Therapeutic efficacy of Jichuan decoction (济川煎) in slow-transit constipation: focus on gut microbiota modulation

Abstract

OBJECTIVE:

To clarify the therapeutic mechanisms of Jichuan decoction (济川煎, JCD) in slow-transit constipation (STC), we focused on its neuromuscular and microbiota-modifying effects.

METHODS:

An STC mouse model was induced by administering diphenoxylate for 14 consecutive days. The experimental groups included healthy controls (HC), a saline-treated STC model group, a mosapride-treated positive control group (MSP), and JCD-treated groups at different dosages. Gastrointestinal motility was evaluated first by black stool latency and then by colonic 5-hydroxytryptamine and substance P levels. Neural markers were assessed by real-time quantitative reverse transcription polymerase chain reaction, and glial-derived neurotrophic factor (GDNF) and central nervous system specific protein β (S100β) levels were measured via enzyme-linked immunosorbent assay. Histopathological analysis was performed via hematoxylin-eosin and periodic acid-Schiff staining. Microbial profiling was conducted via 16S rRNA sequencing.

RESULTS:

JCD treatment improved intestinal motility in STC mice, increased colonic neurotransmitter levels, increased mucosal thickness and goblet cell density, upregulated protein gene product 9.5 and GDNF, downregulated neuronal nitric oxide synthase and S100β, and reversed dysbiosis through the enrichment of Akkermansia muciniphila.

CONCLUSION:

JCD alleviates STC by restoring enteric nervous system function and gut microbiota homeostasis, indicating its potential for STC management.

1. INTRODUCTION

Functional constipation (FC), ranking as the sixth most common gastrointestinal disorder globally, affects approximately 15.3% of the adult population, with its prevalence showing a marked upward trend.^1-4 According to the American Gastroenterological Association, FC is categorized into three distinct subtypes: normal transit constipation, slow-transit constipation (STC) and defecation disorders.⁵ Among these, STC represents the predominant form, constituting approximately 55% of FC cases.⁶ This condition is primarily defined by diminished colonic motility, resulting in prolonged intestinal transit.⁷ The primary therapeutic objectives for STC encompass symptom alleviation, restoration of normal bowel motility, and improvement of defecatory function.⁸

The underlying mechanisms of STC involve complex interactions among gastrointestinal hormones, neurotransmitter imbalances, dysfunction of the enteric nervous system (ENS), and alterations in gut microbial composition.^9,10 Notably, a decline in butyrate-producing bacterial populations has been implicated in constipation pathogenesis, suggesting a critical role of microbial metabolites — particularly those influencing enteric neuronal activity — in disease development.¹¹ Although conventional pharmacological treatments provide temporary symptomatic relief, their long-term effectiveness is often compromised by diminishing efficacy and undesirable side effects.

Emerging research highlights the therapeutic potential of Traditional Chinese Medicine (TCM) in STC management.¹² Jichuan decoction (济川煎, JCD), a classical formulation originating from the Ming Dynasty, exhibits multifaceted therapeutic actions, including accelerated colonic transit, improved anorectal function, neurotransmitter regulation, symptom mitigation, and enhanced quality of life.¹³ Clinical trials have reported minimal adverse effects (e.g., transient dizziness and dry mouth, each occurring in 1.7% of cases) following one month of JCD administration, and these rates did not differ significantly from those in the mosapride-treated control group.

Previous mechanistic investigations by our group demonstrated that JCD ameliorates STC by inhibiting enteric glial apoptosis and promoting neurotrophic factor secretion — key processes in maintaining ENS homeostasis and mediating host-microbiota crosstalk.¹⁴ Nevertheless, the comprehensive therapeutic mechanisms of JCD in STC, particularly its influence on gut microbial ecology, remain incompletely understood. The present study aims to elucidate the potential therapeutic role of JCD in re-establishing a balanced intestinal microbiota in an STC murine model.

2. MATERIALS AND METHODS

2.1. Preparation of JCD

JCD is prepared based on classic prescriptions and in accordance with pre-determined formulas.¹⁵ Briefly, raw herbal materials were immersed in distilled water (1∶10, w/v) for 30 min and extracted three times by boiling. The resulting decoctions were pooled and filtered through sterile gauze; subsequently, the filtered decoctions were concentrated to achieve a final concentration of 0.81 g crude herb equivalent per ml. Aliquots of the prepared JCD were stored at －20 ℃ for subsequent experimental use.

2.2. Animal model establishment and experimental protocol

All the experimental procedures were conducted in compliance with the ethical guidelines approved by the Animal Ethics Committee of Chengdu University of Traditional Chinese Medicine (Approval No. 2016-16). Thirty specific pathogen free-grade C57BL/6J male mice [7 weeks old, mean body weight of (20.2 ± 2.1) g] were procured from Chongqing Evansville Laboratory Animal Co., Ltd. [Chongqing, China; quality certificate number: SCXK (Yu) 2018-0003]. Following a 7-d acclimatization period under controlled conditions [(22 ± 2) ℃, 45%-55% relative humidity, 12-h light/dark cycle], the animals were randomly assigned to six experimental groups by the random number table method (n = 5 per group):

Healthy control (HC) rats received saline (Sichuan Kelun Pharmaceutical Co., Ltd., Chengdu, China). STC Model (STC): Induced with compound diphenoxylate (Changzhou Kangpu Pharmaceutical Co., Ltd., Changzhou, China). Positive control (MSP): Mosapride (Chengdu Kanghong Pharmaceutical Group Co., Ltd., Chengdu, China) (2.5 mg/kg) was administered. JCD treatment groups: Low-dose (JCDL; 3.04 g/kg), Medium dose (JCDM; 6.08 g/kg), and High-dose (JCDH; 12.16 g/kg).

The STC mouse model was induced via daily oral administration of compound diphenoxylate (10 mg·kg^-1;·d^-1;) for 14 consecutive days, while the HC group received equivalent volumes of saline. After the model was established, the mice were fasted for 12 h and subsequently received 0.1 mL/10 g of activated carbon (Shanghai Aladdin Biochemical Technology Co., Ltd., Shanghai, China) via gavage. The time interval from intragastric administration to the excretion of the first black stool, as well as the number and weight of feces excreted within 6 h, were recorded. The data from the blank control group (P < 0.05) confirmed the successful replication of the model. From days 16 to 29, therapeutic interventions were administered as follows: HC and STC groups: Saline (0.1 mL/10 g); MSP group: Mosapride (2.5 mg/kg); JCD groups: JCD doses.

On the basis of the equivalent dose conversion ratio table derived from interspecies body surface area scaling, the high, medium and low JCD doses were set at 20-, 10- and 5-fold the clinical reference dose, respectively. Body weight, food consumption, and water intake were recorded weekly. At the end of the experimental protocol, fecal samples and colon tissues were collected under aseptic conditions, immediately flash-frozen in liquid nitrogen, and stored at －80 ℃ for subsequent analyses.

2.3. Evaluation of intestinal motility

Following a 12-h fasting period, the mice were orally administered an activated carbon suspension (0.1 mL/10 g body weight). The latency to the first expulsion of black-stained feces was meticulously recorded as an indicator of intestinal propulsion efficiency.

2.4. Histopathological examination

Colon tissue samples were fixed in 10% neutral buffered formalin (Fuchen Chemical Reagent Co., Ltd., Tianjin, China), dehydrated through an ascending series of ethanol (Chengdu Haixing Chemical Reagent Factory, Chengdu, China), embedded in paraffin, and cut into 5-μm-thick sections using a Leica rotary microtome (Hesse, Germany).

2.5. Hematoxylin and eosin (HE) staining

The tissue sections were stained using standard protocols and imaged with a high-resolution digital microscope (3DHISTECH, Budapest, Hungary). Morphometric analysis was performed using Image-Pro Plus 6.0 software (Media Cybernetics, Silver Spring, MD, USA).

2.6. Periodic acid-Schiff (PAS) staining

Sections were oxidized with periodic acid, treated with Schiff's reagent (Wuhan Sewell Biotechnology Co., Ltd., Wuhan, China), counterstained with hematoxylin (Wuhan Sewell Biotechnology Co., Ltd., Wuhan, China), and blued with Scott's solution (Wuhan Sewell Biotechnology Co., Ltd., Wuhan, China). Goblet cells were quantified using a 3DHISTECH Panoramic digital slide scanner (Budapest, Hungary).

2.7. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Total RNA was isolated from 150 mg of colonic tissue samples via TRIzol reagent (Hefei Bomei Biotechnology, Hefei, China) following DNase I digestion. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA. Quantitative PCR amplification was conducted using gene-specific primers with the following thermal cycling parameters: initial denaturation at 95 ℃ for 30 s, followed by 45 cycles of denaturation at 95 ℃ for 5 s, annealing at 55 ℃ for 30 s, and extension at 72 ℃ for 30 s. Cycle threshold (Ct) values were determined using PikoReal analysis software (Thermo Fisher Scientific, Waltham, MA, USA). Gene expression levels were quantified via the 2^−ΔΔCt method, with β-actin serving as the endogenous control. The primer sequences used are listed. For β-actin, the forward primer is “GAAGATCAAGATCATTG-CTCC” and the reverse primer is “TACTCCTGCTT-GCTGATCCA”. For neuronal nitric oxide synthase (nNOS), the forward primer is “TCATTTCTGTCC-GTCTCTTCAA” and the reverse primer is “ATCAGA-TCTGAGATGATCACCG”. For protein gene product 9.5 (PGP9.5), the forward primer is “ATAGAGCCA-AGTGTTTCGAGAA” and the reverse primer is “ATTCACTTTGTCATCTACCCGA”.

2.8. Enzyme-linked immunosorbent assay (ELISA)

Commercial ELISA kits were used for the quantitative detection of murine 5-hydroxytryptamine (5-HT, Elabscience, Wuhan, China), substance P (SP; Elabscience, Wuhan, China), central nervous system specific protein β (S100β) (Elabscience, Wuhan, China), and glial cell line-derived neurotrophic factor (GDNF, Shanghai Chuocai Biotechnology, Shanghai, China). Frozen colonic tissue specimens (－80 ℃) were homogenized in phosphate-buffered saline at a 1:9 (w/v) ratio using a mechanical homogenizer. The homogenate was centrifuged at 5000 × g for 10 min at 4 ℃ to obtain the protein supernatant. Protein concentrations were determined prior to performing ELISA according to the manufacturers' standardized protocols.

2.9. 16S Ribosomal RNA Gene Sequencing

Microbial community profiling was conducted through Illumina-based 16S rRNA gene sequencing (Novogene Co., Beijing, China).¹⁶ DNA samples were extracted using a DNA stool kit from MoBio in Beijing, China. The barcode universal primers were used to amplify the V3 and V4 regions of the 16S rRNA gene. The PCR products were purified using a Qiaquick PCR purification kit (QIAGEN, North Rhine-Westphalia, Germany) and sequence by an Illumina Hiseq 2500 platform (Illumina, San Diego, CA, USA). After removal of short sequences (< 200 bpm), sequence data with a similarity of > 97% were clustered into operational taxonomic units (OTUs), followed by using the Silva138 database for species annotation. The bacterial diversity within the samples (alpha diversity) was evaluated by Chao1, while diversity between samples (beta diversity) was analyzed by Unweighted UniFrac index. The relative abundances were compared at the phylum, order, and genus levels, considering a relative abundance threshold of more than 1%.

2.10. Statistical methods

All the statistical computations were executed using GraphPad Prism version 9 (GraphPad Software, CA, USA). Continuous variables are expressed as the mean ± standard deviation ($\overline{x}$± s). Parametric data were analyzed by One-way Analysis of Variance with post hoc testing, whereas nonparametric datasets were evaluated using the Kruskal-Wallis test. Between-group comparisons were performed with Student's t test. A probability value of P < 0.05 was considered to indicate statistical significance for all analyses.

3. RESULTS

3.1. Therapeutic effects of JCD on gastrointestinal motility in STC mice

The administration of JCD to STC mice significantly improved multiple constipation-related parameters. Quantitative assessments revealed normalization of nutritional indices (food/water intake and body weight), fecal characteristics (stool count and hydration status), and intestinal transit function (supplementary Figure 1). Notably, the delay in initial defecation time observed in STC mice relative to that in healthy controls (HC group) was markedly reduced following treatment with varying doses of JCD and MSP (Table 1). Biochemical analyses revealed decreased colonic concentrations of 5-HT and SP in constipated animals, and JCD interventions (particularly at medium and high doses) effectively restored these neurotransmitter levels (Table 1). While JCDL failed to significantly increase 5-HT levels and MSP had a limited effect on SP levels, the overall treatment effects followed a clear dose-response relationship.

Table 1.

JCD improved indices associated with constipation ($\overline{x}$ ± s)

Group	n	First black stool (min)	5-HT (ng/mL)	SP (pg/mL)
HC	5	114.6±15.9	34.99±3.4	78.08±8.8
STC	5	215.6±48.2a	26.93±0.6a	57.65±1.8a
JCDL	5	119.2±16.8b	34.33±3.0	67.66±5.3b
JCDM	5	108.8±10.1b	36.34±2.7b	70.15±6.7b
JCDH	5	104.2±10.8b	37.20±9.2b	70.08±2.6b
MSP	5	157.2±12.4b	34.96±4.2b	73.57±8.6

Notes: HC: healthy control. STC: slow transit constipation model group. JCD: Jichuan decoction. JCDL: low-dose JCD treatment. JCDM: middle-dosage JCD treatment. JCDH: high-dosage JCD treatment. MSP: mosapride treatment. The STC mouse model was induced via daily oral administration of compound diphenoxylate (10 mg·kg^-1;·d^-1;) for 14 consecutive days. From days 16 to 29, therapeutic interventions were administered as follows: HC and STC groups: Saline (0.1 mL/10 g); MSP group: Mosapride (2.5 mg/kg); JCD groups: JCD doses. Statistical analyses were measured using the Kruskal-Wallis test. Compared with the HC group, ^aP < 0.05; compared with the STC group, ^bP < 0.05.

3.2. Histopathological evaluation of the mucosal protective effects of JCD

Histological examination demonstrated that JCD could reverse constipation-induced mucosal atrophy. The medium- and high-dose JCD treatments notably increased the thickness of the intestinal epithelium and normalized the goblet cell population compromised by STC (Table 2, supplementary Figure 2). These restorative effects were dose dependent, suggesting the potential of JCD in mucosal barrier repair.

Table 2.

The pathological changes in the distal colon of STC mice were improved by JCD ($\overline{x}$± s)

Group	n	The thickness of the colon mucosa	The number of goblet cells
HC	5	221±9	199±19
STC	5	119±8a	143±29a
JCDL	5	135±6	157±25
JCDM	5	216±13b	187±18b
JCDH	5	244±72b	195±16b
MSP	5	145±16	185±7b

Notes: HC: healthy control; STC: slow transit constipation model group; JCD: Jichuan decoction; JCDL: low-dose JCD treatment; JCDM: middle-dosage JCD treatment; JCDH: high-dosage JCD treatment; MSP: mosapride treatment. The STC mouse model was induced via daily oral administration of compound diphenoxylate (10 mg·kg^-1;·d^-1;) for 14 consecutive days. From days 16 to 29, therapeutic interventions were administered as follows: HC and STC groups: Saline (0.1 mL/10 g); MSP group: Mosapride (2.5 mg/kg); JCD groups: JCD doses. Statistical analyses were measured using the Kruskal-Wallis test. Compared with the HC group, ^aP < 0.05; compared with the STC group, ^bP < 0.05.

3.3. Neuroprotective effects of JCD on the enteric nervous system

Immunohistochemical analysis revealed significant downregulation of the expression of the neuronal marker PGP9.5 and GDNF in STC mice compared with healthy controls. High-dose JCD administration restored PGP9.5 expression, with lower doses showing progressive improvement trends. Conversely, the elevated expression of nNoS and S100β in constipated animals was attenuated by JCD treatment, particularly at relatively high concentrations (Table 3). The differential regulation of these neural markers indicates the multifaceted neuroprotective mechanism of JCD in STC pathophysiology.

Table 3.

JCD rescued ENS damage by increasing the expression of facilitate markers and inhibiting the expression of detrimental markers in STC mice ($\overline{x}$ ± s)

Group	n	Relative PGP9.5 mRNA level	Relative nNOS mRNA level	GDNF (pg/mL)	S100β (pg/mL)
HC	5	1.01±0.19	1.04±0.33	429.4±27.87	614.1±14.28
STC	5	0.56±0.09a	2.20±0.42a	367.0±20.00a	754.0±49.03a
JCDL	5	0.55±0.08	2.01±0.80	402.1±15.33b	677.4±82.02
JCDM	5	0.65±0.06	1.62±0.29	399.5±14.97b	612.1±80.40b
JCDH	5	0.91±0.25b	1.08±0.33b	418.3±15.14b	614.2±52.10b
MSP	5	0.82±0.07b	1.02±0.41b	411.9±16.04b	641.8±50.99b

Notes: STC: slow transit constipation model group; JCD: Jichuan decoction; JCDL: low-dose JCD treatment; JCDM: middle-dosage JCD treatment; JCDH: high-dosage JCD treatment; MSP: mosapride treatment. The STC mouse model was induced via daily oral administration of compound diphenoxylate (10 mg·kg^-1;·d^-1;) for 14 consecutive days. From days 16 to 29, therapeutic interventions were administered as follows: HC and STC groups: Saline (0.1 mL/10 g); MSP group: Mosapride (2.5 mg/kg); JCD groups: JCD doses. One-way analysis of variance was used for S100β, while the Kruskal-Wallis test was used for the rest. Compared with the HC group, ^aP < 0.05; compared with the STC group, ^bP < 0.05.

3.4. JCD successfully restores the imbalanced intestinal microbiota in STC mice

Rarefaction curve analysis confirmed the adequate sequencing depth, as evidenced by the plateau in species discovery with increasing sequence volume (supplementary Figure 3A). 16S rRNA sequencing yielded 1 522 061 high-quality reads. Venn diagram analysis revealed 677 common OTUs across all the samples, with group-specific OTUs numbering 132 (HC), 122 (STC), and 112 (JCDH) (supplementary Figure 3B). Linear discriminant analysis (LDA) revealed significant microbial biomarkers (supplementary Figure 3C), whereas phylogenetic analysis revealed key species distributions (supplementary Figure 3D). Microbial composition analysis revealed distinct patterns: Verrucomicrobiota and Akkermansia predominated in healthy controls, whereas Proteobacteria and Herbaspirillum were characteristic of JCDH-treated animals. STC mice presented elevated populations of Bacteroidota and Enterococcus. Notably, the microbiota profile of the JCDH group closely resembled that of the healthy controls, in contrast to that of the STC samples.

Hierarchical clustering analysis further confirmed greater similarity between the HC and JCDH groups than the STC group (supplementary Figure 4A). Taxonomic evaluation revealed significant microbiota alterations at both the phylum and genus levels across groups (supplementary Figure 4A). In STC mice, the Verrucomicrobiota population was reduced (supplementary Figure 4B), and JCDH treatment effectively reversed this change (supplementary Figure 4C). Similarly, the abundance of Akkermansia (AKK), which was markedly reduced in the STC (supplementary Figure 4E), was restored to normal levels following JCDH treatment (supplementary Figure 4F). These findings demonstrate the ability of JCD to restore STC-induced microbial imbalances and establish a healthy gut microbiota profile.

4. DISCUSSION

JCD has been established as an effective formulation for treating STC, particularly in patients who present with Kidney Yang deficiency syndrome according to TCM diagnostic criteria; however, its precise pharmacological mechanisms remain to be fully elucidated.¹³ In this investigation, we systematically examined the therapeutic effects of JCD at three different dosage levels, with a particular emphasis on evaluating the optimal efficacy of high-dose administration. Given the holistic nature of both systems biology and TCM approaches, we employed an integrated methodology combining gut microbiome analysis with molecular biology techniques to elucidate the mechanism underlying the therapeutic effects of JCD on STC.¹⁷

4.1. JCD significantly increased the major defecation index in STC mice.

Our experimental results demonstrated that JCD administration significantly improved key defecation parameters in STC model mice. Clinically, constipation manifests as decreased intestinal motility, hardened fecal matter, and impaired bowel movements.^18,19 The results of the current study revealed that JCD intervention led to substantial enhancement across all the measured physiological parameters. An STC animal model was successfully established via oral administration of diphenoxylate, a well-characterized antidiarrheal agent. Our findings indicate that JCD treatment effectively normalized several pathological markers in constipated mice, including a significant reduction in the time to first black stool defecation and the restoration of colonic 5-HT and SP levels to physiological ranges. Following a 14-d treatment regimen, all primary outcome measures significantly improved, confirming both successful model establishment and therapeutic efficacy.^20,21

Histopathological examination further revealed that JCD treatment substantially ameliorated colonic tissue abnormalities in STC mice, particularly through the restoration of mucosal architecture and goblet cell populations. Research utilizing leptin-deficient mice generated through CRISPR-Cas9 gene-editing technology has revealed similar constipation phenotypes, including impaired gastrointestinal motility, mucosal thinning, and reduced mucin secretion capacity.²² These observations align with reports showing that interventions such as carmine asparagus extract can be used.²³ Probiotic-enriched chocolate products and the TCM formulation Tiantian capsule (天天胶囊) effectively counteract loperamide-induced constipation while simultaneously improving mucosal integrity and the number of goblet cells.^24,25 Our current data corroborate these earlier findings, supporting the consistent association between constipation resolution and normalization of intestinal mucosal parameters across multiple experimental models and therapeutic approaches.

4.2. JCD Recovered ENS damage in STC mice

Notably, ENS integrity markedly improved following JCD treatment. The intervention demonstrated a dual regulatory effect, enhancing PGP9.5 and GDNF expression while suppressing nNOS and S100β levels, thereby promoting ENS functional restoration in STC murine models.

Previous studies have shown that surgical interventions can decrease the number of PGP9.5-positive neurons and impair the regulation of nNOS expression in constipation models. Interestingly, sacral nerve stimulation has been shown to counteract these effects while simultaneously activating the GDNF-PI3K/Akt pathway to increase colonic GDNF and phosphorylated AKT expression.²⁶ Similar neuromodulatory effects were observed with electroacupuncture therapy, which upregulated PGP9.5 and choline acetyltransferase while downregulating nNOS in constipated subjects.²⁶

Recent investigations have revealed that microbial interventions, such as latilactobacillus sakei Furu2019 combined with stachyose, ameliorate symptoms of constipation through the modulation of the GDNF and NOS pathways.²⁷ Conversely, prolonged oxalacetate administration was associated with reduced numbers of glial fibrillary acidic protein-positive enteric glial cells and PGP9.5+ neurons, accompanied by increased numbers of S100β-immunoreactive enteric glial cells.²⁸

The coordinated improvement of these four biomarkers strongly suggests their functional interdependence within the ENS network, providing compelling evidence for the therapeutic efficacy of JCD in STC management. The consistent directional changes across multiple independent studies further validated these molecular markers as robust indicators of ENS functional status.

4.3. The dysbiotic gut microbiota in STC mice was significantly restored by JCD

The dysbiotic gut microbiota represents a hallmark characteristic of STC, as impaired intestinal motility significantly disrupted the colonic microenvironment in both clinical cases and experimental models. Our 16S rRNA sequencing data demonstrated profound microbial dysbiosis in STC mice, and this dysbiosis was substantially ameliorated following JCD treatment. Comprehensive taxonomic analysis revealed systemic disturbances spanning multiple hierarchical levels from phylum to species classifications. The detection of diagnostic microbial markers and evolutionarily significant species further validated the intestinal microbial imbalance in STC mice, with all three JCD dosage regimens exhibiting restorative effects.

Notably, a significant reduction in AKK abundance was observed following diphenoxylate-induced constipation, which was subsequently reversed by JCD administration. As the sole representative of the Verrucomicrobia phylum, AKK typically constitutes 1%-5% of the gut microbiota.²⁹ This emerging probiotic candidate possesses unique mucin-degrading capabilities and utilizes mucin as its primary carbon, nitrogen, and energy source.²⁹ Substantial evidence links elevated AKK levels with improved metabolic and inflammatory conditions through its multifaceted roles in maintaining epithelial barrier function, modulating energy metabolism, and enhancing butyrate production.^29-35 Our results support the hypothesis that AKK contributes to STC alleviation by restoring mucosal layer integrity, increasing goblet cell populations, upregulating the expression of tight junction proteins (including occludin, claudin, and zonula occludens-1), and suppressing inflammatory responses.^36-38

Currently, relatively few direct studies on JCD and AKK exist. However, the interaction between them can be inferred to be based on the components of JCD and the physiological characteristics of AKK. The polysaccharides and phenylethanol glycosides (such as echinoside and vermiculin) in Cistanche have prebiotic effects that promote the growth of AKK.³⁹ These properties indicate that JCD directly promotes the growth of key beneficial bacteria, thereby enabling rapid stool excretion, preventing dryness, and achieving the effects of moistening dryness, lubricating the intestines, tonifying the kidney and strengthening Yang. Danggui (Radix Angelicae Sinensis) contains polysaccharides and ferulic acid, whereas Niuxi (Radix Achyranthis Bidentatae) contains polysaccharides and saponins. Polysaccharides increase the efficacy of the main ingredients, and ferulic acid has anti-inflammatory and microbiota regulatory effects, which may indirectly support the colonization of AKK by improving the intestinal microenvironment.^40,41 Saponins can alleviate intestinal inflammation and promote the proliferation of AKK through anti-inflammatory and immun-omodulatory effects.^42,43 These two drugs, as adjuvant drugs, further complement the principal drug to enhance its therapeutic effect. Zexie (Rhizoma Alismatis), as an adjuvant, promotes diuresis and removes dampness while preventing Cistanche from being overly warm and nourishing, embodying the idea of “combining unblocking and tonifying". Zhiqiao (Fructus Aurantii Submaturus) promotes the circulation of Qi and widens the intestines, facilitating the smooth flow of Qi in intestinal organs and assisting in defecation. It is used as an adjuvant medicine. Shengma (Rhizoma Cimicifugae Foetidae) slightly promotes and increases Yang, and when combined with Niuxi (Radix Achyranthis Bidentatae), it produces an “ascending and descending” effect to regulate the flow of Qi and restore the transmission function of the large intestine. Shengma (Rhizoma Cimicifugae Foetidae) not only guides medicine directly to the spleen, stomach and large intestine but also assists medicine. Within a certain range, polysaccharides and phenylethanol glycosides exert prebiotic effects, and ferulic acid and saponins exert anti-inflammatory and intestinal regulatory effects; these effects increase with increasing concentration. Therefore, the high-dose group had the greatest effect on all the indicators.

This investigation employed an integrated approach combining microbial profiling with molecular biology techniques to elucidate the therapeutic potential of JCD against STC, with a particular emphasis on the high-dose JCD group. Future research should focus on deciphering the intricate interactions among JCD, the gut microbiota, and host physiology to elucidate the mechanism underlying the efficacy of JCD in STC management.

In conclusion, the results of the present study demonstrated that therapeutic interventions targeting ENS repair and intestinal microbial symbiosis restoration may represent the primary pharmacological mechanisms underlying the efficacy of JCD in STC management. Further systematic investigations are warranted to facilitate the clinical translation of JCD-based therapeutic strategies.

5. ACKNOWLEDGEMENTS

The authors would like to acknowledge YAO Zhenghong (Novogene, Sales Department, Beijing, Master of Agriculture), for skillful technical assistance.

6. SUPPORTING INFORMATION

Supporting data to this article can be found online at http://www.journaltcm.com.

Funding Statement

Supported by the National Natural Science Foundation of China: Exploring the Mechanism of Qi-tonifying and Phlegm-eliminating Acupuncture Promoting Intestinal Nerve Precursor Cell Regeneration in Obese Mice Based on the Single-cell RNA-sep Platform (No. 82374176); the Natural Science Foundation of Sichuan Province: Discovery of "Active Center" Oligosaccharide Fragments in Polysaccharides of Pinellia Ternata and Its Processed Products and Research on Quality Evaluation Techniques and Methods (2022NSFSC0591); the Youth Nursery Project of Sichuan Provincial Health Commission: Mechanism Research on miR-491-5p Targeting Akt to Inhibit Intestinal Nerve Apoptosis in the Pathogenesis of Slow Transit Constipation (24QNMP030); General Project of Sichuan Provincial Administration of Traditional Chinese Medicine: Exploring the Mechanism of Jichuan Decoction in Regulating Intestinal nerve Apoptosis in Slow Transit Constipation Rats Based on the Tumor Necrosis Factor Signaling Pathway (2024MS589); the Project of Sichuan Medical Association: Exploring the Mechanism of Jichuan Decoction in Regulating Intestinal Nerve Apoptosis in Slow Transit Constipation Rats Based on the Glial Cell line-derived Neurotrophic Factor/Phosphoinositide 3-kinase/Protein Kinase B Signaling Pathway (S23034)