Abstract
OBJECTIVE:
To clarify the therapeutic mechanisms of Jichuan decoction (济川煎, JCD) in slow-transit constipation (STC), we focused on its neuromuscular and microbiota-modifying effects.
METHODS:
An STC mouse model was induced by administering diphenoxylate for 14 consecutive days. The experimental groups included healthy controls (HC), a saline-treated STC model group, a mosapride-treated positive control group (MSP), and JCD-treated groups at different dosages. Gastrointestinal motility was evaluated first by black stool latency and then by colonic 5-hydroxytryptamine and substance P levels. Neural markers were assessed by real-time quantitative reverse transcription polymerase chain reaction, and glial-derived neurotrophic factor (GDNF) and central nervous system specific protein β (S100β) levels were measured via enzyme-linked immunosorbent assay. Histopathological analysis was performed via hematoxylin-eosin and periodic acid-Schiff staining. Microbial profiling was conducted via 16S rRNA sequencing.
RESULTS:
JCD treatment improved intestinal motility in STC mice, increased colonic neurotransmitter levels, increased mucosal thickness and goblet cell density, upregulated protein gene product 9.5 and GDNF, downregulated neuronal nitric oxide synthase and S100β, and reversed dysbiosis through the enrichment of Akkermansia muciniphila.
CONCLUSION:
JCD alleviates STC by restoring enteric nervous system function and gut microbiota homeostasis, indicating its potential for STC management.
Keywords: slow-transit constipation, enteric nervous system, intestinal microbiota, Akkermansia muciniphila, Jichuan decoction
1. INTRODUCTION
Functional constipation (FC), ranking as the sixth most common gastrointestinal disorder globally, affects approximately 15.3% of the adult population, with its prevalence showing a marked upward trend.1-4 According to the American Gastroenterological Association, FC is categorized into three distinct subtypes: normal transit constipation, slow-transit constipation (STC) and defecation disorders.5 Among these, STC represents the predominant form, constituting approximately 55% of FC cases.6 This condition is primarily defined by diminished colonic motility, resulting in prolonged intestinal transit.7 The primary therapeutic objectives for STC encompass symptom alleviation, restoration of normal bowel motility, and improvement of defecatory function.8
The underlying mechanisms of STC involve complex interactions among gastrointestinal hormones, neurotransmitter imbalances, dysfunction of the enteric nervous system (ENS), and alterations in gut microbial composition.9,10 Notably, a decline in butyrate-producing bacterial populations has been implicated in constipation pathogenesis, suggesting a critical role of microbial metabolites — particularly those influencing enteric neuronal activity — in disease development.11 Although conventional pharmacological treatments provide temporary symptomatic relief, their long-term effectiveness is often compromised by diminishing efficacy and undesirable side effects.
Emerging research highlights the therapeutic potential of Traditional Chinese Medicine (TCM) in STC management.12 Jichuan decoction (济川煎, JCD), a classical formulation originating from the Ming Dynasty, exhibits multifaceted therapeutic actions, including accelerated colonic transit, improved anorectal function, neurotransmitter regulation, symptom mitigation, and enhanced quality of life.13 Clinical trials have reported minimal adverse effects (e.g., transient dizziness and dry mouth, each occurring in 1.7% of cases) following one month of JCD administration, and these rates did not differ significantly from those in the mosapride-treated control group.
Previous mechanistic investigations by our group demonstrated that JCD ameliorates STC by inhibiting enteric glial apoptosis and promoting neurotrophic factor secretion — key processes in maintaining ENS homeostasis and mediating host-microbiota crosstalk.14 Nevertheless, the comprehensive therapeutic mechanisms of JCD in STC, particularly its influence on gut microbial ecology, remain incompletely understood. The present study aims to elucidate the potential therapeutic role of JCD in re-establishing a balanced intestinal microbiota in an STC murine model.
2. MATERIALS AND METHODS
2.1. Preparation of JCD
JCD is prepared based on classic prescriptions and in accordance with pre-determined formulas.15 Briefly, raw herbal materials were immersed in distilled water (1∶10, w/v) for 30 min and extracted three times by boiling. The resulting decoctions were pooled and filtered through sterile gauze; subsequently, the filtered decoctions were concentrated to achieve a final concentration of 0.81 g crude herb equivalent per ml. Aliquots of the prepared JCD were stored at -20 ℃ for subsequent experimental use.
2.2. Animal model establishment and experimental protocol
All the experimental procedures were conducted in compliance with the ethical guidelines approved by the Animal Ethics Committee of Chengdu University of Traditional Chinese Medicine (Approval No. 2016-16). Thirty specific pathogen free-grade C57BL/6J male mice [7 weeks old, mean body weight of (20.2 ± 2.1) g] were procured from Chongqing Evansville Laboratory Animal Co., Ltd. [Chongqing, China; quality certificate number: SCXK (Yu) 2018-0003]. Following a 7-d acclimatization period under controlled conditions [(22 ± 2) ℃, 45%-55% relative humidity, 12-h light/dark cycle], the animals were randomly assigned to six experimental groups by the random number table method (n = 5 per group):
Healthy control (HC) rats received saline (Sichuan Kelun Pharmaceutical Co., Ltd., Chengdu, China). STC Model (STC): Induced with compound diphenoxylate (Changzhou Kangpu Pharmaceutical Co., Ltd., Changzhou, China). Positive control (MSP): Mosapride (Chengdu Kanghong Pharmaceutical Group Co., Ltd., Chengdu, China) (2.5 mg/kg) was administered. JCD treatment groups: Low-dose (JCDL; 3.04 g/kg), Medium dose (JCDM; 6.08 g/kg), and High-dose (JCDH; 12.16 g/kg).
The STC mouse model was induced via daily oral administration of compound diphenoxylate (10 mg·kg-1;·d-1;) for 14 consecutive days, while the HC group received equivalent volumes of saline. After the model was established, the mice were fasted for 12 h and subsequently received 0.1 mL/10 g of activated carbon (Shanghai Aladdin Biochemical Technology Co., Ltd., Shanghai, China) via gavage. The time interval from intragastric administration to the excretion of the first black stool, as well as the number and weight of feces excreted within 6 h, were recorded. The data from the blank control group (P < 0.05) confirmed the successful replication of the model. From days 16 to 29, therapeutic interventions were administered as follows: HC and STC groups: Saline (0.1 mL/10 g); MSP group: Mosapride (2.5 mg/kg); JCD groups: JCD doses.
On the basis of the equivalent dose conversion ratio table derived from interspecies body surface area scaling, the high, medium and low JCD doses were set at 20-, 10- and 5-fold the clinical reference dose, respectively. Body weight, food consumption, and water intake were recorded weekly. At the end of the experimental protocol, fecal samples and colon tissues were collected under aseptic conditions, immediately flash-frozen in liquid nitrogen, and stored at -80 ℃ for subsequent analyses.
2.3. Evaluation of intestinal motility
Following a 12-h fasting period, the mice were orally administered an activated carbon suspension (0.1 mL/10 g body weight). The latency to the first expulsion of black-stained feces was meticulously recorded as an indicator of intestinal propulsion efficiency.
2.4. Histopathological examination
Colon tissue samples were fixed in 10% neutral buffered formalin (Fuchen Chemical Reagent Co., Ltd., Tianjin, China), dehydrated through an ascending series of ethanol (Chengdu Haixing Chemical Reagent Factory, Chengdu, China), embedded in paraffin, and cut into 5-μm-thick sections using a Leica rotary microtome (Hesse, Germany).
2.5. Hematoxylin and eosin (HE) staining
The tissue sections were stained using standard protocols and imaged with a high-resolution digital microscope (3DHISTECH, Budapest, Hungary). Morphometric analysis was performed using Image-Pro Plus 6.0 software (Media Cybernetics, Silver Spring, MD, USA).
2.6. Periodic acid-Schiff (PAS) staining
Sections were oxidized with periodic acid, treated with Schiff's reagent (Wuhan Sewell Biotechnology Co., Ltd., Wuhan, China), counterstained with hematoxylin (Wuhan Sewell Biotechnology Co., Ltd., Wuhan, China), and blued with Scott's solution (Wuhan Sewell Biotechnology Co., Ltd., Wuhan, China). Goblet cells were quantified using a 3DHISTECH Panoramic digital slide scanner (Budapest, Hungary).
2.7. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)
Total RNA was isolated from 150 mg of colonic tissue samples via TRIzol reagent (Hefei Bomei Biotechnology, Hefei, China) following DNase I digestion. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA. Quantitative PCR amplification was conducted using gene-specific primers with the following thermal cycling parameters: initial denaturation at 95 ℃ for 30 s, followed by 45 cycles of denaturation at 95 ℃ for 5 s, annealing at 55 ℃ for 30 s, and extension at 72 ℃ for 30 s. Cycle threshold (Ct) values were determined using PikoReal analysis software (Thermo Fisher Scientific, Waltham, MA, USA). Gene expression levels were quantified via the 2−ΔΔCt method, with β-actin serving as the endogenous control. The primer sequences used are listed. For β-actin, the forward primer is “GAAGATCAAGATCATTG-CTCC” and the reverse primer is “TACTCCTGCTT-GCTGATCCA”. For neuronal nitric oxide synthase (nNOS), the forward primer is “TCATTTCTGTCC-GTCTCTTCAA” and the reverse primer is “ATCAGA-TCTGAGATGATCACCG”. For protein gene product 9.5 (PGP9.5), the forward primer is “ATAGAGCCA-AGTGTTTCGAGAA” and the reverse primer is “ATTCACTTTGTCATCTACCCGA”.
2.8. Enzyme-linked immunosorbent assay (ELISA)
Commercial ELISA kits were used for the quantitative detection of murine 5-hydroxytryptamine (5-HT, Elabscience, Wuhan, China), substance P (SP; Elabscience, Wuhan, China), central nervous system specific protein β (S100β) (Elabscience, Wuhan, China), and glial cell line-derived neurotrophic factor (GDNF, Shanghai Chuocai Biotechnology, Shanghai, China). Frozen colonic tissue specimens (-80 ℃) were homogenized in phosphate-buffered saline at a 1:9 (w/v) ratio using a mechanical homogenizer. The homogenate was centrifuged at 5000 × g for 10 min at 4 ℃ to obtain the protein supernatant. Protein concentrations were determined prior to performing ELISA according to the manufacturers' standardized protocols.
2.9. 16S Ribosomal RNA Gene Sequencing
Microbial community profiling was conducted through Illumina-based 16S rRNA gene sequencing (Novogene Co., Beijing, China).16 DNA samples were extracted using a DNA stool kit from MoBio in Beijing, China. The barcode universal primers were used to amplify the V3 and V4 regions of the 16S rRNA gene. The PCR products were purified using a Qiaquick PCR purification kit (QIAGEN, North Rhine-Westphalia, Germany) and sequence by an Illumina Hiseq 2500 platform (Illumina, San Diego, CA, USA). After removal of short sequences (< 200 bpm), sequence data with a similarity of > 97% were clustered into operational taxonomic units (OTUs), followed by using the Silva138 database for species annotation. The bacterial diversity within the samples (alpha diversity) was evaluated by Chao1, while diversity between samples (beta diversity) was analyzed by Unweighted UniFrac index. The relative abundances were compared at the phylum, order, and genus levels, considering a relative abundance threshold of more than 1%.
2.10. Statistical methods
All the statistical computations were executed using GraphPad Prism version 9 (GraphPad Software, CA, USA). Continuous variables are expressed as the mean ± standard deviation (± s). Parametric data were analyzed by One-way Analysis of Variance with post hoc testing, whereas nonparametric datasets were evaluated using the Kruskal-Wallis test. Between-group comparisons were performed with Student's t test. A probability value of P < 0.05 was considered to indicate statistical significance for all analyses.
3. RESULTS
3.1. Therapeutic effects of JCD on gastrointestinal motility in STC mice
The administration of JCD to STC mice significantly improved multiple constipation-related parameters. Quantitative assessments revealed normalization of nutritional indices (food/water intake and body weight), fecal characteristics (stool count and hydration status), and intestinal transit function (supplementary Figure 1). Notably, the delay in initial defecation time observed in STC mice relative to that in healthy controls (HC group) was markedly reduced following treatment with varying doses of JCD and MSP (Table 1). Biochemical analyses revealed decreased colonic concentrations of 5-HT and SP in constipated animals, and JCD interventions (particularly at medium and high doses) effectively restored these neurotransmitter levels (Table 1). While JCDL failed to significantly increase 5-HT levels and MSP had a limited effect on SP levels, the overall treatment effects followed a clear dose-response relationship.
Table 1.
JCD improved indices associated with constipation ( ± s)
| Group | n | First black stool (min) | 5-HT (ng/mL) | SP (pg/mL) |
|---|---|---|---|---|
| HC | 5 | 114.6±15.9 | 34.99±3.4 | 78.08±8.8 |
| STC | 5 | 215.6±48.2a | 26.93±0.6a | 57.65±1.8a |
| JCDL | 5 | 119.2±16.8b | 34.33±3.0 | 67.66±5.3b |
| JCDM | 5 | 108.8±10.1b | 36.34±2.7b | 70.15±6.7b |
| JCDH | 5 | 104.2±10.8b | 37.20±9.2b | 70.08±2.6b |
| MSP | 5 | 157.2±12.4b | 34.96±4.2b | 73.57±8.6 |
Notes: HC: healthy control. STC: slow transit constipation model group. JCD: Jichuan decoction. JCDL: low-dose JCD treatment. JCDM: middle-dosage JCD treatment. JCDH: high-dosage JCD treatment. MSP: mosapride treatment. The STC mouse model was induced via daily oral administration of compound diphenoxylate (10 mg·kg-1;·d-1;) for 14 consecutive days. From days 16 to 29, therapeutic interventions were administered as follows: HC and STC groups: Saline (0.1 mL/10 g); MSP group: Mosapride (2.5 mg/kg); JCD groups: JCD doses. Statistical analyses were measured using the Kruskal-Wallis test. Compared with the HC group, aP < 0.05; compared with the STC group, bP < 0.05.
3.2. Histopathological evaluation of the mucosal protective effects of JCD
Histological examination demonstrated that JCD could reverse constipation-induced mucosal atrophy. The medium- and high-dose JCD treatments notably increased the thickness of the intestinal epithelium and normalized the goblet cell population compromised by STC (Table 2, supplementary Figure 2). These restorative effects were dose dependent, suggesting the potential of JCD in mucosal barrier repair.
Table 2.
The pathological changes in the distal colon of STC mice were improved by JCD (± s)
| Group | n | The thickness of the colon mucosa | The number of goblet cells |
|---|---|---|---|
| HC | 5 | 221±9 | 199±19 |
| STC | 5 | 119±8a | 143±29a |
| JCDL | 5 | 135±6 | 157±25 |
| JCDM | 5 | 216±13b | 187±18b |
| JCDH | 5 | 244±72b | 195±16b |
| MSP | 5 | 145±16 | 185±7b |
Notes: HC: healthy control; STC: slow transit constipation model group; JCD: Jichuan decoction; JCDL: low-dose JCD treatment; JCDM: middle-dosage JCD treatment; JCDH: high-dosage JCD treatment; MSP: mosapride treatment. The STC mouse model was induced via daily oral administration of compound diphenoxylate (10 mg·kg-1;·d-1;) for 14 consecutive days. From days 16 to 29, therapeutic interventions were administered as follows: HC and STC groups: Saline (0.1 mL/10 g); MSP group: Mosapride (2.5 mg/kg); JCD groups: JCD doses. Statistical analyses were measured using the Kruskal-Wallis test. Compared with the HC group, aP < 0.05; compared with the STC group, bP < 0.05.
3.3. Neuroprotective effects of JCD on the enteric nervous system
Immunohistochemical analysis revealed significant downregulation of the expression of the neuronal marker PGP9.5 and GDNF in STC mice compared with healthy controls. High-dose JCD administration restored PGP9.5 expression, with lower doses showing progressive improvement trends. Conversely, the elevated expression of nNoS and S100β in constipated animals was attenuated by JCD treatment, particularly at relatively high concentrations (Table 3). The differential regulation of these neural markers indicates the multifaceted neuroprotective mechanism of JCD in STC pathophysiology.
Table 3.
JCD rescued ENS damage by increasing the expression of facilitate markers and inhibiting the expression of detrimental markers in STC mice ( ± s)
| Group | n | Relative PGP9.5 mRNA level | Relative nNOS mRNA level | GDNF (pg/mL) | S100β (pg/mL) |
|---|---|---|---|---|---|
| HC | 5 | 1.01±0.19 | 1.04±0.33 | 429.4±27.87 | 614.1±14.28 |
| STC | 5 | 0.56±0.09a | 2.20±0.42a | 367.0±20.00a | 754.0±49.03a |
| JCDL | 5 | 0.55±0.08 | 2.01±0.80 | 402.1±15.33b | 677.4±82.02 |
| JCDM | 5 | 0.65±0.06 | 1.62±0.29 | 399.5±14.97b | 612.1±80.40b |
| JCDH | 5 | 0.91±0.25b | 1.08±0.33b | 418.3±15.14b | 614.2±52.10b |
| MSP | 5 | 0.82±0.07b | 1.02±0.41b | 411.9±16.04b | 641.8±50.99b |
Notes: STC: slow transit constipation model group; JCD: Jichuan decoction; JCDL: low-dose JCD treatment; JCDM: middle-dosage JCD treatment; JCDH: high-dosage JCD treatment; MSP: mosapride treatment. The STC mouse model was induced via daily oral administration of compound diphenoxylate (10 mg·kg-1;·d-1;) for 14 consecutive days. From days 16 to 29, therapeutic interventions were administered as follows: HC and STC groups: Saline (0.1 mL/10 g); MSP group: Mosapride (2.5 mg/kg); JCD groups: JCD doses. One-way analysis of variance was used for S100β, while the Kruskal-Wallis test was used for the rest. Compared with the HC group, aP < 0.05; compared with the STC group, bP < 0.05.
3.4. JCD successfully restores the imbalanced intestinal microbiota in STC mice
Rarefaction curve analysis confirmed the adequate sequencing depth, as evidenced by the plateau in species discovery with increasing sequence volume (supplementary Figure 3A). 16S rRNA sequencing yielded 1 522 061 high-quality reads. Venn diagram analysis revealed 677 common OTUs across all the samples, with group-specific OTUs numbering 132 (HC), 122 (STC), and 112 (JCDH) (supplementary Figure 3B). Linear discriminant analysis (LDA) revealed significant microbial biomarkers (supplementary Figure 3C), whereas phylogenetic analysis revealed key species distributions (supplementary Figure 3D). Microbial composition analysis revealed distinct patterns: Verrucomicrobiota and Akkermansia predominated in healthy controls, whereas Proteobacteria and Herbaspirillum were characteristic of JCDH-treated animals. STC mice presented elevated populations of Bacteroidota and Enterococcus. Notably, the microbiota profile of the JCDH group closely resembled that of the healthy controls, in contrast to that of the STC samples.
Hierarchical clustering analysis further confirmed greater similarity between the HC and JCDH groups than the STC group (supplementary Figure 4A). Taxonomic evaluation revealed significant microbiota alterations at both the phylum and genus levels across groups (supplementary Figure 4A). In STC mice, the Verrucomicrobiota population was reduced (supplementary Figure 4B), and JCDH treatment effectively reversed this change (supplementary Figure 4C). Similarly, the abundance of Akkermansia (AKK), which was markedly reduced in the STC (supplementary Figure 4E), was restored to normal levels following JCDH treatment (supplementary Figure 4F). These findings demonstrate the ability of JCD to restore STC-induced microbial imbalances and establish a healthy gut microbiota profile.
4. DISCUSSION
JCD has been established as an effective formulation for treating STC, particularly in patients who present with Kidney Yang deficiency syndrome according to TCM diagnostic criteria; however, its precise pharmacological mechanisms remain to be fully elucidated.13 In this investigation, we systematically examined the therapeutic effects of JCD at three different dosage levels, with a particular emphasis on evaluating the optimal efficacy of high-dose administration. Given the holistic nature of both systems biology and TCM approaches, we employed an integrated methodology combining gut microbiome analysis with molecular biology techniques to elucidate the mechanism underlying the therapeutic effects of JCD on STC.17
4.1. JCD significantly increased the major defecation index in STC mice.
Our experimental results demonstrated that JCD administration significantly improved key defecation parameters in STC model mice. Clinically, constipation manifests as decreased intestinal motility, hardened fecal matter, and impaired bowel movements.18,19 The results of the current study revealed that JCD intervention led to substantial enhancement across all the measured physiological parameters. An STC animal model was successfully established via oral administration of diphenoxylate, a well-characterized antidiarrheal agent. Our findings indicate that JCD treatment effectively normalized several pathological markers in constipated mice, including a significant reduction in the time to first black stool defecation and the restoration of colonic 5-HT and SP levels to physiological ranges. Following a 14-d treatment regimen, all primary outcome measures significantly improved, confirming both successful model establishment and therapeutic efficacy.20,21
Histopathological examination further revealed that JCD treatment substantially ameliorated colonic tissue abnormalities in STC mice, particularly through the restoration of mucosal architecture and goblet cell populations. Research utilizing leptin-deficient mice generated through CRISPR-Cas9 gene-editing technology has revealed similar constipation phenotypes, including impaired gastrointestinal motility, mucosal thinning, and reduced mucin secretion capacity.22 These observations align with reports showing that interventions such as carmine asparagus extract can be used.23 Probiotic-enriched chocolate products and the TCM formulation Tiantian capsule (天天胶囊) effectively counteract loperamide-induced constipation while simultaneously improving mucosal integrity and the number of goblet cells.24,25 Our current data corroborate these earlier findings, supporting the consistent association between constipation resolution and normalization of intestinal mucosal parameters across multiple experimental models and therapeutic approaches.
4.2. JCD Recovered ENS damage in STC mice
Notably, ENS integrity markedly improved following JCD treatment. The intervention demonstrated a dual regulatory effect, enhancing PGP9.5 and GDNF expression while suppressing nNOS and S100β levels, thereby promoting ENS functional restoration in STC murine models.
Previous studies have shown that surgical interventions can decrease the number of PGP9.5-positive neurons and impair the regulation of nNOS expression in constipation models. Interestingly, sacral nerve stimulation has been shown to counteract these effects while simultaneously activating the GDNF-PI3K/Akt pathway to increase colonic GDNF and phosphorylated AKT expression.26 Similar neuromodulatory effects were observed with electroacupuncture therapy, which upregulated PGP9.5 and choline acetyltransferase while downregulating nNOS in constipated subjects.26
Recent investigations have revealed that microbial interventions, such as latilactobacillus sakei Furu2019 combined with stachyose, ameliorate symptoms of constipation through the modulation of the GDNF and NOS pathways.27 Conversely, prolonged oxalacetate administration was associated with reduced numbers of glial fibrillary acidic protein-positive enteric glial cells and PGP9.5+ neurons, accompanied by increased numbers of S100β-immunoreactive enteric glial cells.28
The coordinated improvement of these four biomarkers strongly suggests their functional interdependence within the ENS network, providing compelling evidence for the therapeutic efficacy of JCD in STC management. The consistent directional changes across multiple independent studies further validated these molecular markers as robust indicators of ENS functional status.
4.3. The dysbiotic gut microbiota in STC mice was significantly restored by JCD
The dysbiotic gut microbiota represents a hallmark characteristic of STC, as impaired intestinal motility significantly disrupted the colonic microenvironment in both clinical cases and experimental models. Our 16S rRNA sequencing data demonstrated profound microbial dysbiosis in STC mice, and this dysbiosis was substantially ameliorated following JCD treatment. Comprehensive taxonomic analysis revealed systemic disturbances spanning multiple hierarchical levels from phylum to species classifications. The detection of diagnostic microbial markers and evolutionarily significant species further validated the intestinal microbial imbalance in STC mice, with all three JCD dosage regimens exhibiting restorative effects.
Notably, a significant reduction in AKK abundance was observed following diphenoxylate-induced constipation, which was subsequently reversed by JCD administration. As the sole representative of the Verrucomicrobia phylum, AKK typically constitutes 1%-5% of the gut microbiota.29 This emerging probiotic candidate possesses unique mucin-degrading capabilities and utilizes mucin as its primary carbon, nitrogen, and energy source.29 Substantial evidence links elevated AKK levels with improved metabolic and inflammatory conditions through its multifaceted roles in maintaining epithelial barrier function, modulating energy metabolism, and enhancing butyrate production.29-35 Our results support the hypothesis that AKK contributes to STC alleviation by restoring mucosal layer integrity, increasing goblet cell populations, upregulating the expression of tight junction proteins (including occludin, claudin, and zonula occludens-1), and suppressing inflammatory responses.36-38
Currently, relatively few direct studies on JCD and AKK exist. However, the interaction between them can be inferred to be based on the components of JCD and the physiological characteristics of AKK. The polysaccharides and phenylethanol glycosides (such as echinoside and vermiculin) in Cistanche have prebiotic effects that promote the growth of AKK.39 These properties indicate that JCD directly promotes the growth of key beneficial bacteria, thereby enabling rapid stool excretion, preventing dryness, and achieving the effects of moistening dryness, lubricating the intestines, tonifying the kidney and strengthening Yang. Danggui (Radix Angelicae Sinensis) contains polysaccharides and ferulic acid, whereas Niuxi (Radix Achyranthis Bidentatae) contains polysaccharides and saponins. Polysaccharides increase the efficacy of the main ingredients, and ferulic acid has anti-inflammatory and microbiota regulatory effects, which may indirectly support the colonization of AKK by improving the intestinal microenvironment.40,41 Saponins can alleviate intestinal inflammation and promote the proliferation of AKK through anti-inflammatory and immun-omodulatory effects.42,43 These two drugs, as adjuvant drugs, further complement the principal drug to enhance its therapeutic effect. Zexie (Rhizoma Alismatis), as an adjuvant, promotes diuresis and removes dampness while preventing Cistanche from being overly warm and nourishing, embodying the idea of “combining unblocking and tonifying". Zhiqiao (Fructus Aurantii Submaturus) promotes the circulation of Qi and widens the intestines, facilitating the smooth flow of Qi in intestinal organs and assisting in defecation. It is used as an adjuvant medicine. Shengma (Rhizoma Cimicifugae Foetidae) slightly promotes and increases Yang, and when combined with Niuxi (Radix Achyranthis Bidentatae), it produces an “ascending and descending” effect to regulate the flow of Qi and restore the transmission function of the large intestine. Shengma (Rhizoma Cimicifugae Foetidae) not only guides medicine directly to the spleen, stomach and large intestine but also assists medicine. Within a certain range, polysaccharides and phenylethanol glycosides exert prebiotic effects, and ferulic acid and saponins exert anti-inflammatory and intestinal regulatory effects; these effects increase with increasing concentration. Therefore, the high-dose group had the greatest effect on all the indicators.
This investigation employed an integrated approach combining microbial profiling with molecular biology techniques to elucidate the therapeutic potential of JCD against STC, with a particular emphasis on the high-dose JCD group. Future research should focus on deciphering the intricate interactions among JCD, the gut microbiota, and host physiology to elucidate the mechanism underlying the efficacy of JCD in STC management.
In conclusion, the results of the present study demonstrated that therapeutic interventions targeting ENS repair and intestinal microbial symbiosis restoration may represent the primary pharmacological mechanisms underlying the efficacy of JCD in STC management. Further systematic investigations are warranted to facilitate the clinical translation of JCD-based therapeutic strategies.
5. ACKNOWLEDGEMENTS
The authors would like to acknowledge YAO Zhenghong (Novogene, Sales Department, Beijing, Master of Agriculture), for skillful technical assistance.
6. SUPPORTING INFORMATION
Supporting data to this article can be found online at http://www.journaltcm.com.
Funding Statement
Supported by the National Natural Science Foundation of China: Exploring the Mechanism of Qi-tonifying and Phlegm-eliminating Acupuncture Promoting Intestinal Nerve Precursor Cell Regeneration in Obese Mice Based on the Single-cell RNA-sep Platform (No. 82374176); the Natural Science Foundation of Sichuan Province: Discovery of "Active Center" Oligosaccharide Fragments in Polysaccharides of Pinellia Ternata and Its Processed Products and Research on Quality Evaluation Techniques and Methods (2022NSFSC0591); the Youth Nursery Project of Sichuan Provincial Health Commission: Mechanism Research on miR-491-5p Targeting Akt to Inhibit Intestinal Nerve Apoptosis in the Pathogenesis of Slow Transit Constipation (24QNMP030); General Project of Sichuan Provincial Administration of Traditional Chinese Medicine: Exploring the Mechanism of Jichuan Decoction in Regulating Intestinal nerve Apoptosis in Slow Transit Constipation Rats Based on the Tumor Necrosis Factor Signaling Pathway (2024MS589); the Project of Sichuan Medical Association: Exploring the Mechanism of Jichuan Decoction in Regulating Intestinal Nerve Apoptosis in Slow Transit Constipation Rats Based on the Glial Cell line-derived Neurotrophic Factor/Phosphoinositide 3-kinase/Protein Kinase B Signaling Pathway (S23034)
REFERENCES
- 1. Bharucha AE, Lacy BE. . Mechanisms, evaluation, and management of chronic constipation. Gastroenterology 2020; 158: 1232-49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Barberio B, Judge C, Savarino EV, Ford AC. . Global prevalence of functional constipation according to the Rome criteria: a systematic review and Meta-analysis. Lancet Gastroenterol Hepatol 2021; 6: 638-48. [DOI] [PubMed] [Google Scholar]
- 3. van Mill MJ, Koppen IJN, Benninga MA. . Controversies in the management of functional constipation in children. Curr Gastroenterol Rep 2019; 21: 23-9. [DOI] [PubMed] [Google Scholar]
- 4. Shin JE, Park KS, Nam K. . Chronic functional constipation. Korean J Gastroenterol 2019; 73: 92-8. [DOI] [PubMed] [Google Scholar]
- 5. Bharucha AE, Pemberton JH, Locke GR. . American gastroenterological association technical review on constipation. Gastroenterology 2013; 144: 218-38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Tanner S, Chaudhry A, Goraya N, et al. . Prevalence and clinical characteristics of dyssynergic defecation and slow transit constipation in patients with chronic constipation. J Clin Med 2021; 10: 2027-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Wang HL. . Understanding the pathogenesis of slow-transit constipation: one step forward. Dig Dis Sci 2015; 60: 2216-18. [DOI] [PubMed] [Google Scholar]
- 8. Cho YS, Lee YJ, Shin JE, et al. . 2022 seoul consensus on clinical practice guidelines for functional constipation. J Neurogastroenterol Motil 2023; 29: 271-305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Xu MM, Guo Y, Chen Y, Zhang W, Wang L, Li Y. . Electroacupuncture promotes gut motility and alleviates functional constipation by regulating gut microbiota and increasing butyric acid generation in mice. J Integr Med 2023; 21: 397-406. [DOI] [PubMed] [Google Scholar]
- 10. Zou S, Xie B, An Z, et al. . Olive oil solution of volatile oil from citri reticulatae pericarpium viride alleviates slow-transit constipation via regulating SCF/c-kit signaling pathway and intestinal flora. Drug Des, Devel and Ther 2025; 19: 4275-95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Hu L, Liu Q, Ke X, Zhao P, Fang W, Ren Y. . Correlation of the intestinal flora and its metabolites with the colonic transport function in functional constipation. Front Microbiol 2025; 16: 1591697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Ali MZ, Mehmood MH, Haneef M, et al. . A flavonoid driven phyto-pharmacological effects of capparis decidua edgew. in rodents. Pak J Pharm Sci 2020; 33: 333-42. [PubMed] [Google Scholar]
- 13. Dai L, Zhong LL, Ji G. . Irritable bowel syndrome and functional constipation management with integrative medicine: a systematic review. World J Clin Cases 2019; 7:3486-504. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Vicentini FA, Keenan CM, Wallace LE, et al. . Intestinal microbiota shapes gut physiology and regulates enteric neurons and glia. Microbiome 2021; 9: 210-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Wang XM, Lü LX, Qin YS, et al. . Jichuan decoction ameliorates slow transit constipation via regulation of intestinal glial apoptosis. World J Gastroenterol 2022; 28: 5007-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Huang L, Duan C, Xia X, et al. . Commensal microbe-derived propionic acid mediates juvenile social isolation-induced social deficits and anxiety-like behaviors. Brain Res Bull 2021; 166:161-71. [DOI] [PubMed] [Google Scholar]
- 17. Meng X, Ma J, Kang AN, et al. . A novel approach based on metabolomics coupled with Intestinal flora analysis and network pharmacology to explain the mechanisms of action of bekhogainsam decoction in the improvement of symptoms of streptozotocin-induced diabetic nephropathy in mice. Front Pharmacol 2020; 11: 633-41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Alavi K, Thorsen AJ, Fang SH, et al. . The american society of colon and rectal surgeons clinical practice guidelines for the evaluation and management of chronic constipation. Dis Colon Rectum 2024; 67: 1244-57. [DOI] [PubMed] [Google Scholar]
- 19. Chen KD, Wang KL, Chen C, et al. . Hydrogen-rich water alleviates constipation by attenuating oxidative stress through the sirtuin1/nuclear factor-erythroid-2-related factor 2/heme oxygenase-1 signaling pathway. World J Gastroenterol 2024; 30: 2709-25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Liu J, Ji L, Wang Y, et al. . Tongbian decoction inhibits cell autophagy via PI3K/Akt/mTOR signaling pathway to treat constipation rats. J Ethnopharmacol 2025; 339: 119-39. [DOI] [PubMed] [Google Scholar]
- 21. Wang Y, Wang X, Qian Y, et al. . Naringenin attenuates slow-transit constipation by regulating the AMPK/mTOR/ULK1 signaling pathway: in vivo and in vitro studies. J Nutr Biochem 2025; 24: 11-3. [DOI] [PubMed] [Google Scholar]
- 22. Kim JE, Choi YJ, Lee SJ, et al. . Molecular characterization of constipation disease as novel phenotypes in CRISPR-Cas9-generated leptin knockout mice with obesity. Int J Mol Sci 2020; 21: 94-104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Kim JE, Park JW, Kang MJ, et al. . Anti-inflammatory response and muscarinic cholinergic regulation during the laxative effect of Asparagus cochinchinensis in loperamide-induced constipation of SD rats. Int J Mol Sci 2019; 20: 946-55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Eor JY, Tan PL, Lim SM, et al. . Laxative effect of probiotic chocolate on loperamide-induced constipation in rats. Food Res Int 2019; 116: 1173-82. [DOI] [PubMed] [Google Scholar]
- 25. Li T, Hu M, Jiang C, et al. . Laxative effect and mechanism of Tiantian Capsule on loperamide-induced constipation in rats. J Ethnopharmacol 2021; 266: 113411. [DOI] [PubMed] [Google Scholar]
- 26. Wang L, Gharibani P, Yang Y, et al. . Regulation of enteric nervous system via sacral nerve stimulation in opioid-induced constipated rats. Front Neurosci 2023; 17: 1146883. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Guo Y, Song L, Huang Y, et al. . Latilactobacillus sakei Furu2019 and stachyose as probiotics, prebiotics, and synbiotics alleviate constipation in mice. Front Nutr 2022; 9: 1039403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Robinson AM, Stojanovska V, Rahman AA, McQuade RM, Senior PV, Nurgali K. . Effects of oxaliplatin treatment on the enteric glial cells and neurons in the mouse ileum. J Histochem Cytochem 2016; 64: 530-45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Niu H, Zhou M, Zogona D, et al. . Akkermansia muciniphila: a potential candidate for ameliorating metabolic diseases. Front immunol 2024; 15: 1370658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Feng J, Hu X, Liu J, et al. . Akkermansia muciniphila in neurological disorders: mechanisms and therapeutic potential via the gut-brain axis. Front Neurosci 2025; 19: 1650807. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Yuan H, Shi J, Gu C, et al. . Akkermansia muciniphila: a next-generation gut probiotic supporting neurorepair and functional recovery. Neural Regen Res 2025; 29: 00701. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Becken B, Davey L, Middleton DR. et al. . Genotypic and phenotypic diversity among human isolates of Akkermansia muciniphila. mBio 2021; 12: e00478-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Kangm EJ, Kim JH, Kim YE, et al. . The secreted protein Amuc_1409 from Akkermansia muciniphila improves gut health through intestinal stem cell regulation. Nat Commun 2024; 15: 2983-93. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Xu Y, Duan J, Wang D, et al. . Akkermansia muciniphila alleviates persistent inflammation, immunosuppression, and catabolism syndrome in mice. Metabolites 2023; 13: 194-206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Yang L, Huang Y, Chen M, et al. . Pasteurized Akkermansia muciniphila AKK PROBIO attenuates obesity through gut microbiota-SCFA-GLP-1 axis and potential involvement of AMPK/PPAR-α pathway. Probiotics Antimicrob proteins 2025; 22: 12602. [DOI] [PubMed] [Google Scholar]
- 36. Zhao Y, Yang H, Wu P, et al. . Akkermansia muciniphila: a promising probiotic against inflammation and metabolic disorders. Virulence 2024; 15: 2375555. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Wang Y, Li C, Li J, et al. . Abelmoschus manihot polysaccharide fortifies intestinal mucus barrier to alleviate intestinal inflammation by modulating Akkermansia muciniphila abundance. Acta pharm Sin. B 2024; 14: 3901-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Mo C, Lou X, Xue J, et al. . The influence of Akkermansia muciniphila on intestinal barrier function. Gut pathog 2024; 16: 41-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Peng Q, Jiang P, Yi L, et al. . In vivo systematic analysis of microbiota-prebiotic crosstalk reveals a synbiotic that effectively ameliorates DSS-induced colitis in mice. Gut Microbes 2025; 17: 2541028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Liu J, Guan Y, Yang L, et al. . Ferulic acid as an anti-inflammatory agent: insights into molecular mechanisms, pharmacokinetics and applications. Pharmaceuticals 2025; 18: 912-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Hu X, Han X, Liu G, Guan G, Xia C. . Ferulic acid and N-Feruloylserotonin ameliorate LPS-induced intestinal inflammation via modulation of gut microbiota, metabolome, and transcriptome. Front Microbiol 2025; 16: 1597774. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Yang CY, Luo J, Peng WJ, Dai WB. . Huaiyu pill alleviates inflammatory bowel disease in mice via blocking toll like receptor 4-myeloid differentiation primary response gene 88-nuclear factor kappa B subunit 1 pathway. J Tradit Chin Med 2024; 44: 916-25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Xiong B, Wang H, Song YX, Lan WY, Li J, Wang F. . Natural saponins and macrophage polarization: Mechanistic insights and therapeutic perspectives in disease management. Front Pharmacol 2025; 16: 1584035. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supporting data to this article can be found online at http://www.journaltcm.com.
