolbachia genes.

Locus	Primer name	Sequence (5′–3′)	Tm (°C)
ftsZ	ftsz_F	GCWGGAATGGGTGGTGGMACTG	60
	ftsz_R	GCAGCTTCTGCAGCARTAATTGC
hcpA	hcpa F	CAGCWATAAAAARCGCAACTGG	58
	hcpa R	AGCATCACGCACTTTRCCA
gatB	gatb F	CTTCGTTGTGATGCAAATGT	50
	gatb_R	GATTTAAYARRATCAATTTTGTC
fbpA	fbpa F	CTTATGCWGGAATGCTTCCACTTAT	58
	fbpa_R	TAGCACCAAGCAAAGYTGCT

Amplicons were Sanger-sequenced following Glowska et al.²², and chromatograms were manually inspected and edited in Geneious R11 (Biomatters Ltd.). All sequences are deposited in GenBank under the accession numbers as in Table 2.

Table 2.

GenBank accession numbers of sequence data used in this study for alignment and phylogenetic analysis of Wolbachia strains.

Wolbachia host	Wolbachia phylogenetic group	16S rRNA	fbpA	ftsZ	gatB	hcpA
Drosophila sturtevanti	A	CP050531	CP050531	CP050531	CP050531	CP050531
Enoplognatha latimana	A	OR220066	OR227584	OR227585	OR227586	OR227589
Apotomis betuletana	B	OX366320	OX366320	OX366320	OX366320	OX366320
Ischnura elegans	B	OX366371	OX366371	OX366371	OX366371	OX366371
Dirofilaria immitis	C	CP046578	CP046578	CP046578	CP046578	CP046578
Onchocerca ochengi	C	HE660029	HE660029	HE660029	HE660029	HE660029
Litomosoides sigmodontis	D	CP046577	CP046577	CP046577	CP046577	CP046577
Litomosoides brasiliensis	D	KU255241	KU255333	KU255355	KU255381
Megalothorax incertus	E	KT799584	KT799594	KT799599	KT799604	KT799609
Chorthippus parallelus	F	FJ438537	KM078858	KM078863	KM078868	KM078878
Cimex japonicus	F	AB508951		AB508953		MF662582
Oeciacus vicarius	F	AY091456		AY091457		MF662584
Odontotermes horni	F	GQ422897	GQ422843	GQ422852	GQ422862	GQ422872
Zootermopsis angusticollis	H	AY764279		AY764283		FJ390174
Zootermopsis nevadensis	H	AY764280		AY764284		FJ390175
Ctenocephalides orientis	I	CP116769	CP116769	CP116769	CP116769	CP116769
Dipetalonema caudispina	J	CP046580	CP046580		CP046580	CP046580
Cruorifilaria tuberocauda	J	CP046579	CP046579		CP046579	CP046579
Bryobia sp.	K	EU499316		EU499321
Nothrus anauniensis	K	PP001782	PP024883			PP024885
Radopholus similis	L	EU833482		EU833483
Cinara cedri	M	JN384079	JN384037	JN384034	JN384099	JN384036
Toxoptera aurantii	N	JN384095
Bemisia tabaci	O	KF454771	KF454746	KF452576	KF452588	KF454726
Syringophilopsis turdus	P	KP114103		KP114114
Torotrogla merulae	P	KP114099		KP114113
Torotrogla cardueli	Q	KP114100
Atemnus politus	S	MN931248	MN931694	MN931697	MN931691
Cimex hemipterus	T	CP061738	CP061738	CP061738	CP061738	CP061738
Spinturnix sp.	U	KP165041		MW145493
Branchipus schaefferi	V	MH447361
Streprocephalus cafer	V	MH447357
Ctenocephalides felis wCfeJ	V	CP051157	CP051157	CP051157	CP051157	CP051157
Howardula sp.	W	CP092368	CP092368		CP092368
Ctenocephalides felis wCfeT	W	CP051156	CP051156	CP051156	CP051156	CP051156
Tiaeris stenaspis	X	OR457752	OR462179	OR462180	OR462181	OR462182
Syringophilus bipectinatus	Y	PZ269478	PV730314	PV730315	PV730316	PV730317
Outgroup strains
Ehrlichia chaffeensis		CP000236	CP000236	CP000236	CP000236	CP000236
Ehrlichia ruminantium		CR767821	CR767821	CR767821	CR767821	CR767821

The V4 region of the 16S rRNA sequence of Wolbachia from S. bipectinatus was analyzed for nucleotide variations in comparison to strains from established Wolbachia supergroups, with particular emphasis on positions corresponding to the Escherichia coli 16S rRNA reference sequence (GenBank accession no. AE014075).

Phylogenetic analyses

Phylogenetic placement of Wolbachia from S. bipectinatus was inferred using both single-locus and multilocus approaches. Separate phylogenetic analyses were conducted for each genetic marker (16S rRNA, fbpA, ftsZ, gatB and hcpA) and for a concatenated multilocus alignment (supermatrix) combining all five loci. The concatenated dataset incorporated sequences from 36 Wolbachia strains infecting diverse arthropod and nematode hosts together with the sequence from S. bipectinatus. Potential recombination among loci was tested using the φ (phi) test implemented in SplitsTree 6³⁸.

Multiple sequence alignments were generated in MEGA^39,40. Maximum-likelihood trees were reconstructed in IQ-TREE⁴¹, with the best-fitting nucleotide substitution models selected using ModelFinder⁴². Branch support was assessed using the ultrafast bootstrap approximation (UFBoot) and the SH-like approximate likelihood ratio test (SH-aLRT), each with 1,000 replicates.

Sequences from Ehrlichia spp. were included as outgroup taxa. NCBI accession numbers for all sequences included in the phylogenetic analysis are provided in Table 2.

Results

Molecular characterization of Wolbachia from S. bipectinatus

In the V4 region of the 16S rRNA gene of Wolbachia from S. bipectinatus, a thymine (T) was observed at the position corresponding to nucleotide 664 of the Escherichia coli reference sequence. In contrast, adenine (A) is present at this position in all currently described Wolbachia supergroups. This nucleotide substitution generates a distinctive sequence motif (5′-TGAATG-3′), which appears to be characteristic of a highly divergent Wolbachia lineage, hereafter referred to as lineage Y, likely representing a new supergroup (Table 3).

Table 3.

Unique 16S rRNA sequence motif (TGAATG) diagnostic for Wolbachia supergroup Y detected in S. bipectinatus.

A 253-bp fragment of the 16S rRNA gene was amplified from Wolbachia associated with the quill mite, and BLASTn analysis revealed the highest sequence identity (99.21%) to Wolbachia 16S rRNA sequences from the meadow grasshopper Chorthippus parallelus (Insecta: Orthoptera; accession numbers FJ438537 and FJ438338) and from the tropical bed bug Cimex hemipterus (Insecta: Hemiptera; accession number AB508951).

In addition to 16S rRNA, four protein-coding Wolbachia genes were amplified from S. bipectinatus: fbpA, ftsZ, gatB, and hcpA (Table 2). The 305-bp fbpA sequence showed 100% identity to a Wolbachia strain detected in a sarcoptiform mite (Acariformes: Sarcoptiformes; accession number KX843053). The 430-bp ftsZ fragment exhibited the highest identity (86.68%) to the ftsZ gene from the bat fly Cyclopodia dubia (Insecta: Diptera; accession numbers KT755138 and KT751139). The 282-bp gatB sequence shared 83.51% identity with the gatB gene from the filarial nematode Litomosoides brasiliensis (Nematoda: Rhabditida; accession number KU255381). Finally, the 336-bp hcpA fragment showed 99% identity to the Wolbachia sequence associated with the springtail Megalothorax incertus (Collembola: Neelipleona; accession number KT799609).

Wolbachia phylogenetic placement

Phylogenetic analysis of Wolbachia from S. bipectinatus was performed using concatenated sequences of five bacterial loci: 16S rRNA, fbpA, ftsZ, gatB, and hcpA, resulting in a total alignment length of 1,596 bp. Across all analyzed samples, a single amplicon sequence variant (ASV) of the 16S rRNA gene and a single sequence type for each of the remaining loci were identified. These results suggest that S. bipectinatus is infected with a single, genetically homogeneous strain of Wolbachia.

Phylogenetic analyses based on both the concatenated multilocus supermatrix and the single-gene datasets consistently recovered the Wolbachia strain detected in S. bipectinatus as a putatively distinct lineage relative to previously described Wolbachia supergroups. In the concatenated five-gene analysis (16S rRNA, fbpA, ftsZ, gatB, and hcpA), this strain formed a deeply divergent, well-supported clade that was separated from all recognized Wolbachia supergroups (Fig. 1). The nodes subtending this lineage received high support in both ultrafast bootstrap and SH-aLRT tests, indicating that the inferred placement is robust and not driven by a single locus.

Fig. 1.

Maximum-likelihood (ML) phylogenetic reconstruction of Wolbachia based on a concatenated matrix of five bacterial loci: 16S rRNA, fbpA, ftsZ, gatB, and hcpA (total alignment length 1596 bp). ML bootstrap values are based on 1000 replicates and are shown at the nodes. Terminal node labels correspond to the host species of each Wolbachia strain, except for the outgroup. Capital letters indicate previously described Wolbachia supergroups. The strain detected in the quill mite S. bipectinatus is recovered as a highly divergent Wolbachia lineage (lineage Y), likely representing a previously unrecognised supergroup.

The topology recovered from the concatenated dataset was broadly congruent with the general signal observed across individual gene trees (Supplementary Figures S1–S5). The ftsZ and fbpA phylogenies closely mirrored the multilocus topology and consistently supported the placement of the S. bipectinatus Wolbachia as a deeply divergent lineage distinct from previously recognised supergroups (Supplementary Figures S1–S2). By contrast, in the remaining loci (gatB and hcpA; Supplementary Figures S3–S4), its affinities to other supergroups were less clearly resolved. In these loci, alternative topologies were recovered in which the S. bipectinatus strain showed affinities to existing Wolbachia supergroups, and the 16S rRNA gene did not consistently support a basal position. Such incongruence among loci is common in Wolbachia phylogenetics and likely reflects differences in phylogenetic signal, evolutionary rate, or locus-specific histories associated with short MLST fragments.

To assess whether recombination could bias the concatenated analysis, a φ (phi) test was performed on the multilocus alignment. No evidence of recombination was detected, supporting the validity of the concatenated phylogenetic reconstruction. Collectively, these results point to the Wolbachia strain associated with S. bipectinatus representing a deeply divergent lineage within the genus.

Developmental-stage structure of sampled mite populations

Before analysing microbiome composition, we summarised the developmental-stage structure of the sampled mite populations. A total of 1394 S. bipectinatus individuals were analysed, comprising 466 females (33.4%), 258 males (18.5%) and 670 immature stages (48.1%) (Supplementary Table S1). Across feather populations, females accounted for 26.8–51.1% of individuals, males for 7.2–26.8%, and immatures for 35.1–60.2%. Given that immature stages accounted for nearly half of all specimens, exact sex ratios could not be reliably assessed.

Overall microbiome composition (complete dataset)

Analysis of 16S rRNA gene amplicon data from 90 pooled S. bipectinatus samples revealed a microbiome strongly dominated by Wolbachia. A single Wolbachia ASV was detected in all analysed mite samples and accounted for between 56 and 99% of total bacterial reads, irrespective of host sex, developmental stage or population (Fig. 2A).

Fig. 2.

Relative abundance of bacterial taxa detected in pooled S. bipectinatus samples across females, males and immature mites, compared with feather quill. (A) Proportion of Wolbachia reads relative to all other bacterial taxa, illustrating the dominance of a single Wolbachia ASV in all mite samples. (B) Relative abundances of non-Wolbachia bacterial families across samples.

Excluding Wolbachia from this overview, mite microbiomes were dominated by low-abundance taxa belonging mainly to Arcobacteraceae, Enterobacteriaceae, Pseudomonadaceae, Sphingomonadaceae, Staphylococcaceae, Streptococcaceae, Moraxellaceae, Microbacteriaceae and Rhodobacteraceae, whereas quill samples harboured a broader assemblage additionally including Weeksellaceae, Xanthomonadaceae, Nocardioidaceae and Intrasporangiaceae (Fig. 2B).

Ordination analyses based on the complete bacterial dataset revealed a clear separation between mite samples and feather quill controls, with the first two axes primarily reflecting the overwhelming contribution of Wolbachia to mite microbiomes (Fig. 3).

Fig. 3.

Ordination of complete bacterial communities associated with S. bipectinatus. Principal coordinates analysis (PCoA) based on Bray–Curtis distances shows the microbial composition of mite and feather quill samples, with each point representing a pooled sample and spatial proximity reflecting similarity in community structure. The first two axes explain the majority of the variance and primarily capture the overwhelming contribution of Wolbachia to mite microbiomes relative to feather-derived controls.

Alpha-diversity analyses likewise showed significantly higher Shannon diversity in feather quills compared with mites, whereas female, male and immature mites displayed broadly similar diversity levels (Fig. 4).

Fig. 4.

Alpha diversity of bacterial communities associated with S. bipectinatus and feather samples. Raincloud plots illustrate Shannon diversity indices for bacterial communities in female, male and immature mites, as well as feather quill controls. Each point represents a pooled mite sample. Boxplots indicate extrema (whiskers), interquartile range (boxes) and medians (horizontal lines), whereas violin plots depict the probability density of the data. Feather-derived samples exhibit significantly higher bacterial diversity than mites, whereas no pronounced differences are observed among mite categories. Asterisks denote levels of statistical significance following Bonferroni correction (*p < 0.05; **p < 0.01).

Microbiome structure after removal of Wolbachia

To visualise patterns among low-abundance bacteria, Wolbachia reads were computationally removed and the dataset was renormalised. In ordination analyses of these Wolbachia-depleted communities, mite samples remained tightly clustered and clearly distinct from feather quill controls (Supplementary Figure S6), indicating that the bacterial assemblages detected in S. bipectinatus largely represent an internal microbiome rather than external contamination.

Shannon diversity calculated from Wolbachia-depleted datasets again showed significantly higher diversity in feather samples than in mites, while differences among mite sexes and developmental stages were minimal (Supplementary Figure S7).

Venn-type comparisons further demonstrated that most bacterial taxa detected in mites were shared across host categories, whereas feather quills contained a partially distinct set of taxa (Fig. 5).

Fig. 5.

Shared and unique bacterial taxa across host categories. Venn diagram summarising the number of shared and unique bacterial taxa detected in S. bipectinatus mites and feather quill samples, illustrating substantial overlap among mite categories and partial differentiation from environmental controls (feather quills).

Discussion

Previous studies have demonstrated that quill mites commonly harbor intracellular bacteria, including lineages of Spiroplasma and Wolbachia, which are among the most frequently reported endosymbiotic bacteria in syringophilids^22,12,43.

Although the diversity of these symbionts is increasingly well documented, their functional roles in quill mite biology remain incompletely understood. Pronounced female-biased sex ratios in many quill mite species have prompted hypotheses that endosymbionts may act as reproductive manipulators, as in other mites and insects^44,45. Alternatively, given the nutritionally restricted diet of syringophilids, bacterial mutualists could contribute essential metabolites, a pattern observed in several hematophagous arthropods⁴⁶.

Microbiome structure in S. bipectinatus

By analysing multiple populations of S. bipectinatus collected from red junglefowl (domestic type), and separating specimens by sex and developmental stage, we were able to test whether microbial community composition covaries with host traits and to compare mite-associated assemblages with bacteria present in the feather-quill microhabitat. The mite microbiome differed significantly from that of the surrounding quill environment (p < 0.01), supporting the view that syringophilids maintain a host-filtered and specialised bacterial community rather than passively reflecting environmental exposure. Differences between female and male mites were also detected (p < 0.05), indicating that sex-specific physiology or immune processes may influence bacterial composition. However, these patterns were not driven by Wolbachia, which dominated all samples irrespective of sex or developmental stage.

Phylogenetic position of the Wolbachia strain infecting S. bipectinatus

Multilocus phylogenetic analyses consistently recovered the strain from S. bipectinatus as a deeply divergent and well-supported monophyletic lineage, clearly distinct from all currently recognised supergroups. In the concatenated supermatrix, this lineage was separated from other Wolbachia clades with high branch support, and the absence of detectable recombination in the multilocus alignment further supports the robustness of this reconstruction. Across all analysed samples, only a single 16S rRNA amplicon sequence variant and a single sequence type at each of the remaining loci were detected, indicating that S. bipectinatus harbours a genetically homogeneous Wolbachia strain rather than a mixture of divergent infections.

This distinctiveness is further reinforced by a diagnostic nucleotide substitution in the 16S rRNA gene that generates a unique sequence motif, which may serve as an additional molecular marker for this lineage. Low sequence similarity to previously described Wolbachia strains, together with its consistent detection across host individuals, provides further support for the evolutionary distinctiveness of this symbiont.

Although individual gene trees differed in the precise placement of the S. bipectinatus Wolbachia relative to other arthropod-associated strains, none recovered it within any established supergroup. The ftsZ and fbpA loci yielded topologies most congruent with the concatenated analysis, whereas the remaining markers provided less resolution regarding affinities to other supergroups. Such locus-specific variation is well recognised in Wolbachia phylogenetics and underscores the value of multilocus approaches for resolving deep evolutionary relationships. Notably, some loci (particularly gatB and hcpA) suggested closer relationships with existing supergroups, illustrating the limitations of single-gene phylogenies. These discrepancies are well documented in Wolbachia and other intracellular bacteria and may arise from limited phylogenetic signal, recombination, or gene-specific evolutionary trajectories. In this context, the concatenated multilocus analysis provides a more robust framework for inference, although genome-scale data will ultimately be required to fully resolve the status of this lineage.

Several factors may currently limit fine-scale resolution of the deepest relationships, including relatively short amplicon lengths and incomplete representation of some arthropod hosts in comparative datasets. However, these limitations do not obscure the consistent recovery of the S. bipectinatus strain as a distinct lineage across analyses. We therefore refer to this lineage as ‘lineage Y’, which is likely to represent a previously unrecognised Wolbachia supergroup, while emphasising that expanded taxon sampling and genome-scale data will be required to assess its phylogenetic breadth and long-term stability.

Is Wolbachia an obligate endosymbiont in S. bipectinatus?

Wolbachia was the most abundant bacterium detected in all S. bipectinatus samples, comprising 56–99% of the total microbiome and frequently exceeding 90% of reads. This pattern contrasts sharply with passerine-associated quill mites, in which Wolbachia was absent or present at low abundance¹². The ubiquity and dominance of Wolbachia in S. bipectinatus, together with its genetic uniformity across individuals, are consistent with a highly integrated association maintained by vertical transmission and may reflect long-term host-symbiont coadaptation.

Its phylogenetic distinctiveness and extreme prevalence suggest a potentially important physiological role. It is plausible that in lineages such as S. bipectinatus the association became obligate early in their evolutionary history, whereas facultative infections reported from passerine-associated mites may reflect secondary relaxation of host dependence driven by ecological change or symbiont replacement. Nevertheless, alternative explanations cannot be excluded. Differences in sampling and detection protocols among studies may partly account for contrasting estimates of Wolbachia prevalence, and experimental work will be required to determine whether this symbiont is strictly required for host survival or reproduction.

The pervasive presence of Wolbachia across both sexes and all developmental stages argues against classical reproductive manipulation such as feminisation or male killing. Males were consistently present in all populations examined, and sex ratios, although apparently female-biased, with an average ratio of 1.8:1, were far less skewed than those reported for many other syringophilids, for example 11:1 as in Kethley⁴⁷. A nutritional or physiological role therefore, appears more plausible, given the evolutionary transition of syringophilid mites to obligate ectoparasitism on birds and the metabolic constraints associated with this lifestyle . Support for a long-term vertically transmitted association is further provided by the strict monoinfection pattern observed here, in contrast to multiple Wolbachia lineages reported from other quill mite species¹².

Low-level detection of Wolbachia in feather-quill samples may reflect residual contamination from mite eggs or cuticular bacteria, consistent with experimental studies showing that Wolbachia can persist outside host cells for several days⁴⁸. Taken together, the abundance, ubiquity, genetic uniformity and phylogenetic distinctiveness of Wolbachia in S. bipectinatus strongly suggest a tightly integrated, likely obligate association centred on physiological support rather than reproductive manipulation, although functional genomic or metabolomic data will be required to test this hypothesis directly.

Host associations and evolutionary context

S. bipectinatus parasitises galliform birds, an early diverging neognath lineage, and therefore provides a phylogenetically informative system for investigating the evolution of symbioses in syringophilid mites. Comparative analyses across quill mites from diverse avian hosts and related free-living cheyletids will be essential for determining whether obligate Wolbachia associations arose early in this group or represent lineage-specific innovations.

Symbiont replacement has been documented in other parasitic arthropods, including lice⁴⁹, and the phylogenetic distinctiveness of the S. bipectinatus strain may reflect long-term persistence. However, genomic-scale datasets and dense host sampling are currently lacking for quill mites, and available phylogenetic evidence does not yet permit strong inferences about the frequency of symbiont turnover in this group. Unlike the shallow, comb like topologies characteristic of recent replacement events in lice, the Wolbachia infecting S. bipectinatus forms a deeply divergent and well supported lineage, a pattern more consistent with long term association. Nevertheless, alternative scenarios involving ancient acquisition followed by limited horizontal transfer cannot be excluded without broader comparative sampling across syringophilid mites and their avian hosts.

We therefore treat symbiont replacement in quill mites as an open evolutionary question rather than a demonstrated process. Resolving whether repeated environmental acquisition has shaped symbioses in this group will require genome scale data from multiple mite taxa, formal cophylogenetic tests, and expanded sampling across host lineages.

Other bacteria and potential epidemiological relevance

In addition to Wolbachia, several other bacterial genera previously reported from quill mites were also detected in S. bipectinatus, including Acinetobacter, Lactobacillus, Sphingomonas, Stenotrophomonas, Paracoccus, Pseudomonas and Streptococcus^12,43. Microbiome profiles overlapped substantially among mite categories, whereas feather-quill samples harboured partially distinct assemblages.

Notably, sequences assigned to bacterial genera that include pathogenic members were also recovered. In particular, Arcobacter was consistently detected in both mite bodies and quill samples. This genus is commonly isolated from animal hosts, especially poultry, and is regarded as an emerging zoonotic pathogen associated with foodborne disease^50,51. Arcobacter has been implicated in gastrointestinal illness in humans, with contaminated poultry, red meat, unpasteurised milk and shellfish identified as major transmission routes, and foodborne outbreaks have been documented, including an episode in which 51 of 109 individuals developed symptoms after consumption of contaminated roasted chicken⁵². The occurrence of Arcobacter in both mites and feather quills is therefore consistent with acquisition from the avian host or from the microenvironment within the quill and raises the possibility that mites may contribute to bacterial circulation within bird populations, although direct evidence for vector competence is currently lacking.

Our dataset also included ASVs classified within the Escherichia–Shigella complex. Shigella is a well-known causative agent of shigellosis, a diarrhoeal disease of public health relevance, and transmission in wildlife has been linked to contact with livestock, environmental exposure near agricultural areas or arthropod vectors; parasite-mediated transmission has been proposed in some systems, for example through fleas⁵³. The detection of Escherichia-Shigella sequences in quill mites therefore warrants attention, but species-level identification and functional data are required before any epidemiological inferences can be drawn.

Previous studies have additionally reported Brucella and Bartonella in quill mites¹², both of which can infect birds and mammals and have been implicated in zoonotic spillover events. Together, these findings suggest that quill mites may participate in the circulation of diverse bacterial taxa in avian systems, particularly in dense host populations such as poultry, although their precise role remains unresolved. Importantly, the mere presence of bacterial DNA in mites does not demonstrate vector competence and should be regarded as a starting point for targeted experimental work. Because taxonomic assignments based on short amplicons can be uncertain, confirmation of pathogenic potential will require strain-resolved genomic data, cultivation-based approaches and transmission experiments to assess whether quill mites function as biological or mechanical vectors and to clarify their epidemiological significance.

Conclusion

This study reveals the dominance of a previously unrecognised Wolbachia strain in S. bipectinatus, here described as a highly divergent Wolbachia lineage (lineage Y) likely representing a new supergroup. The strain is consistently present across developmental stages and both sexes, suggesting a potentially obligate association. The microbiome also includes diverse bacterial taxa, including genera with pathogenic members such as Arcobacter. These findings highlight the complexity of quill mite microbial communities and their possible role in pathogen circulation among avian hosts. Together, they provide a foundation for future studies on endosymbiont function, host specificity, and host-parasite coevolution.

Author contributions

Conceptualization, Eliza Glowska-Patyniak, Kamila Ostrowska, Jan Hubert and Artur Trzebny; Data curation, Eliza Glowska-Patyniak and Artur Trzebny; Formal analysis, Eliza Glowska-Patyniak, Artur Trzebny, Amresh Kumar Sharma, Anup Som, Jan Hubert; Funding acquisition, Eliza Glowska-Patyniak, Jan Hubert; Investigation, Eliza Glowska-Patyniak, Kamila Ostrowska, Julia Olechnowicz, Jan Hubert, Miroslawa Dabert and Artur Trzebny; Methodology, Miroslawa Dabert, Kamila Ostrowska, Eliza Glowska-Patyniak, Julia Olechnowicz, Edyta Konecka, Amresh Kumar Sharma, Anup Som and Artur Trzebny; Project administration, Eliza Glowska-Patyniak; Resources, Eliza Glowska-Patyniak; Software, Artur Trzebny, Edyta Konecka, Amresh Kumar Sharma, Anup Som and Eliza Glowska-Patyniak; Supervision, Eliza Glowska-Patyniak; Validation, Eliza Glowska-Patyniak; Visualization, Artur Trzebny, Edyta Konecka, Amresh Kumar Sharma, Anup Som and Eliza Glowska-Patyniak; Writing—original draft, all authors; Writing—review & editing, all authors. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Science Centre, Poland, under Grant No. UMO-2021/03/Y/NZ8/00060.

Data availability

The data supporting this study’s findings are openly available in NCBI under BioProject accession number PRJNA1250786 and are shown in Table 2.

Declarations

Competing interest

The authors declare no competing interests.