Molecular Characterization and Antibiotic Resistance of Broad‐Spectrum β‐Lactamase‐Producing Enterobacterales in Urinary Tract Infections in Libreville, Gabon

Jean Fabrice Yala; Ornella Zong Minko; Rolande Mabika Mabika; Franck Mounioko; Elvire Anita Mbongo-Kama; Annicet Clotaire Dikoumba; Alain Souza

doi:10.1155/ijm/3553027

. 2026 Jun 16;2026:3553027. doi: 10.1155/ijm/3553027

Molecular Characterization and Antibiotic Resistance of Broad‐Spectrum β‐Lactamase‐Producing Enterobacterales in Urinary Tract Infections in Libreville, Gabon

Jean Fabrice Yala ^1,^2,^✉, Ornella Zong Minko ^1,², Rolande Mabika Mabika ¹, Franck Mounioko ³, Elvire Anita Mbongo-Kama ⁴, Annicet Clotaire Dikoumba ¹, Alain Souza ^2,⁵

Editor: Shweta Negi

PMCID: PMC13270413 PMID: 42311935

Abstract

Background

The effectiveness of antibiotic therapy for urogenital tract infections (UTIs) is increasingly compromised by the global dissemination of extended‐spectrum β‐lactamase‐producing Enterobacterales (ESβL‐En). This study aimed to assess the involvement of broad‐spectrum β‐lactamase‐producing Enterobacterales (BSβL‐En) in UTIs and to establish their antibiotic susceptibility profile.

Methods

A cross‐sectional study was conducted from October to December 2019 at the Army Training Hospital Omar Bongo Ondimba. All patients suspected of having a UTI were included. BSβL‐En isolates were recovered using MacConkey agar supplemented with cefotaxime. Phenotypic screening for β‐lactamase (ESβL, AmpC, and carbapenemases) using specific phenotypic confirmatory disc diffusion test. Antimicrobial susceptibility was determined using the disk diffusion method and minimum inhibitory concentration (MIC) assays. The presence of resistance genes (bla _CTX-M, bla _TEM, bla _CARBA, bla _IMP, mcr-1 and mcr-2) was investigated by polymerase chain reaction.

Results

A total of 295 patients were enrolled, among whom 18.3% (54/295) had UTIs. Of the isolated uropathogens 74.1% were BSβL‐En. The predominant species were Enterobacter cloacae (8/54, 14.8%), Escherichia coli (6/54, 11.1%) and Kluyvera spp (5/54, 9.3%). Among 40 BSβL‐En isolates, 87.5% (n = 35/40) were confirmed by molecular analysis. Notably 48.5% (17/35) harbored at least two bla genes, simultaneously. Fourteen isolates carried the bla _CARBA and bla _IMP genes, which in combination with the bla _CTX-M and bla _TEM. About 40.0% of the isolates (14/35) carried the bla _CTX-M, 8.6% had the bla _TEM (3/35), and 2.9% had the bla _IMP (n = 1/35). All urinary isolates were multidrug‐resistant (MDR), exhibiting high levels of β‐lactamase production, with resistance rates of 81.6% ± 0.16% for first‐line antibiotics (e.g., β‐lactams, fluoroquinolones) and 61.7% ± 0.04% for last‐resort antibiotics (e.g., imipenen, ertapenem, and colistin). The prevalence of carbapenem resistance genes was 44.1%, whereas no colistin resistance genes (mcr‐1 and mcr‐2) were detected.

Conclusion

This study highlights a high prevalence of multidrug‐resistant uropathogens producing BSβL, with significant resistance to both first‐line and last‐resort antibiotics.

Keywords: β-lactamase, Enterobacterales, gabon, multidrug-resistant, urogenital infection

1. Background

Urinary tract infections (UTIs) comprise a heterogeneous group of infections affecting the urinary tract and its associated structures [1]. They are among the most common infectious diseases in both hospital and community settings [2]. In 70% to 95% of cases, the main uropathogens are Escherichia coli (E. coli) followed by Klebsiella pneumoniae and Proteus mirabilis. These pathogens are generally derived from the intestinal microbiota [3].

Several community‐based studies have reported that E. coli (46.4%–74.2%) followed by Klebsiella spp (6.0%–13.45%), Enterococcus spp (5.3%–9.54%), and Proteus spp (4.7%–11.9%) [4]. The global incidence of UTIs has been estimated at approximately 1.6% [5]. UTIs primarily affect women, with a recurrence risk of 25%–35% per year, whereas recurrence in men is considerably lower [2]. However, in children aged 2 to 24 months, this tendency seems to be reversed in both sexes [6]. Depending on the person′s age, the frequency and recurrence of UTIs can be taken as signs of health complications or/and more severe underlying pathologies. UTIs constitute significant public health problems as they can lead to permanent kidney damage and diabetes [7]. In women, recurrent infections may also affect the reproductive system and contribute to secondary infertility [8].

The management of UTIs is based on CBEU, often following empirical antibiotic therapy or inappropriate self‐medication practices [9]. The increasing prevalence of ESβL‐En has become a major concern, as these organisms frequently harbor multiple resistance determinants, thereby limiting therapeutic options [10]. Treatment options for UTIs cause to ESβLs‐producing Enterobacterales include nitrofurantoin, fosfomycin, fluoroquinolones, cefoxitin (FOX), piperacillin‐tazobactam (TZP), carbapenems, ceftazidime‐avibactam, ceftolozane‐tazobactam, and aminoglycosides. Depending on susceptibility results, carbapenem‐sparing regimens may be considered for mild to moderate UTIs caused by ESβL‐En [10]. For carbapenem‐resistant Enterobacterales (CRE), therapeutic options include ceftazidime‐avibactam, colistin, polymixin B, fosfomycin, aztreonam, aminoglycosides, and tigecycline [10].

Multidrug‐resistant (MDR) bacteria increasingly threaten the efficacy of last‐resort antibiotics, including carbapenems and colistin [11]. Several studies have reported alarming resistance rates of up to 60% to carbapenems and 40% for colistin among E. coli strains [12, 13]. Given their high frequency and clinical impact of these infections, continuous monitoring of antibiotic resistance profile among BSβL‐En is essential.

In Gabon, a Central African country, previous studies have described epidemiology of uropathogens in Libreville and Franceville, as well as susceptibility pattems [14, 15]. These studies showed that E. coli isolate were the predominant among Enterobacterales species responsible for UTIs, with resistance rate of approximately 65% to penicillin and 45% to aminopenicillin [14, 15]. However, data specifically focusing on BSBL‐En‐associated UTIs remain limited.

Therefore the aim of this study was to investigate and characterize BSβL‐En involved in UTIs among inpatients and outpatients at the Army Training Hospital Omar Bongo Ondimba (HIAOBO) in Libreville, Gabon, to determine their susceptibility profiles to first‐line antibiotics, and to perform the phenotypic and genotypic characterization of resistance to last‐line antibiotics.

2. Methods

2.1. Study Design

This cross‐sectional study was conducted at the HIAOBO in Libreville, Gabon. It is a 3rd generation university hospital, with several departments (intensive care, surgery, medicine, pediatrics, emergency, gynecology, etc.) and a medical analysis laboratory. The laboratory offers a range of services for outpatients and inpatients. Urine samples were collected from patients with a suspected UTI and admitted to the various departments of the hospital, as well as outpatients who came to perform a cytobacteriological examination of their urine. The study was conducted from October 28 to December 28, 2019.

Patients, of all genders and ages, suspected of UTIs, were randomly recruited. The main inclusion criterion was that patients agreed to participate in the study and those who had a prescription for ordered for urine culture and sensitivity analysis. Patients undergoing other medical examinations were excluded from the study. The demographic and clinical data of the patients were recorded. The processing of the isolates after culture was carried out at the Laboratory of Molecular and Cellular Biology (LABMC), Department of Biology of the Masuku University of Sciences and Technology (USTM).

Written informed consent was obtained from patients, or parents or guardians of participating minors. For each participant, characteristics such as demographic (age, sex), source (outpatient, or inpatient), and services (neonatal, medicine, emergency ambulatory service, pediatrics, intensive care, cardiology) were collected on a standard survey form.

2.2. Isolation and Identification of Bacteria

The 1st jets of the various urine samples were collected in sterile jars. Then 10 μL were collected using calibrated loops which were subsequently streaked tight, parallel on the surface of CLED agar and then MacConkey agar supplemented medium with cefotaxime (McC‐CTX) concentrated at 2 μg/mL to detect ESβL‐En or cephalosporinase (AmpC) producers (AmpC‐En). After incubation at 37°C for 18–24 h, the various presumptive colonies cefotaxime‐resistant isolates were obtained were obtained on McC‐CTX and further subcultured in soft heart–brain agar (BCC) and before then stored at 4°C for subsequent identification. All colonies obtained were then screened by orientation tests: gram staining, oxidase, and catalase tests. Identification of the bacteria was performed by the Gallery of Analysis of Identification Profiles (API) 20E (Biomerieux, S.A, France).

2.3. Phenotypic Detection of the Production of Broad‐Spectrum β‐lactamases (BSβL): ESβL, AmpC and Carbapenemase

Phenotypic detection of BSβL production (ESβL, AmpC, and carbapenemases) on the various selected bacteria was performed by a standard antibiogram using the disk diffusion method.

2.4. Detection of ESβL‐Producing Strains

The detection of ESβL‐producing strains was carried out using two diffusion methods: the synergy test and antimicrobial susceptibility testing interpretation. The double‐disk synergy test was carried out using third‐generation cephalosporin ceftazidime (CAZ), a fourth‐generation cephalosporin cefepime (FEP), monobactam aztreonam (ATM) and amoxicillin and clavulanic acid (AMC). The appearance of a characteristic “champagne cork” or “keyhole” (synergy) effect between the β‐lactam antibiotic disks and the clavulanic acid disk on Mueller–Hinton agar was interpreted as indicative of ESβL production [16, 17]. Interpretation of antimicrobial susceptibility testing was performed according to the method described by Robin et al. [17]. The procedure and interpretive criteria of the disk diffusion test were carried out in accordance with the recommendations of the Antibiogram Committee of the French Society of Microbiology (CA‐SFM) 2019 V2.0.

2.5. Detection of Strains‐Producing AmpC

Two methods were used to characterize AmpCs β‐lactamase production: the disk diffusion method and interpretation of the antimicrobial susceptibility test.

The diffusion‐on‐disk method consisted of measuring inhibition zone diameters around FOX disks (FOX, 30 μg) and FEP disks (FEP, 30 μg), which were used for the screening of AmpC‐producing strains [18, 19]. Isolates exhibiting an inhibition zone diameter ≤ 18 mm for FOX and ≥ 27 mm for FEP, in the absence of a synergy effect, were classified as AmpC β‐lactamase producers.

2.6. Detection of Strains‐Producing Carbapenemases

Phenotypic detection of carbapenemase production was inferred from the antimicrobial susceptibility testing profile, in accordance with the interpretative approach described by Nordmann et al. [20] (Table 1). This screening strategy is widely used in resource‐limited settings as a first‐line approach for the presumptive detection of carbapenemase‐producing Enterobacterales when confirmatory rapid tests are not available.

Table 1.

Resistance phenotypes resulting from the expression of the main carbapenemases reported in Enterobacterales without or with extended‐spectrum β‐lactamases (ESβLs).

	AMX	AMC	TZP	CTX	CAZ	IMP	ETP	ATM	Reference
KPC	R	S/I	R	R	R	S/I/R	I/R	R	[20]
KPC + ESβL	R	I/R	R	R	R	I/R	I/R	R
IMP/VIM/NDM	R	R	I/R	R	I/R	S/I/R	I/R	S
IMP/VIM/NDM + ESβL	R	R	I/R	R	R	I/R	R	R
OXA‐48/OXA‐181	R	R	S/I/R	S/I	S	S/I	S/I	S
OXA‐48/OXA‐181 + ESβL	R	R	I/R	R	R	I/R	I/R	R

Open in a new tab

Abbreviations: AMC, amoxycillin‐clavulanic acid; AMX, amoxycillin; ATM, aztreonam CAZ, ceftazidime; CTX, cefotaxime; ETP, ertapenem; IMP, imipenem; TZP, piperacillin‐tazobactam;.

Carbapenemase production was suspected when exhibited reduced susceptibility or resistance to key β‐lactam antibiotics, including amoxicillin, AMC, TZP, cefotaxime, ceftazidime, imipenem, ertapenem, and aztreonam, based on their inhibition zone diameters.

2.7. Susceptibility Profiles of BSβL‐En to the Usual and Latest Line Antibiotics

Antimicrobial susceptibility testing was performed using the ATB UR EU (08) gallery (bioMérieux, Marcy l′Étoile, France), according to the manufacturer′s instructions. A total of 21 antibiotics were tested: ampicillin (AMP); amoxicillin + clavulanate, ticarcillin (TIC), piperacillin (PIC), piperacillin + tazobactam, cefolatine, cefixim, cefoxitin, cefotaxime, ceftazidim, FEP, imipenem, gentamicin, tobramycin, amikacin, ofloxacin, ciprofloxacin, levofloxacin, co‐trimoxazole, fosfomycin, and nitrofurantoin. The galleries were inoculated with bacterial suspensions adjusted to 0.5 McFarland and incubated at 37°C for 18–24 h. Results were interpreted by assessing the turbidity of the wells, in accordance with the manufacturer′s guidelines. Isolates were categorized as susceptible, intermediate, or resistant. MDR strains were defined as those exhibiting acquired nonsusceptibility to at least one agent in three or more antimicrobial categories.

In this study, all tested antibiotics were considered first‐line agents, except for imipenem. Imipenem, along with ertapenem and colistin, was classified as a last‐resort antibiotic for the treatment of UTI in this study. Susceptibility was determined by the reference method to ertapenem according to Kirby‐Bauer, the broth microdilution for colistin. All results were interpreted according to the recommendations of the CA‐SFM, 2019, Version 2.0. Each test was performed in quadruplicate (n = 4).

2.8. Molecular Typing of BSβL‐En Genes and Search for Resistance Genes to Colistin and Carbapenems

2.8.1. DNA Extraction

The extraction of bacterial DNA was done by heat treatment. Briefly, colonies were diluted in microtubes containing 200 μL ultrapure water and homogenized water. The tubes were incubated in a dry water bath at 100°C for 10 min. The obtained lysates obtained were centrifuged at 12,000 rpm for 8 min. The resulting supernatant were transferred into new microtubes and served as matrix for DNA.

2.8.2. Characteristics of the Genes and Study Conditions

Molecular typing of ESβL (bla _CTX-M and bla _TEM,) as well as the search for carbapenems (bla _CARBA and bla _IMP) and colistin (mcr1 and mcr2) resistance genes were carried out by the polymerase chain reaction (PCR) amplification on all strains. The sequences of the different primers and the sizes of the genes are recorded in Table 2.

Table 2.

Primers used for PCR amplification of genes from β‐lactamases and resistance to carbapenems and colistin.

	Primer	Primers ^′sequences (5 ^′3 ^′)	Size (Kb)	Genes	References
β‐lactamases	CTX‐M‐F	ATGGTTAAAAAATCACTGC	864	Bla _CTX-M	[16, 21]
	CTX‐M‐R	TTGGTGACGATTTTAGCCGC	864	Bla _CTX-M	[16, 21]
	TEM‐F	ATTCTTGAAGACGAAAGGGC	1150	Bla _TEM	[16, 21]
	TEM‐R	ACGCTCAGTGGAACGAAAAC	1150	Bla _TEM	[16, 21]

Carbapenemases	IMP‐F	GAAGGCGTTTATGTTCATAC	587	Bla _IMP	[22]
	IMP‐R	GTACGTTTCAAGAGTGATGC	587	Bla _IMP	[22]
	CARBA‐F	AATGGCAATCAGCGCTTC	586	Bla _CARBA	[22]
	CARBA‐R	GGGGCTTGATGCTCACT	586	Bla _CARBA	[22]

Colistin	Mcr‐1‐F	AGTCCGTTTGTTCTTGTGGC	1497	Mcr1	[23]
	Mcr‐1‐R	AGATCCTTGGTCTCGGCTTG	1497	Mcr1	[23]
	Mcr‐2‐F	CAAGTGTGTTGGTCGCAGTT	576	Mcr2	[23]
	Mcr‐2‐R	TCTAGCCCGACAAGCATACC	576	Mcr2	[23]

Open in a new tab

Abbreviation: CARBA, Carbapenemase; CTX‐M, Cefotaximase from Munich; F, Foward; R, Reverse; Kb, Kilobase; mcr, mobilized colistin resistance; TEM, Temoniera; IMP, Imipenemase metallo‐β‐lactamase.

The single or multiplex PCR reactions were carried out in a thermocycler (Bio‐RAD, T100TM, USA) in a final reaction volume of 20 μL containing 2 μL of DNA from the bacterial clones and 18 μL of the PCR mix, composed of master mix 1X (AmpliTaqGoldTM 360, Applied Biosystems Thermo Fisher, Luthhuania) and primers (0.5 μM). The different amplification programs were as follows: an initial denaturation step at 95°C for 15 min followed by a 32‐cycle step consisting of denaturation at 94°C for 1 min, hybridization at 55°C (bla _TEM and bla _CTX-M) or 58°C (bla _IMP, bla _CARBA, and mcr-1/2) for 1 min and elongation for 1 min at 72°C. Final elongation was done at 72°C for 10 min. After amplication PCR‐amplified DNA fragments were separated by electrophoresis on a 1.5% (w/v) agarose gel prepared in 1X Tris‐borate‐EDTA (TBE) solution containing ethidium bromide and visualized under an ultraviolet transilluminator (LABOLAN, ECX‐15 M, Spain).

2.9. Ethical Considerations

The study was approved on September 15, 2019 by the ethical committee of the hospital structure in accordance with the recommendations of the decree PROT N° 0020/2015/SG/CNE of the Gabonese National Ethics Committee for Research and the Ministry of Health. The study protocol was approved and authorized by the Management of the HIAOBO and the Head of the Medical Analysis Laboratory, Bacteriology Unit. Urine samples were collected from all types of patients after obtaining their written and informed consent for adults, and from the guardians of minor participants.

2.10. Statistical Analysis

All the data collected during this study were entered and managed using Microsoft Excel 2010 (Microsoft Corporation, 2010). Statistical analyses were performed using R software (Version 3.2.2)…

The chi‐squared test allowed us to assess possible significant differences between the various sociodemographic parameters. The kappa coefficient was applied to measure the level of agreement between the presence of different β‐lactamase encoding genes and the observed antibiotic resistance phenotypes, with interpretation based on a 95% confidence interval [24]. All these statistical tests were two‐tailed, and a p value < 0.05 was considered statistically significant.

3. Results and Discussion

3.1. Results

3.1.1. Demographics and Prevalence of UTIs

In this study, 295 patients were enrolled. The study population was predominantly composed of outpatients (93.2%), whereas hospitalized patients accounted for 6.8%, of whom 70.0% were admitted to medical department. The sex ratio was 1.23, with a higher proportion of females (55.2%) than males (44.8%) (Table 3). Furthermore, the average age was 35.6 ± 17.4 years old. The most represented age group consisted of patients aged 21 to 30 years (29.2%). The rate of infections caused by BSβL‐En was 18.31% (54/295). The demographic characteristics of the study population are summarized in Table 3.

Table 3.

Sociodemographic characteristics of the study population.

	Hospitalized patients	Outpatients	Total	Hospitalized patients	Outpatients	Total	p
				UTI‐presumptive BSβL
	n = 20 (6.8)	n = 275 (93.2)	n = 295 (100)	n = 2 (0.7)	n = 52 (17.6)	n = 54 (18.3)
	n (%)	n (%)	n (%)	n (%)	n (%)	n (%)
Gender
Female	10 (50.0)	153 (55.6)	163 (55.2)	1 (50.0)	37 (71.2)	38 (70.4)	0.6245
Male	10 (50.0)	122 (44.4)	132 (44.8)	1 (50.0)	15 (28.8)	16 (29.6)	0.6245
Gender ratio F/M	1	1.3	1.23	1.0	2.5	2.4
Age (years)
0–10	3 (15.0)	18 (6.5)	21 (7.1)	—	1 (1.9)	1 (100)	0.0104
11–20	2 (10.0)	33 (12.0)	35 (11.5)	—	7 (13.5)	7 (13.0)
21–30	3 (15.0)	83 (30.2)	86 (29.2)	1 (50.0)	14 (26.9)	15 (27.8)
31–40	—	61 (22.2)	61 (20.7)	—	11 (21.1)	11 (20.4)
41–50	3 (15.0)	32 (11.6)	35 (11.9)	—	7 (13.5)	7 (13.0)
51–60	3 (15.0)	23 (8.4)	26 (8.8)	1 (50.0)	5 (9.6)	6 (11.1)
61 or more	6 (30.0)	25 (9.1)	31 (10.5)	—	8 (15.4)	8 (14.8)
Hospital unit
External	—	275 (100)	275 (93.2)	—	5 (100.0))	52 (96.3)	? 2.2.10^-6
Neonatal	2 (10.0)	—	2 (0.7)	—	—	—
Medicine	14 (70.0)	—	14 (4.8)	2 (100.0)	—	2 (3.7)
EAS	1 (5.0)	—	1 (0.3)	—	—	—
Pediatrics	1 (5.0)	—	1 (0.3)	—	—	—
Intensive care	1 (5.0)	—	1 (0.34	—	—	—
Cardiology	1 (5.0)	—	1 (0.3)	—	—	—

Open in a new tab

Abbreviation: BSβL, Broad‐Spectrum β‐Lactamase; EAS, Emergency Ambulatory Service; UTI, Urinary Tract Infections.

The results in Table 3 highlight that the majority of the population infected by presumptive BSβL uropathogens was made up of outpatients (17.6%), and a minority of minority were hospitalized patients (0.7%). The chi‐squared test showed a significant difference regarding the origin of the patients (p < 2.2.10⁻⁶). The gender ratio of the infected population was 2.4 with a higher rate of women (70.4%). The most affected age groups are 21 to 30 years and 31 to 40 years with prevalence rates of 27.8% and 20.4%, respectively. However, the chi‐squared test did not show any significant difference between the two genders (p = 0.6245), whereas there was a significant difference between age groups (p = 0.0104).

3.1.2. Distribution and Frequency of Presumptive Isolates Containing Broad‐Spectrum β‐Lactamases Producing Enterobacterales (BSβL‐En)

Presumptive Gram‐negative BSβL‐En were isolated from 54 urine specimens. Their distribution and rates are presented in Table 4.

Table 4.

Etiologies of urinary tract infections (UTIs).

	Number of isolates (N)	Percentage %
Gram‐negative Bacilli	44	81.5
Enterobacteria	40	74.1
Citrobacter koseri/farmeri	1	1.9
Enterobacter cloacae	8	14.8
Enterobacter gergovia	1	1.9
Enterobacter sakasakii	2	3.7
Escherichia coli	6	11.1
Klebsiella oxytoca	1	1.9
Klebsiella pneumoniae	4	7.4
Kluyvera spp	5	9.3
Proteus mirabilis	4	7.4
Raoultella ornithinolytica	1	1.9
Serratia fonticola	2	3.7
Serratia marcescens	1	1.9
Serratia odorifera 1	3	5.6
Yersinia intermedia	1	1.9
Nonfermentative Gram‐negative	4	7.4
Pseudomonas spp	3	5.5
Acinetobacter baumannii	1	1.9

Open in a new tab

The results in Table 4 showed that of the 54 bacterial isolates, Gram‐negative bacilli were responsible for most UTIs (81.5%). Among the Gram‐negative bacilli, Enterobacterales were mainly responsible for UTIs (74.7%) followed by nonfermentative Gram‐negative bacilli (7.4%). Gram‐negative bacteria included 44 bacterial strains; 40 were BSβL‐En (9 genera, 14 species), whereas 4 were nonfermentative bacilli isolates (2 genera, 4 species). The three predominant Gram‐negative species were Enterobacter cloacae (14.8%), E. coli (11.1%), and Kluyvera spp (9.3%) (Table 4).

3.1.3. Characterization of BSβL‐En and Phenotypic Resistance Profiles

The phenotypic tests for the confirmation of BSβL‐En identified 40 (100.0%) producers, of which 4 (10.0%) producers of carbapenemases, 6 (15.0%) ESβL‐En, 7 (17.5%) AmpC producers and 23 (57.5%) combined producers of AmpC/ESβL as presented in (Table 5). The majority of ESβL‐En were isolated from women (69.0%; 20/29) compared to men (31.0%; 9/29). In addition, the dissemination of these BSβL‐En mainly came from outpatients 93.1% (27/29).

Table 5.

Frequency of BSβL‐producing Enterobacterales and their antibiotic susceptibility profiles.

	BSβL	Usual antibiotics																				2nd line ATB therapy
	n (%)	AMP	AMC	TIC	PIC	TZP	CFT	CFM	CXT	CTX	CAZ	FEP	GEN	TOB	AKN	LVX	OFL	CIP	TSU	FOS	FUR	IMI	ERT	CS
AmpC	7 (17.5)	7 (100)	7 (100)	7 (100)	7 (100)	4 (57.1)	7 (100)	7 (100)	7 (100)	7 (100)	6 (85.7)	5 (71.4)	6 (85.7)	3 (42.9)	3 (42.9)	3 (42.9)	4 (57.1)	4 (57.1)	4 (57.1)	5 (71.4)	5 (83.3)	5 (83.3)	4 (57.1)	2 (28.6)
E. cloacae	3 (42.8)	3 (100)	3 (100)	3 (100)	3 (100)	1 (33.3)	3 (100)	3 (100)	3 (100)	3 (100)	2 (66.7)	1 (33.3)	2 (66.7)	0 (0.0)	0 (0.0)	0 (0.0)	1 (33.3)	1 (33.3)	1 (33.3)	2 (66.7)	2 (66.7)	1 (33.3)	1 (33.3)	1 (3.3)
E. gergoviae	1 (14.3)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)
E. coli	2 (28.6)	2 (100)	2 (100)	2 (100)	2 (100)	1 (50.0)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	1 (50.0)	1 (50.0)	1 (50.0)	1 (50.0)	1 (50.0)	1 (50.0)	2 (100)	2 (100)	0 (0.0)
P. mirabilis	1 (14.3)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	1 (100)
ESβL	6 (15.0)	6 (100)	6 (100)	6 (100)	6 (100)	3 (50.0)	6 (100)	6 (100)	4 (66.7)	5 (83.3)	5 (83.3)	4 (66.7)	5 (83.3)	5 (83.3)	3 (50.0)	4 (66.7)	5 (83.3)	5 (83.3)	4 (66.7)	5 (83.3)	3 (50.0)	2 (33.3)	3 (50.0)	6 (100)
E. cloacae	1 (16.7)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	1 (100)
P. mirabilis	3 (50.0)	3 (100)	3 (100)	3 (100)	3 (100)	1 (33.3)	3 (100)	3 (100)	2 (66.7)	2 (66.7)	2 (66.7)	1 (33.3)	2 (66.7)	2 (66.7)	1 (33.3)	1 (33.3)	2 (66.7)	2 (66.7)	2 (66.7)	2 (66.7)	1 (33.3)	0 (0.0)	2 (33.3)	3 (100)
S. marcescens	1 (16.7)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	1 (100)	1 (100)	1 (100)	1 (100)
Y. intermedia	1 (16.7)	1 (100)	1 (100.0)	1 (100)	1 (100)	0 (0.0)	1 (100)	1 (100)	0 (0.0)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	1 (100)	1 (100)	1 (100)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	1 (100)
Carbapenemases	4 (10.0)	4 (100)	4 (100)	4 (100)	4 (100)	2 (50.0)	2 (50.0)	2 (50.0)	2 (50.0)	2 (50.0)	2 (50.0)	4 (100)	2 (50.0)	2 (50.0)	2 (50.0)	2 (50.0)	3 (75.0)	3 (75.0)	2 (50.0)	3 (75.0)	3 (75.0)	1 (25.0)	0 (0.0)	4 (100)
E. sakazakii	1 (25.0)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)^a	1 (100)
E. coli	1 (25.0)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	1 (100)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	1 (100)	1 (100)	0 (0.0)	0 (0.0)	1 (100)	0 (0.0)^a	0 (0.0)^a	1 (100)
K. pneumoniae	1 (25.0)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	0 (0.0)	1 (100)	0 (0.0)	0 (0.0)	0 (0.0)	1 (100)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	1 (100)	1 (100)	0 (0.0)	0 (0.0)	1 (100)
S. odorifera 1	1 (25.0)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	0 (0.0)	0 (0.0)^a	1 (100)
AmpC-ESβL	23 (57.5)	23 (100)	23 (100)	23 (100)	23 (100)	19 (82.6)	23 (100)	23 (100)	23 (100)	23 (100)	23 (100)	20 (86.9)	19 (82.6)	17 (73.9)	13 (56.5)	11 (47.8)	18 (78.3)	18 (78.3)	20 (91.3)	11 (47.8)	1 2 (56.5)	16 (69.6)	20 (86.9)	13 (56.5)
C. koseri/farmeri	1 (4.3)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	1 (100)	1 (100)	1 (100)
E. cloacae	4 (17.4)	4 (100)	4 (100)	4 (100)	4 (100)	3 (75.0))	4 (100)	4 (100)	4 (100)	4 (100)	4 (100)	4 (100)	3 (75.0)	2 (50.0)	2 (50.0)	2 (50.0)	3 (75.0)	3 (75.0)	3 (75.0)	4 (10.0)	4 (100)	3 (75.0)	3 (75.0)	2 (50.0)
E. sakazakii	1 (4.3)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	0 (0.0)	0 (0.0)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)
E. coli	3 (13.0)	3 (100)	3 (100)	3 (100)	3 (100)	1 (33.3)	3 (100)	3 (100)	3 (100)	3 (100)	2 (66.7)	2 (66.7)	2 (66.7)	3 (100)	2 (66.7)	3 (100)	3 (100)	3 (100))	3 (100)	1 (33.3)	2 (66.7)	1 (33.3)	1 (33.3)	1 (33.3)
K. oxytoca	1 (4.3)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	1 (100)	1 (100)	1 (100)	0 (0.0)	0 (0.0)	0 (0.0)	1 (100)	0 (0.0)
K. pneumoniae	3 (13.0)	3 (100)	3 (100)	3 (100)	3 (100)	3 (100)	3 (100)	3 (100)	3 (100)	3 (100)	3 (100)	1 (33.3)	3 (100)	1 (33.3)	0 (0.0)	2 (66.7)	3 (100)	3 (100)	3 (100)	0 (0.0)	2 (66.7)	1 (33.3)	3 (66.7)	3 (66.7)
Kluyvera spp	5 (21.7)	5 (100)	5 (100)	5 (100)	5 (100)	5 (100)	5 (100)	5 (100)	5 (100)	5 (100)	5 (100)	5 (100)	4 (80.0)	4 (80.0)	4 (80.0)	2 (40.0)	3 (60.0)	3 (60.0)	4 (80.0)	1 (20.0)	1 (20.0)	4 (80.0)	5 (100)	2 (40.0)
R. ornithinolytica	1 (4.3)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	1 (100)	1 (100)	1 (100)	1 (100)	0 (0.0)	1 (100)	1 (100)	0 (0.0)
S. fonticola	2 (8.7)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	1 (50.0)	1 (50.0)	0 (0.0)	1 (50.0)	1 (50.0)	1 (50.0)	1 (50.0)	2 (100)	2 (100)	2 (100)	2 (100)	1 (50.0)
S. odorifera 1	2 (8.7)	2 (10.0)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	2 (100)	1 (50.0)	0 (0.0)	2 (100)	2 (100)	2 (100)	0 (0.0)	0 (0.0)	2 (100)	2 (100)	2 (100)
Total	40 (100)	40 (100)	40 (100)	40 (100)	40 (100)	28 (70.0)	38 (95.0)	38 (95.0)	36 (90.0)	37 (92.5)	37 (92.5)	33 (82.5)	32 (80.0)	27 (67.5)	21 (52.5)	20 (50.0)	30 (75.0)	30 (75.0)	32 (85.0)	30 (75.0)	23 (57.5)	23 (57.5)	26 (65.0)	25 (62.5)

Open in a new tab

^astrains presenting an intermediate phenotype (I) to the antibiotic.

Abbreviations: AKN, amikacin; AMC, amoxicillin + clavulanate; AMP, ampicillin; C. koseri/farmeri, Citrobacter koseri/farmeri; CAZ, ceftazidim; CFM, cefixim; CFT, cefolatine; CIP, ciprofloxacin; CS, colistin; CXT, cefoxitin; E. Cloacae, Enterobacter cloacae; E. coli, Escherichia coli; E. gergoviae, Enterobacter gergoviae; E. sakazakii, Enterobacter sakasakii; ERT, ertapenem; FEP, cefepime; FOS, fosfomycin; FUR, nitrofurantoin; GEN, gentamicin; IMI, imipenem; K. oxytoca, Klebsiella oxytoca; K. pneumoniae, Klebsiella pneumoniae; LVX, levofloxacin; OFL, ofloxacin; P. mirabilis, Proteus mirabilis; PIC, piperacillin; R. ornithinolytica, Raoultella ornithinolytica; S. fonticola, Serratia fonticola; S. marcescens, Serratia marcescens; S. odorifera 1, Serratia odorifera 1; TIC, ticarcillin; TOB, tobramycin; TSU, co‐trimoxazole; TZP, piperacillin + tazobactam; Y. intermedia, Yersinia intermedia.

Among the 40 strains of BSβL‐En screened for the susceptibility tests, resistance rates of 81.8% ± 0.16% and 61.7% ± 0.04% were obtained for the usual antibiotics and those of last resort. The different resistance profiles of the BSβL‐En are shown in Table 5.

Analysis of the results presented in Table 5 showed that all the strains were resistant to AMP, TIC and PIC with resistance rates of 100.0%. These rates varied in the presence of β‐lactamase inhibitors (AMC and TZP). The overall resistance rate was 70.0% for TZP and 100.0% for the AMC. High resistance rates to cephalosporins were also observed, including cephalotin (95.0%), cefixime (95.0%), cefoxitin (90.0%), cefotaxime (92.5%), ceftazidime (92.5%), and FEP (82.5%). Similarly, high resistance rates were recorded for aminoglycosides, with 80.0%, 67.5%, and 52.5% for gentamicin, tobramycin, and amikacin, respectively. Comparable resistance patterns were observed for other antibiotic classes, including cotrimoxazole (85.0%), ofloxacin (75.0%), ciprofloxacin (75.0%), fosfomycin (75.0%), nitrofurantoin (57.5%), and levofloxacin (50.0%). Finally, resistance to last‐resort antibiotics was also notable, with rates of 57.5% for imipenem, 62.5% for colistin, and 65.0% for ertapenem.

3.1.4. Molecular Typing of BSβL‐En Strains and Characterization of Resistance Genes

Of the 40 presumptive BSβL‐En strains, 35 (87.5%) were positive for the bla genes screened. The various Enterobacterales producing these genes are shown in Table 6.

Table 6.

Distribution of BSβL types, carbapenem and colistin resistance genes, as well as associations between ESβL/resistance genes according to bacterial strains.

Strains		BSβL								Molecular prevalence of resistance
	Number of isolates	CTX‐M	TEM	IMP	TEM/CTX‐M	IMP/CTX‐M	IMP/TEM	CARBA/CTX‐M	CARBA/TEM/CTX‐M	IMP	CARBA	Mcr1/2
	n/N	n/N	n ^′/N	n/N	n/N	n/N	n/N	n/N	n/N	n/N	n/N	n/N
Citrobacter koseri/farmeri	0/1 (0, 0)	—	—		—	—	—	—	—	—	—	—
Enterobacter cloacae	8/8 (100.0)	5/8 (62.5)	—		—	1/8 (12.5)	1/8 (12.5)	1/8 (12.5)	—	2/8 (25.0)	1/8 (12.5)	—
Enterobacter gergoviae	1/1 (100.0)	—	—		—	—	—	—	1/1 (100.0)	—	1/1 (100)	—
Enterobacter sakasakii	1/2 (50.0)	1/1 (50.0)	—		—	—	—	—	—	—	—	—
Escherichia coli	6/6 (100.0)	—	3/6 (50.0)	1/6 (16.7)		1/6 (33.33)	—		1/6 (16.66)	2/5 (40.0)	1/5 (20.0)	—
Klebsiella oxytoca	1/1 (100.0)	—	—		—	1/1 (100.0)	—	—	—	1/1 (100.0)	—	—
Klebsiella pneumoniae	4/4 (100.0)	2/4 (50.0)	—		2/4 (50.0)	—	—	—	—	—	—	—
Kluyvera spp	5/5 (100.0)	2/5 (40.0)	—		1/5 (20.0)	1/5 (20.0)	—		1/5 (20.0)	1/5 (20.0)	1/5 (20.0)	—
Proteus mirabilis	1/5 (25.0)	—	—		—	—	—	1/5 (20.0)	—	—	1/4 (25.0)	—
Raoultella ornithinolytica	1/1 (100.0)	—	—		—	—	—	1/1 (100.0)	—	—	1/1 (100.0)	—
Serratia fonticola	2/2 (100.0)	1/2 (50.0)	—		—	1/2 (50.0)	—	—	—	1/2 (50.0)	—	—
Serratia marcescens	1/1 (100.0)	—	—			—	—	—	1/1 (100.0)	—	1/1 (100.0)	—
Serratia odorifera 1	3/3 (100.0)	2/3 (66.7)	—		—	—	—	1/3 (33.33)	—	—	1/3 (33.33)	—
Yersinia intermedia	1/1 (100.0)	1/1 (100.0)	—		—	—	—	—	—	—	—	—
Total	35/40 (87.5)	14/35 (40.0)	3/35 (8.6)	1/35 (2.9)	3/35 (8.6)	5/35 (14.3)	1/35 (2.9)	4/35 (11.4)	4/35 (11.4)	7/40(17.5)	8/40(20.0)	0/40 (0.0)

Open in a new tab

The analysis of the results in Table 6 shows that the bla _CTX-M genes were detected in 31 strains (88.6%), of which 14 (40.0%) harbored bla _CTX-M alone, whereas the other 3 (8.6%) harbored bla _CTX-M in combination with bla _TEM. However, 3 strains (8.6%) were positive for the bla _TEM gene (Table 6). Concerning the diversity of carbapenememases, the bla _CARBA and bla _IMP genes were detected in 15 (42.935%) strains. Only one strain (2.9%) harbored bla _IMP alone, whereas the other 5 (14.3%) harbored bla _IMP in association with bla _CTX-M and 2 others the bla _IMP-TEM genes. The bla _CARBA gene was only detected in association with bla _CTX-M (11.4%) alone or with bla _TEM (11.4%).

Furthermore, of the 40 strains that were molecularly screened, 15 (37.5%) possessed carbapenem resistance genes and none harbor colistin resistance genes.

3.1.5. Correlation Between BSβL Typing and Phenotypic Resistance Profiles

Overall, kappa statistics indicated a lack of substantial agreement between the presence of BSBL‐producing Enterobacterales and antimicrobial susceptibility profiles. However, statistically significant associations were observed, particularly within the AmpC–ESBL co‐producing group. For this profile, agreement with imipenem was classified as moderate according to the Landis and Koch interpretation scale, with a kappa coefficient of 0.375 (95% CI: 0.12–0.63). In contrast, agreement with cefoxitin was considered fair, with a kappa value of 0.261 (95% CI: 0.01–0.51). Significant associations were also observed between this group and TZP as well as amikacin, suggesting specific phenotypic correlations despite overall heterogeneity in resistance patterns.

4. Discussion

The aim of this study was to describe the epidemiology of uropathogenic strains of BSβL‐En isolated in Libreville, Gabon, and to determine their resistance profiles to both first‐line and last‐resort antibiotics.

In the present study, UTIs diagnosed at the HIAOBO in Libreville between October and December 2019 were more frequent in women (70.4%). These results are similar to those reported in other studies [25–27]. Various factors predispose women to this type of infection, essentially their anatomical predisposition [25–27]. Indeed, the proximity between the genital and anal orifices in women facilitates the proliferation of germs toward the urethra which is also shorter [28].

This study included different age groups and it appears that most cases of UTIs were observed in patients aged 21 to 40 years (48.2%). These results are in agreement with those obtained from previous studies in Africa [25, 29]. They could be explained by the fact that subjects aged 20 to 40 have higher sexual activity [30]. The increased number of sexual partners and their capacity to check in hospital structures independently would explain their high number [28, 31, 32]. However, these results contrast with those reported in a study by Kot et al., [27] which showed that the rate of asymptomatic and symptomatic UTI was higher in patients in the age group of 60 years and older.

Partly the patients in this study came from a community setting (17.6%). This turnout can be explained by the fact that the hospital is the first place indicated for health care and for future patients seeking treatment or wishing to know their health status [31]. In addition, the cytobacteriological examination of urine (CBEU) is one of the most prescribed community examinations [33].

The overall prevalence of UTI in this study (18.31%) was comparable to those in Nepal [34], Libya [35], and Ethiopia [36], with 15.2%; 20.0% and 21.1%, respectively, but lower than those reported in Argentina, Saudi Arabia, and other regions of Gabon [14, 15, 37, 38]. The contrast observed between these results, in particular the low incidence in this study, may probably be explained by the epidemiological variability of UTIs, the differences in age, gender, the number of patients examined, the period of the study and the types of media chosen for the isolation the strains [31, 35]. In addition, the choice of the type of pathogens sought during this work, namely ESβL, compared to the study of Yala et al., [21] which only targeted. Enterobacterales responsible for UTIs in the same health care structure would also explain the low recorded prevalence [16].

Gram‐negative bacilli were the predominant uropathogens (81.5%), with Enterobacterales being the most frequently isolated group, consistent with previous literature [34, 39]. In addition, these Enterobacterales present resistance profile toward broad‐spectrum cephalosporins that seems to be at the origin of several types of infections [40, 41]. This resistance trait is mainly due to the production of β‐lactamases in particular, ESβLs and AmpCs or even carbapenemase, which reduce therapeutic options [40, 41]. This study showed that 40/54 (74.1%) of the strains of Enterobacterales isolated from community UTIs are producers of β‐lactamases of the ESβL, AmpC and carbapenemase types. E. cloacae (14.8%), E. coli (11.1%), Kluyvera spp (9.3%) and K. pneumoniae (7.4%) species were the most common ones. These same uropathogens are also isolated in other studies although with a predominance of E. coli and K. pneumoniae [35, 42, 43]. These results also show that the prevalence of strains producing BSβL vary not only according to geographical areas, but also according to the types and species of uropathogens sought [44].

The present study recorded a phenotypic isolation rate of 72.5% of ESβL‐En. This frequency is similar to that obtained in the studies of Ugwu et al. [42] (96.0%) in Nigeria, Yala et al. [21] (61%) in Gabon, and much lower than that recorded in Gabon by Dikoumba et al. [45] (11.8%), Gebremichael et al. [46] (44.0%) in Ethiopia, and Kot et al. [27] (32.7%) in Poland. The bla _CTX-M gene is the most commonly found gene in 70.59% of cases. The high prevalence of CTX‐M ESβL corroborates the current epidemiological trend reported by numerous studies [21, 43, 45]. Indeed, CTX‐M enzymes currently overlap with other ESβLs and have spread in the community environment, mainly due to their presence in highly mobilizable genetic areas of plasmids and transposons [47]. This expansion would probably be related to a widespread prescription of 3rd generation cephalosporins (cefotaxime and ceftriaxone) in treatments including UTIs [48, 49]. The data recorded largely corroborate the expansion of ESβL within strains of Enterobacterales in our country and in particular within uropathogens complicating the management of patients.

The high detection of BSβL would clearly be correlated with the co‐expression of ESβL‐AmpC enzymes of which 23 strains (57.5%) were produced in this study. In addition, 17.0% of the strains were also producing AmpC‐type β‐lactamases alone. The results obtained are comparable to those recorded by Perera et al. [50], whose prevalence was 19.0%. The co‐expression of ESβL and/or AmpC β‐lactamases is now identified as a major cause of resistance in species of the Enterobacterales family and seems to be related to the prescription of antibiotic therapy during the treatment of this infection [44, 51]. Furthermore, ESβL/AmpC genes are mostly located on mobile genetic elements such as plasmids, some of which are regarded as epidemic which would undoubtedly justify their presence [52].

Phenotypic carbapenemase production was observed in 10.0% of isolates, a rate comparable to studies from Egypt and Sri Lanka [50, 53], but higher than previous reports from Gabon (1.64%) [54]. Molecular analysis identified bla_IMP and bla _CARBA genes although regional studies from Africa and Asia more commonly report bla _NDM and bla _OXA-48 variants [53, 55]. Furthermore, comparison of our findings with those of Dikoumba et al. [54], whose isolates were also collected in Gabon, suggests geographic heterogeneity in carbapenemase distribution within Gabon in the various towns of Franceville vs. Libreville, Mouila, and Tchibanga.

The different BSβL isolates obtained showed resistance rates of 81.8% and 61.7%, respectively, for common antibiotics and those of last resort. The high rate of resistance to common antibiotics supports the current pattern of ESβL/AmpC‐En resistance to other antibiotic families [47, 51]. Although carbapenems remain the molecules of choice against these ESβL and AmpC producing strains, the nonprescription of these molecules would clearly complicate the treatment of UTIs due to the prevalence of BSβL‐En in our countries. In addition, therapeutic alternatives that include conventional combinations such as β‐lactam + β‐lactamase inhibitors, cephamycins, temocillin, aminoglycosides, tigecycline, and fosfomycin [51] do not seem to be judicious treatments in Gabon considering the high rates of resistance to fosfomycin (75.0%), and aminoglysosides, respectively, to gentamicin (80.0%), tobramycin (67.5%), and amikacin (52.5%) recorded in this study.

Moreover, carbapenems and colistin are considered last‐resort antibiotics for the treatment of BSβL‐En and knowledge of their susceptibility profiles is essential for optimal therapeutic management [56, 57]. Overall, these isolates exhibited a high resistance rate (61.7%) to last‐resort antibiotics. In this study, high levels of phenotypic resistance to ertapenem (65%) and imipenem (57.5%) was observed.

These findings are consistent with those reported in other studies, although the specific antibiotics tested differed within the same class. Indeed, Pandit et al., [34] reported resistance rates of 90.3% and 83.8% to imipenem and meropenem, respectively, likewise Krir et al., found 63.2% of ESβL producing isolate were resistant to imipenem [58]. These profiles would probably be justified by the association of a decrease in their membrane permeability and the production of ESβL and/or AmpCs as demonstrated in the literature [59]. In addition, the presence of carbapenemases is also correlated with this decrease or even loss of susceptibility to carbapenems [60, 61] of which 44.1% of ESβL are carriers, thus justifying these phenotypes obtained. Sporadic cases of colistin‐resistant isolates in both hospital and community settings [62] would warrant evaluation of the susceptibility of ESβL in this study to this antibiotic.

Sporadic cases of colistin‐resistant isolates in both hospital and community settings [62] justify the evaluation of the susceptibility of ESβL in this study to this antibiotic. The absence of mcr‐1 and mcr‐2 genes despite phenotypic colistin resistance (62.5%), suggests alternative mechanisms, including chromosomal mutations affecting regulatory systems such as pmrA/pmrB and phoP/phoQ, as well as lipid A modifications [59, 63]. Plasmid‐mediated resistance mechanisms surch as IncHI2 plasmid co‐transmissible and carriers of the mcr-1 gene were not investigated in this study but could also contribute to resistance not only to colistin, cephalosporins and carbapenems [64]. Although the mcr-1 and mcr-2 genes were not detected in this study, this high phenotypic resistance to colistin could be attributed to production of ESβLs and AmpC. Indeed, Gram‐negative bacteria producing ESβL, MBL and AmpC hosting the mcr genes on the same plasmid have been reported [65].

Furthermore, the fact that CTX‐M genes, naturally chromosomally mediated in Enterobacterales species, are easily transmitted by conjugation in vivo via a plasmid between them, would not only explain the high expression but also the emergence of this type of ESβL [66]. This would explain why it is the most frequently associated in this study (66.7%; n = 10/15) compared to TEM‐type ESβL (6.7%; n = 1/15). At the same time, the high levels would be explained by the association or cohabitation of bla genes within strains that would promote ESβL resistance to last‐line antibiotics [67].

Finally, limitations of this study include the restricted molecular characterization of ESβL genes, the absence of AmpC, carbapenemase, and mcr genes panels beyond selected targets. Furthermore, the use of antibiotic‐supplemented culture media at concentrations above standard recommendations may have influenced bacterial recovery rates.

5. Conclusion

In conclusion, this study shows that BSβL‐En are involved in UTIs in Libreville, Gabon with the two prominent species being E. cloacae and E. coli. These strains have high prevalence rates of production of BSβL of which the most predominant are β‐lactamases of the AmpC and ESβL types. The most common genetic support for BSβL is CTX‐M type. In addition, these BSβL‐En show high rates of resistance to both first‐ and last‐line therapeutic antibiotics. The presence of bla _IMP and bla _CARBA genes confirms the genetic support of carbapenem resistance and circulating carbapenemases.

Given these concerning findings, strengthened surveillance of uropathogens through systematic screening of clinical isolates and continuous monitoring of antimicrobial resistance trends is essential at both local and national levels.

Nomenclature

AKN: amikacin
AMC: amoxicillin + clavulanate
AMP: ampicillin
API: Analysis of Identification Profiles
AZT: aztreonam
BCC: heart–brain agar
BSβL‐En: broad‐spectrum beta‐lactamase‐producing Enterobacterales
CA‐SFM: Antibiogram Community of the French Microbiology Society
CAZ: ceftazidime
CFM: cefixime
CFT: cefolatine
CIP: ciprofloxacin
CS: colistin
CTX: cefotaxime
CXT: cefoxitin
DNA: deoxyribonucleic acid
EAS: emergency ambulatory service
ERT: ertapenem
ESβL: extended‐Spectrum β‐lactamase
ESβL‐En: extended‐spectrum β‐lactamase‐producing Enterobacterales
FEP: cefepime
FOS: fosfomycin
FOX: cefoxitin
FUR: nitrofurantoin.
GEN: gentamicin
HIAOBO: Hôpital D′Instruction des Armées Omar Bongo Ondimba
IMI: Imipenem
LABMC: Laboratory of Molecular and Cellular Biology
LVX: levofloxacin
McC‐CTX: MacConkey agar supplemented with cefotaxime
MIC: minimal inhibitory concentration
OFL: ofloxacin
PCR: polymerase chain reaction
PIC: piperacillin
TBE: Tris‐borate‐EDTA
TIC: ticarcillin
TOB: tobramycin
TSU: co‐trimoxazole
TZP: piperacillin + tazobactam
USTM: Masuku University of Sciences and Technology
UTIs: urogenital tract infections

Author Contributions

All authors contributed to the study conception and design. Material preparation, data collection, and analysis were performed by Ornella Zong Minko, Jean Fabrice Yala, Rolande Mabika Mabika, and Franck Mounioko. The technical platform and sample collection site were provided by Anicet C. Dikoumba and Elvire Anita Mbongo‐Kama. The first draft of the manuscript was written by Ornella Zong Minko, Rolande Mabika, Jean Fabrice Yala, and Alain SOUZA. And all authors commented on previous versions of the manuscript.

Funding

No funding was received for this manuscript.

Disclosure

All authors read and approved the final manuscript.

Ethics Statement

The study was approved by the Gabonese National Ethics Committee for Research and the Ministry of Health (PROT N° 0020/2015/SG/CNE) and was conducted in accordance with the ethical standards of the 1964 Declaration of Helsinki.

Conflicts of Interest

The authors declare no conflicts of interest.

Acknowledgments

All authors cited in this document for their scientific contributions.

Yala, Jean Fabrice , Minko, Ornella Zong , Mabika, Rolande Mabika , Mounioko, Franck , Mbongo‐Kama, Elvire Anita , Dikoumba, Annicet Clotaire , Souza, Alain , Molecular Characterization and Antibiotic Resistance of Broad‐Spectrum β‐Lactamase‐Producing Enterobacterales in Urinary Tract Infections in Libreville, Gabon, International Journal of Microbiology, 2026, 3553027, 15 pages, 2026. 10.1155/ijm/3553027

Academic Editor: Shweta Negi

Contributor Information

Jean Fabrice Yala, Email: yalajeanfabrice@gmail.com.

Shweta Negi, Email: kshwetakal@wiley.com.

Data Availability Statement

The data that support the findings of this study are openly available in BioStudies at https://www.ebi.ac.uk/biostudies/studies/S-BSST1054, reference number:S‐BSST1054.

References

1. Rakotovao-Ravahatra Z. D., Randriatsarafara F. M., Rasoanandrasana S., Raverohanta L., and Rakotovao A. L., Resistant Phenotypes of Escherichia coli Strains Responsible for Urinary Tract Infection in the Laboratory of the University Hospital Joseph Raseta Befelatanana, Antananarivo, Pan African Medical Journal. (2017) 26, 10.11604/pamj.2017.26.166.11828. [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Yamaji R., Rubin J., Thys E., Friedman C. R., and Riley W., crossm Persistent Pandemic Lineages of Uropathogenic Escherichia coli in a College Community from 1999 to 2017, Journal of Clinical Microbiology. (2018) 56, no. 4, e01817–e01834, 10.1128/JCM.01834-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
3. Stefaniuk E., Suchocka U., Bosacka K., and Hryniewicz W., Etiology and Antibiotic Susceptibility of Bacterial Pathogens Responsible for Community-Acquired Urinary Tract Infections in Poland, European Journal of Clinical Microbiology and Infectious Diseases. (2016) 35, no. 8, 1363–1369, 10.1007/s10096-016-2673-1, 27189078. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Kaur R. and Kaur R., Symptoms, Risk Factors, Diagnosis and Treatment of Urinary Tract Infections, Postgraduate Medical Journal. (2021) 97, no. 1154, 803–812, 10.1136/postgradmedj-2020-139090, 33234708. [DOI] [PubMed] [Google Scholar]
5. Mengistu D. A., Alemu A., Abdukadir A. A., Mohammed Husen A., Ahmed F., and Mohammed B., Incidence of Urinary Tract Infection Among Patients: Systematic Review and Meta-Analysis, Inquiry. (2023) 60, 469580231168746, 10.1177/00469580231168746, 37096884. [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Leblanc A., Blondeau C., Holowacz S., Langlois C., and Haddioui L., Synergistic Effect of Cinnamon and Cranberry Extracts on the Inhibition of Uropathogenic Escherichia coli Adherence to Uroepithelial Cells, Phytothérapie. (2019) 17, no. 4, 196–200, 10.3166/phyto-2019-01787. [DOI] [Google Scholar]
7. Kline K. A. and Lewis A. L., Gram-Positive Uropathogens, Polymicrobial Urinary Tract Infection, and the Emerging Microbiota of the Urinary Tract, Microbiol Spectrum. (2016) 4, no. 2, 10.1128/microbiolspec.UTI-0012-2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Moragianni D., Dryllis G., Andromidas P., Kapeta-Korkouli R., Kouskouni E., Pessach I., Papalexis P., Kodonaki A., Athanasiou N., Pouliakis A., and Baka S., Genital Tract Infection and Associated Factors Affect the Reproductive Outcome in Fertile Females and Females Undergoing in Vitro Fertilization, Biomed Reports. (2019) 10, no. 4, 231–237, 10.3892/br.2019.1194, 30972218. [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Fagan M., Lindbæk M., Grude N., Reiso H., Romøren M., Skaare D., and Berild D., Antibiotic Resistance Patterns of Bacteria Causing Urinary Tract Infections in the Elderly Living in Nursing Homes Versus the Elderly Living at Home: An Observational Study, BMC Geriatrics. (2015) 15, no. 15, 10.1186/s12877-015-0097-x, 26238248. [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Bader M. S., Loeb M., and Brooks A. A., An update on the Management of Urinary Tract Infections in the Era of Antimicrobial Resistance, Postgraduate Medicine. (2017) 129, no. 2, 242–258, 10.1080/00325481.2017.1246055. [DOI] [PubMed] [Google Scholar]
11. Sbiti M., Lahmadi K., and Lhoussaine L., Epidemiological Profile of Uropathogenic Enterobacteria Producing Extended Spectrum Beta-Lactamases, Pan African Medical Journal. (2017) 28, 10.11604/pamj.2017.28.29.11402. [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Mabika Mabika R., Oyegue Llabagui S. L., Mounioko F., Moussavou M.-G., Affiri Odzame J., and Souza A., Study of the Sensitivity to Carbapenems in the Escherichia coli Isolated From Childhood Diarrhea at the Paul Moukambi Hospital Center of Koula-Moutou, International Journal of Innovative Science and Research. (2019) 8, no. 6, 1411–14117. [Google Scholar]
13. Yala J. F., Mabika Mabika R., Mounioko F., Zong Minko O., Lepengue A. N., and Souza A., Evaluation In Vitro De L′Activité Antibactérienne De Tephrosia vogelii Hook.F, Et Potentialisation De L′Activité Des De L′Imipenème Sur Des Souches D′E. coli , Scholars Academic Journal of Pharmacy. (2020) 9, no. 1, 36–45. [Google Scholar]
14. Ndong Atome G. R., Mbongo Kama E., Padzys G. S., Lekongo Moungomo C.-M., Ondo J. P., and Lebibi J., Antibiotic Reistance of Bacteria Causing Urinary Tract Infections, International Journal of Innovative Science and Research. (2019) 8, no. 1, 1345–1350. [Google Scholar]
15. Ndzime Y. M., Onanga R., Kassa Kassa R. F., Bignoumba M., Mbehang Nguema P. P., Gafou A., Lendamba R. W., Mbombe Moghoa K., and Bisseye C., Epidemiology of Community Origin Escherichia coli and Klebsiella pneumoniae Uropathogenic Strains Resistant to Antibiotics in Franceville Gabon, Infection and Drug Resistance. (2021) 16, no. 14, 585–594, 10.2147/IDR.S296054. [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Garrec H., Drieux-Rouzet L., Golmard J.-L., Jarlier V., and Robert J., Comparison of Nine Phenotypic Methods for Detection of Extended-Spectrum β -Lactamase Production, Journal of Clinical Microbiology. (2011) 49, no. 3, 1048–1057, 10.1128/JCM.02130-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
17. Robin F., Gibold L., and Bonnet R., Intrinsic or Acquired Resistant to β-Lactams in Enterobacteriaceae: How to Identify Them in Clinical Practice, Revue Francophone des Laboratoires 2012. (2012) 445, 47–58, 10.1016/S1773-035X(12)71676-3. [DOI] [Google Scholar]
18. Philippon A. and Arlet G., Gram-Negative Bacteria: Novelties About Beta-Lactamases After 15 Years, Antibiotiques. (2005) 7, 247–259, 10.1016/S1294-5501(05)80458-3. [DOI] [Google Scholar]
19. Ruppé É., Woerther P. L., and Barbier F., Mechanisms of Antimicrobial Resistance in Gram-Negative Bacilli, Annual Intensive Care. (2015) 5, no. 1, 10.1186/s13613-015-0061-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Nordmann P., Gniadkowski M., Giske C. G., Poirel L., Woodford N., and Miriagou V., Identification and Screening of Carbapenemase-Producing Enterobacteriaceae , Clinical Microbiology and Infection. (2012) 18, no. 5, 432–438, 10.1111/j.1469-0691.2012.03815.x. [DOI] [PubMed] [Google Scholar]
21. Yala J., Mabika R. M., Bisseye C., and Kenguele H., Phenotypic and Genotypic Characterization of Enterobacteriaceae (ESBLE) in Patients Attending Omar Bongo Ondimba Military Hospital at Libreville (Gabon), Current Research in Microbiology and Biotechnology. (2016) 4, no. 6, 944–949. [Google Scholar]
22. Mosquito S., Ruiz J., Pons M. J., Durand D., Barletta F., and Ochoa T. J., Molecular Mechanisms of Antibiotic Resistance in Diarrhoeagenic Escherichia coli Isolated From Children, International Journal of Antimicrobial Agents. (2012) 40, no. 6, 544–548, 10.1016/j.ijantimicag.2012.07.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Zhang J., Wang J., Chen L., Yassin A. K., Kelly P., Butaye P., Li J., Gong J., Cattley R., Qi K., and Wang C., Housefly (Musca domestica) and Blow Fly (Protophormia terraenovae) as Vectors of Bacteria Carrying Colistin Resistance Genes, Applied and environmental microbiology. (2017) 84, no. 1, e01717–e01736, 10.1128/AEM.01736-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
24. McHugh M. L., Lessons in Biostatistics Interrater Reliability: the Kappa Statistic, Biochem Medica (Zagreb).(2012) 22, no. 3, 276–282, 23092060. [PMC free article] [PubMed] [Google Scholar]
25. Tajbakhsh E., Tajbakhsh S., and Khamesipour F., Isolation and Molecular Detection of Gram Negative Bacteria Causing Urinary Tract Infection in Patients Referred to Shahrekord Hospitals, Iranian Red Crescent Medical Journal. (2015) 17, no. 5, e24779, 10.5812/ircmj.17(5)2015.24779. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Amrani R., Messaoudi S., Benajiba N., Rkain M., Frikh M., and Elouennass M., Les Infections Urinaires Infantiles Au Centre Hospitalier Universitaire Mohammed VI D′Oujda (Maroc), Journal de pédiatrie et de puériculture. (2019) 4, no. 1, 1–8. [Google Scholar]
27. Kot B., Gruzewska A., Szweda P., Wicha J., and Parulska U., Antibiotic Resistance of Uropathogens Isolated From Patients Hospitalized in District Hospital in Central Poland in 2020, Antibiotics. (2021) 10, no. 4, 10.3390/antibiotics10040447. [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Odoki M., Aliero A. A., Tibyangye J., Maniga J. N., Wampande E., Kato C. D., Agwu E., and Bazira J., Prevalence of Bacterial Urinary Tract Infections and Associated Factors Among Patients Attending Hospitals in Bushenyi District , Uganda, International Journal of Microbiology. (2019) 2019, no. 2019, 4246780, 10.1155/2019/4246780, 30906323. [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Sime T. W., Biazin H., Zeleke T. A., and Desalegn Z., Urinary Tract Infection in Cancer Patients and Antimicrobial Susceptibility of Isolates in Tikur Anbessa Specialized Hospital, Addis Ababa, Ethiopia, PLoS One. (2020) 15, e0243474, 10.1371/journal.pone.0243474. [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Fornage S. and Bianchi-Demicheli F., Sexual Medicine in Lausanne: Past, Present and Future, Revue Medicale Suisse. (2017) 13, no. 554, 607–610. [PubMed] [Google Scholar]
31. Tia N. and Lal M., Bacteria Associated With Urinary Tract Infection (UTI), International Journal of Current Microbiology and Applied Sciences. (2016) 5, no. 8, 248–254, 10.20546/ijcmas.2016.508.025. [DOI] [Google Scholar]
32. Armand-Lefèvre L., Antibiotic Resistance in the Community: Myth or Reality? The Threat of ESBL Producing Enterobacteria, Journal des Anti-infectieux. (2017) 19, no. 1, 1–6, 10.1016/j.antinf.2017.01.004. [DOI] [Google Scholar]
33. Hailaji N. S. M., Ould Salem M. L., and Ghaber S. M., Sensitivity to Antibiotics Uropathogens Bacteria in Nouakchott-Mauritania, Progrès en Urologie. (2016) 26, no. 6, 346–352, 10.1016/j.purol.2016.04.004, 27211808. [DOI] [PubMed] [Google Scholar]
34. Pandit R., Awal B., Shrestha S. S., Joshi G., Rijal B. P., and Parajuli N. P., Extended-Spectrum β -Lactamase (ESBL) Genotypes Among Multidrug-Resistant Uropathogenic Escherichia coli Clinical Isolates From a Teaching Hospital of Nepal, Interdisciplinary Perspectives on Infectious Diseases. (2020) 2020, no. 2020, 6525826, 10.1155/2020/6525826, 32377184. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Abujnah A. A., Zorgani A., Sabri M. A. M., El-Mohammady H., Khalek R. A., and Ghenghesh K. S., Multidrug Resistance And Extended-Spectrum β-Lactamases Genes Among Escherichia coli From Patients With Urinary Tract Infections in Northwestern Libya, Libyan Journal of Medicine. (2015) 10, no. 1, 26412, 10.3402/ljm.v10.26412, 25651907. [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Gebremariam G., Legese H., Woldu Y., Araya T., Hagos K., and Gebreyesuswasihun A., Bacteriological Profile, Risk Factors and Antimicrobial Susceptibility Patterns of Symptomatic Urinary Tract Infection Among Students of Mekelle University, Northern Ethiopia, BMC Infectious Diseases. (2019) 19, no. 1, 10.1186/s12879-019-4610-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Marchisio M., Porto A., Joris R., Rico M., Baroni M. R., and Di Conza J., Susceptibility to β-Lactams and Quinolones of Enterobacteriaceae Isolated From Urinary Tract Infections in Outpatients, Brazilian Journal Microbiology. (2015) 46, no. 4, 1155–1159, 10.1590/S1517-838246420140880. [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Ahmed S. S., Shariq A., Alsalloom A. A., Babikir I. H., and Alhomoud B. N., Uropathogens and Their Antimicrobial Resistance Patterns: Relationship With Urinary Tract Infections, International Journal of Health Sciences. (2019) 13, no. 2, 48–55, 30983946. [PMC free article] [PubMed] [Google Scholar]
39. Bitew A., Molalign T., and Chanie M., Species Distribution and Antibiotic Susceptibility Profile of Bacterial Uropathogens Among Patients Complaining Urinary Tract Infections, BMC Infectious Diseases. (2017) 17, no. 1, 10.1186/s12879-017-2743-8, 28962545. [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Toudji A. G., Djeri B., Karou S. D., Tigossou S., Ameyapoh Y., and De Souza C., Prévalence des souches d’entérobactéries productrices de bêta-lactamases à spectre élargi isolées au Togo et de leur sensibilité aux antibiotiques, International Journal of Biological and Chemical Sciences. (2017) 11, no. 3, 10.4314/ijbcs.v11i3.19. [DOI] [Google Scholar]
41. Anesi J. A., Lautenbach E., Nachamkin I., Garrigan C., Warren B., Wheeler M., Tolomeo P., and Han J. H., Clinical and Molecular Characterization of Community-Onset Urinary Tract Infections Due to Extended-Spectrum Cephalosporin-Resistant Enterobacteriaceae , Infection Control and Hospital Epidemiology. (2016) 37, no. 12, 1433–1439, 10.1017/ice.2016.225, 27678022. [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Ugwu M. C., Shariff M., Nnajide C. M., Beri K., Okezie U. M., Iroha I. R., and Esimone C. O., Phenotypic and Molecular Characterization of β-Lactamases Among Enterobacterial Uropathogens in Southeastern Nigeria, Canadian Journal of Infectious Diseases and Medical Microbiology. (2020) 2020, no. 1, 5843904, 10.1155/2020/5843904, 32184910. [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Eltai N. O., Al Thani A. A., Al-Ansari K., Deshmukh A. S., Wehedy E., Al-Hadidi S. H., and Yassine H. M., Molecular Characterization of Extended Spectrum β-Lactamases Enterobacteriaceae Causing Lower Urinary Tract Infection Among Pediatric Population, Antimicrobial Resistance and Infection Control. (2018) 7, no. 7, 10.1186/s13756-018-0381-6, 30069306. [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Mohamed E. S., Khairy R. M. M., and Abdelrahim S. S., Prevalence and Molecular Characteristics of ESBL and AmpC β-Lactamase Producing Enterobacteriaceae Strains Isolated From UTIs in Egypt, Antimicrobial Resistance and Infection Control. (2020) 9, no. 1, 10.1186/s13756-020-00856-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
45. Dikoumba A. C., Onanga R., Boundenga L., Bignoumba M., Ngoungou E. B., and Godreuil S., Prevalence and Characterization of Extended-Spectrum Beta-Lactamase-Producing Enterobacteriaceae in Major Hospitals in Gabon, Microbial Drug Resistance. (2021) 27, 1525–1534, 10.1089/mdr.2020.0497. [DOI] [PubMed] [Google Scholar]
46. Gebremichael S., Tekele T. D. S., Tullu K. D., Birru K., and Legese M. H., Extended-spectrum Beta-lactamase and AmpC Beta-Lactamases Producing Gram Negative Bacilli Isolated From Clinical Specimens at International Clinical Laboratories, Addis Ababa, Ethiopia, PLoS One. (2020) 15, no. 11, e0241984, 10.1371/journal.pone.0241984, 33180785. [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Partridge S. R., Kwong S. M., Firth N., and Jensen S. O., Mobile Genetic Elements Associated With Antimicrobial Resistance, Clinical Microbiology Reviews. (2018) 31, no. 4, 10–1128, 10.1128/CMR.00088-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
48. Jules G. C., Adébayo A. S. C., Yempabou S., and François D., Résistance Bacterienne Au Cours Des Infections Urinaires Chez Les Patients Diabetiques Au Cnhu-Hkm De Cotonou, Benin, Journal de la Société de Biologie Clinique du Bénin. (2016) 24, no. 1, 69–72. [Google Scholar]
49. Manyahi J., Moyo S. J., Tellevik M. G., Ndugulile F., Urassa W., Blomberg B., and Langeland N., Detection of CTX-M-15 Beta-Lactamases in Enterobacteriaceae Causing Hospital- and Community-Acquired Urinary Tract Infections as Early as 2004, in Dar Es Salaam, Tanzania, BMC Infectious Diseases. (2017) 17, no. 1, 10.1186/s12879-017-2395-8, 28415986. [DOI] [PMC free article] [PubMed] [Google Scholar]
50. Perera P. D. V. M., Gamage S., De Silva H. S. M., Jayatilleke S. K., de Silva N., Aydin A. et al., Phenotypic and Genotypic Distribution of ESBL, AmpC β-Lactamase and Carbapenemase-Producing Enterobacteriaceae in Community-Acquired and Hospital-Acquired Urinary Tract Infections in Sri Lanka, Journal of Global Antimicrobial Resistance. (2022) 30, 115–122, 10.1016/j.jgar.2022.05.024, 35667644. [DOI] [PubMed] [Google Scholar]
51. Rodriguez-Baño J., Gutiérrez-Gutiérrez B., Machuca I., and Pascual A., Treatment of Infections Caused by Extended-Spectrum-Beta-, Clinical Microbiology Reviews. (2018) 31, no. 2, e00017–e00079, 10.1128/CMR.00079-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Madec J. Y., Haenni M., Nordmann P., and Poirel L., Extended-Spectrum β-Lactamase/AmpC- and Carbapenemase-Producing Enterobacteriaceae in Animals: A Threat for Humans?, Clinical Microbiology Infection. (2017) 23, 826–833, 10.1016/j.cmi.2017.01.013. [DOI] [PubMed] [Google Scholar]
53. Shaaban M., Elshaer S. L., and Abd El-Rahman O. A., Prevalence of Extended-Spectrum β-Lactamases, AmpC, and Carbapenemases in Proteus mirabilis Clinical Isolates, BMC Microbiology. (2022) 22, no. 1, 10.1186/s12866-022-02662-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
54. Dikoumba A.-C., Onanga R., Jean-Pierre H., Didelot M.-N., Dumont Y., Ouedraogo A.-S., Ngoungou E. B., and Godreuil S., Prevalence and Phenotypic and Molecular Characterization of Carbapenemase-Producing Gram-Negative Bacteria in Gabon, American Journal of Tropical Medicine and Hygiene. (2023) 108, no. 2, 268–274, 10.4269/ajtmh.22-0168, 36535247. [DOI] [PMC free article] [PubMed] [Google Scholar]
55. Dwomoh F. P., Kotey F. C. N., Dayie N. T. K. D., Osei M. M., Amoa-Owusu F., Bannah V., Alzahrani F. M., Halawani I. F., Alzahrani K. J., Egyir B., and Donkor E. S., Phenotypic and Genotypic Detection of Carbapenemase-Producing Escherichia coli and Klebsiella pneumoniae in Accra, Ghana, PLoS One. (2022) 17, no. 12, e0279715, 10.1371/journal.pone.0279715, 36584159. [DOI] [PMC free article] [PubMed] [Google Scholar]
56. Mediavilla J. R., Patrawalla A., Chen L., Chavda K. D., Mathema B., Vinnard C. et al., Colistin-and carbapenem-resistant Escherichia coli harboring mcr-1 and bla NDM-5 Causing a Complicated Urinary Tract Infection in a Patient from the United States, American Society for Microbiology. (2016) 7, no. 4, e01116–e01191, 10.1128/mBio.01191-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
57. Vaara M., Polymyxin Derivatives That Sensitize Gram-Negative Bacteria to Other Antibiotics, Molecules. (2019) 24, no. 2, 10.3390/molecules24020249. [DOI] [PMC free article] [PubMed] [Google Scholar]
58. Krir A., Dhraief S., Messadi A. A., and Thabet L., Profil bactériologique et résistance aux antibiotiques des bactéries isolées dans un service de réanimation des brûlés durant sept ans, Annals of Burns and Fire Disasters. (2019) 32, no. 3, 197–202, 32313533. [PMC free article] [PubMed] [Google Scholar]
59. Mazzariol A., Bazaj A., Cornaglia G., Mazzariol A., Bazaj A., and Cornaglia G., Multi-Drug-Resistant Gram-Negative Bacteria Causing Urinary Tract Infections: A Review, Journal of Chemotherapy. (2017) 29, no. Supplement 1, 2–9, 10.1080/1120009X.2017.1380395. [DOI] [PubMed] [Google Scholar]
60. Golikova M. V., Alieva K. N., Strukova E. N., Kondratieva D. A., Petrova N. F., Petrova M. A., and Zinner S. H., Comparative Meropenem Pharmacodynamics and Emergence of Resistance Against Carbapenem-Susceptible Non-Carbapenemase-Producing and Carbapenemase-Producing Enterobacterales: A Pharmacodynamic Study in a Hollow-Fiber Infection Model, Antibiotics. (2023) 12, no. 12, 10.3390/antibiotics12121717, 38136751. [DOI] [PMC free article] [PubMed] [Google Scholar]
61. Smith H. Z., Hollingshead C. M., and Kendall B., Carbapenem-Resistant Enterobacterales, StatPearls Treasure Island, 2024, StatPearls Publishing. [PubMed] [Google Scholar]
62. Rebelo A. R., Bortolaia V., Kjeldgaard J. S., Pedersen S. K., Leekitcharoenphon P., Hansen I. M., Guerra B., Malorny B., Borowiak M., Hammerl J. A., Battisti A., Franco A., Alba P., Perrin-Guyomard A., Granier S. A., de Frutos Escobar C., Malhotra-Kumar S., Villa L., Carattoli A., and Hendriksen R. S., Multiplex PCR for Detection of Plasmid-Mediated Colistin Resistance Determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for Surveillance Purposes, Eurosurveillance. (2018) 23, no. 6, 17–00672, 10.2807/1560-7917.ES.2018.23.6.17-00672. [DOI] [PMC free article] [PubMed] [Google Scholar]
63. Dortet L., Bonnin R., Jousset A., Gauthier L., and Naas T., The Emergence and Spread of Plasmid-Mediated Resistance to Colistin in Enterobacteriaceae: Compromising the Last Bastion on the Way to Pan-Drug Resistance, Journal des Anti-infectieux. (2016) 18, no. 4, 139–159, 10.1016/j.antinf.2016.09.003. [DOI] [Google Scholar]
64. Fukuda A., Usui M., Okubo T., Tagaki C., Sukpanyatham N., and Tamura Y., Co-harboring of Cephalosporin (bla)/colistin (mcr) Resistance Genes Among Enterobacteriaceae From Flies in Thailand, FEMS Microbiology Letters. (2018) 365, no. 16, 10.1093/femsle/fny178, 30010911. [DOI] [PubMed] [Google Scholar]
65. Arif A., Ullah I., Zaman R., and Khan A. M., Phenotypic Identification of Different β-Lactamases in Intrinsic and Acquired Colistin Resistant Uropathogenic Gram Negative Bacteria, Pakistan Journal of Medical Sciences. (2024) 40, no. 6, 1122–1128, 10.12669/pjms.40.6.8516. [DOI] [PMC free article] [PubMed] [Google Scholar]
66. Touzain F., Le Devendec L., de Boisséson C., Baron S., Jouy E., Perrin-Guyomard A., Blanchard Y., and Kempf I., Characterization of Plasmids Harboring bla _CTX-M and bla _CMY Genes in E. coli From French broilers, PLoS One. (2018) 13, no. 1, e0188768, 10.1371/journal.pone.0188768, 29360838. [DOI] [PMC free article] [PubMed] [Google Scholar]
67. Piccirilli A., Pompilio A., Rossi L., Segatore B., Amicosante G., Rosatelli G., Perilli M., and di Bonaventura G., Identification of CTX-M-15 and CTX-M-27 in Antibiotic-Resistant Gram-Negative Bacteria Isolated From Three Rivers Running in Central Italy, Microbial Drug Resistance. (2019) 25, no. 7, 1041–1049, 10.1089/mdr.2019.0016, 30994417. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are openly available in BioStudies at https://www.ebi.ac.uk/biostudies/studies/S-BSST1054, reference number:S‐BSST1054.

[bib-0001] 1. Rakotovao-Ravahatra Z. D., Randriatsarafara F. M., Rasoanandrasana S., Raverohanta L., and Rakotovao A. L., Resistant Phenotypes of Escherichia coli Strains Responsible for Urinary Tract Infection in the Laboratory of the University Hospital Joseph Raseta Befelatanana, Antananarivo, Pan African Medical Journal. (2017) 26, 10.11604/pamj.2017.26.166.11828. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0002] 2. Yamaji R., Rubin J., Thys E., Friedman C. R., and Riley W., crossm Persistent Pandemic Lineages of Uropathogenic Escherichia coli in a College Community from 1999 to 2017, Journal of Clinical Microbiology. (2018) 56, no. 4, e01817–e01834, 10.1128/JCM.01834-17. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0003] 3. Stefaniuk E., Suchocka U., Bosacka K., and Hryniewicz W., Etiology and Antibiotic Susceptibility of Bacterial Pathogens Responsible for Community-Acquired Urinary Tract Infections in Poland, European Journal of Clinical Microbiology and Infectious Diseases. (2016) 35, no. 8, 1363–1369, 10.1007/s10096-016-2673-1, 27189078. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0004] 4. Kaur R. and Kaur R., Symptoms, Risk Factors, Diagnosis and Treatment of Urinary Tract Infections, Postgraduate Medical Journal. (2021) 97, no. 1154, 803–812, 10.1136/postgradmedj-2020-139090, 33234708. [DOI] [PubMed] [Google Scholar]

[bib-0005] 5. Mengistu D. A., Alemu A., Abdukadir A. A., Mohammed Husen A., Ahmed F., and Mohammed B., Incidence of Urinary Tract Infection Among Patients: Systematic Review and Meta-Analysis, Inquiry. (2023) 60, 469580231168746, 10.1177/00469580231168746, 37096884. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0006] 6. Leblanc A., Blondeau C., Holowacz S., Langlois C., and Haddioui L., Synergistic Effect of Cinnamon and Cranberry Extracts on the Inhibition of Uropathogenic Escherichia coli Adherence to Uroepithelial Cells, Phytothérapie. (2019) 17, no. 4, 196–200, 10.3166/phyto-2019-01787. [DOI] [Google Scholar]

[bib-0007] 7. Kline K. A. and Lewis A. L., Gram-Positive Uropathogens, Polymicrobial Urinary Tract Infection, and the Emerging Microbiota of the Urinary Tract, Microbiol Spectrum. (2016) 4, no. 2, 10.1128/microbiolspec.UTI-0012-2012. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0008] 8. Moragianni D., Dryllis G., Andromidas P., Kapeta-Korkouli R., Kouskouni E., Pessach I., Papalexis P., Kodonaki A., Athanasiou N., Pouliakis A., and Baka S., Genital Tract Infection and Associated Factors Affect the Reproductive Outcome in Fertile Females and Females Undergoing in Vitro Fertilization, Biomed Reports. (2019) 10, no. 4, 231–237, 10.3892/br.2019.1194, 30972218. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0009] 9. Fagan M., Lindbæk M., Grude N., Reiso H., Romøren M., Skaare D., and Berild D., Antibiotic Resistance Patterns of Bacteria Causing Urinary Tract Infections in the Elderly Living in Nursing Homes Versus the Elderly Living at Home: An Observational Study, BMC Geriatrics. (2015) 15, no. 15, 10.1186/s12877-015-0097-x, 26238248. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0010] 10. Bader M. S., Loeb M., and Brooks A. A., An update on the Management of Urinary Tract Infections in the Era of Antimicrobial Resistance, Postgraduate Medicine. (2017) 129, no. 2, 242–258, 10.1080/00325481.2017.1246055. [DOI] [PubMed] [Google Scholar]

[bib-0011] 11. Sbiti M., Lahmadi K., and Lhoussaine L., Epidemiological Profile of Uropathogenic Enterobacteria Producing Extended Spectrum Beta-Lactamases, Pan African Medical Journal. (2017) 28, 10.11604/pamj.2017.28.29.11402. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0012] 12. Mabika Mabika R., Oyegue Llabagui S. L., Mounioko F., Moussavou M.-G., Affiri Odzame J., and Souza A., Study of the Sensitivity to Carbapenems in the Escherichia coli Isolated From Childhood Diarrhea at the Paul Moukambi Hospital Center of Koula-Moutou, International Journal of Innovative Science and Research. (2019) 8, no. 6, 1411–14117. [Google Scholar]

[bib-0013] 13. Yala J. F., Mabika Mabika R., Mounioko F., Zong Minko O., Lepengue A. N., and Souza A., Evaluation In Vitro De L′Activité Antibactérienne De Tephrosia vogelii Hook.F, Et Potentialisation De L′Activité Des De L′Imipenème Sur Des Souches D′E. coli , Scholars Academic Journal of Pharmacy. (2020) 9, no. 1, 36–45. [Google Scholar]

[bib-0014] 14. Ndong Atome G. R., Mbongo Kama E., Padzys G. S., Lekongo Moungomo C.-M., Ondo J. P., and Lebibi J., Antibiotic Reistance of Bacteria Causing Urinary Tract Infections, International Journal of Innovative Science and Research. (2019) 8, no. 1, 1345–1350. [Google Scholar]

[bib-0015] 15. Ndzime Y. M., Onanga R., Kassa Kassa R. F., Bignoumba M., Mbehang Nguema P. P., Gafou A., Lendamba R. W., Mbombe Moghoa K., and Bisseye C., Epidemiology of Community Origin Escherichia coli and Klebsiella pneumoniae Uropathogenic Strains Resistant to Antibiotics in Franceville Gabon, Infection and Drug Resistance. (2021) 16, no. 14, 585–594, 10.2147/IDR.S296054. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0016] 16. Garrec H., Drieux-Rouzet L., Golmard J.-L., Jarlier V., and Robert J., Comparison of Nine Phenotypic Methods for Detection of Extended-Spectrum β -Lactamase Production, Journal of Clinical Microbiology. (2011) 49, no. 3, 1048–1057, 10.1128/JCM.02130-10. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0017] 17. Robin F., Gibold L., and Bonnet R., Intrinsic or Acquired Resistant to β-Lactams in Enterobacteriaceae: How to Identify Them in Clinical Practice, Revue Francophone des Laboratoires 2012. (2012) 445, 47–58, 10.1016/S1773-035X(12)71676-3. [DOI] [Google Scholar]

[bib-0018] 18. Philippon A. and Arlet G., Gram-Negative Bacteria: Novelties About Beta-Lactamases After 15 Years, Antibiotiques. (2005) 7, 247–259, 10.1016/S1294-5501(05)80458-3. [DOI] [Google Scholar]

[bib-0019] 19. Ruppé É., Woerther P. L., and Barbier F., Mechanisms of Antimicrobial Resistance in Gram-Negative Bacilli, Annual Intensive Care. (2015) 5, no. 1, 10.1186/s13613-015-0061-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0020] 20. Nordmann P., Gniadkowski M., Giske C. G., Poirel L., Woodford N., and Miriagou V., Identification and Screening of Carbapenemase-Producing Enterobacteriaceae , Clinical Microbiology and Infection. (2012) 18, no. 5, 432–438, 10.1111/j.1469-0691.2012.03815.x. [DOI] [PubMed] [Google Scholar]

[bib-0021] 21. Yala J., Mabika R. M., Bisseye C., and Kenguele H., Phenotypic and Genotypic Characterization of Enterobacteriaceae (ESBLE) in Patients Attending Omar Bongo Ondimba Military Hospital at Libreville (Gabon), Current Research in Microbiology and Biotechnology. (2016) 4, no. 6, 944–949. [Google Scholar]

[bib-0022] 22. Mosquito S., Ruiz J., Pons M. J., Durand D., Barletta F., and Ochoa T. J., Molecular Mechanisms of Antibiotic Resistance in Diarrhoeagenic Escherichia coli Isolated From Children, International Journal of Antimicrobial Agents. (2012) 40, no. 6, 544–548, 10.1016/j.ijantimicag.2012.07.021. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0023] 23. Zhang J., Wang J., Chen L., Yassin A. K., Kelly P., Butaye P., Li J., Gong J., Cattley R., Qi K., and Wang C., Housefly (Musca domestica) and Blow Fly (Protophormia terraenovae) as Vectors of Bacteria Carrying Colistin Resistance Genes, Applied and environmental microbiology. (2017) 84, no. 1, e01717–e01736, 10.1128/AEM.01736-17. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0024] 24. McHugh M. L., Lessons in Biostatistics Interrater Reliability: the Kappa Statistic, Biochem Medica (Zagreb).(2012) 22, no. 3, 276–282, 23092060. [PMC free article] [PubMed] [Google Scholar]

[bib-0025] 25. Tajbakhsh E., Tajbakhsh S., and Khamesipour F., Isolation and Molecular Detection of Gram Negative Bacteria Causing Urinary Tract Infection in Patients Referred to Shahrekord Hospitals, Iranian Red Crescent Medical Journal. (2015) 17, no. 5, e24779, 10.5812/ircmj.17(5)2015.24779. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0026] 26. Amrani R., Messaoudi S., Benajiba N., Rkain M., Frikh M., and Elouennass M., Les Infections Urinaires Infantiles Au Centre Hospitalier Universitaire Mohammed VI D′Oujda (Maroc), Journal de pédiatrie et de puériculture. (2019) 4, no. 1, 1–8. [Google Scholar]

[bib-0027] 27. Kot B., Gruzewska A., Szweda P., Wicha J., and Parulska U., Antibiotic Resistance of Uropathogens Isolated From Patients Hospitalized in District Hospital in Central Poland in 2020, Antibiotics. (2021) 10, no. 4, 10.3390/antibiotics10040447. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0028] 28. Odoki M., Aliero A. A., Tibyangye J., Maniga J. N., Wampande E., Kato C. D., Agwu E., and Bazira J., Prevalence of Bacterial Urinary Tract Infections and Associated Factors Among Patients Attending Hospitals in Bushenyi District , Uganda, International Journal of Microbiology. (2019) 2019, no. 2019, 4246780, 10.1155/2019/4246780, 30906323. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0029] 29. Sime T. W., Biazin H., Zeleke T. A., and Desalegn Z., Urinary Tract Infection in Cancer Patients and Antimicrobial Susceptibility of Isolates in Tikur Anbessa Specialized Hospital, Addis Ababa, Ethiopia, PLoS One. (2020) 15, e0243474, 10.1371/journal.pone.0243474. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0030] 30. Fornage S. and Bianchi-Demicheli F., Sexual Medicine in Lausanne: Past, Present and Future, Revue Medicale Suisse. (2017) 13, no. 554, 607–610. [PubMed] [Google Scholar]

[bib-0031] 31. Tia N. and Lal M., Bacteria Associated With Urinary Tract Infection (UTI), International Journal of Current Microbiology and Applied Sciences. (2016) 5, no. 8, 248–254, 10.20546/ijcmas.2016.508.025. [DOI] [Google Scholar]

[bib-0032] 32. Armand-Lefèvre L., Antibiotic Resistance in the Community: Myth or Reality? The Threat of ESBL Producing Enterobacteria, Journal des Anti-infectieux. (2017) 19, no. 1, 1–6, 10.1016/j.antinf.2017.01.004. [DOI] [Google Scholar]

[bib-0033] 33. Hailaji N. S. M., Ould Salem M. L., and Ghaber S. M., Sensitivity to Antibiotics Uropathogens Bacteria in Nouakchott-Mauritania, Progrès en Urologie. (2016) 26, no. 6, 346–352, 10.1016/j.purol.2016.04.004, 27211808. [DOI] [PubMed] [Google Scholar]

[bib-0034] 34. Pandit R., Awal B., Shrestha S. S., Joshi G., Rijal B. P., and Parajuli N. P., Extended-Spectrum β -Lactamase (ESBL) Genotypes Among Multidrug-Resistant Uropathogenic Escherichia coli Clinical Isolates From a Teaching Hospital of Nepal, Interdisciplinary Perspectives on Infectious Diseases. (2020) 2020, no. 2020, 6525826, 10.1155/2020/6525826, 32377184. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0035] 35. Abujnah A. A., Zorgani A., Sabri M. A. M., El-Mohammady H., Khalek R. A., and Ghenghesh K. S., Multidrug Resistance And Extended-Spectrum β-Lactamases Genes Among Escherichia coli From Patients With Urinary Tract Infections in Northwestern Libya, Libyan Journal of Medicine. (2015) 10, no. 1, 26412, 10.3402/ljm.v10.26412, 25651907. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0036] 36. Gebremariam G., Legese H., Woldu Y., Araya T., Hagos K., and Gebreyesuswasihun A., Bacteriological Profile, Risk Factors and Antimicrobial Susceptibility Patterns of Symptomatic Urinary Tract Infection Among Students of Mekelle University, Northern Ethiopia, BMC Infectious Diseases. (2019) 19, no. 1, 10.1186/s12879-019-4610-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0037] 37. Marchisio M., Porto A., Joris R., Rico M., Baroni M. R., and Di Conza J., Susceptibility to β-Lactams and Quinolones of Enterobacteriaceae Isolated From Urinary Tract Infections in Outpatients, Brazilian Journal Microbiology. (2015) 46, no. 4, 1155–1159, 10.1590/S1517-838246420140880. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0038] 38. Ahmed S. S., Shariq A., Alsalloom A. A., Babikir I. H., and Alhomoud B. N., Uropathogens and Their Antimicrobial Resistance Patterns: Relationship With Urinary Tract Infections, International Journal of Health Sciences. (2019) 13, no. 2, 48–55, 30983946. [PMC free article] [PubMed] [Google Scholar]

[bib-0039] 39. Bitew A., Molalign T., and Chanie M., Species Distribution and Antibiotic Susceptibility Profile of Bacterial Uropathogens Among Patients Complaining Urinary Tract Infections, BMC Infectious Diseases. (2017) 17, no. 1, 10.1186/s12879-017-2743-8, 28962545. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0040] 40. Toudji A. G., Djeri B., Karou S. D., Tigossou S., Ameyapoh Y., and De Souza C., Prévalence des souches d’entérobactéries productrices de bêta-lactamases à spectre élargi isolées au Togo et de leur sensibilité aux antibiotiques, International Journal of Biological and Chemical Sciences. (2017) 11, no. 3, 10.4314/ijbcs.v11i3.19. [DOI] [Google Scholar]

[bib-0041] 41. Anesi J. A., Lautenbach E., Nachamkin I., Garrigan C., Warren B., Wheeler M., Tolomeo P., and Han J. H., Clinical and Molecular Characterization of Community-Onset Urinary Tract Infections Due to Extended-Spectrum Cephalosporin-Resistant Enterobacteriaceae , Infection Control and Hospital Epidemiology. (2016) 37, no. 12, 1433–1439, 10.1017/ice.2016.225, 27678022. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0042] 42. Ugwu M. C., Shariff M., Nnajide C. M., Beri K., Okezie U. M., Iroha I. R., and Esimone C. O., Phenotypic and Molecular Characterization of β-Lactamases Among Enterobacterial Uropathogens in Southeastern Nigeria, Canadian Journal of Infectious Diseases and Medical Microbiology. (2020) 2020, no. 1, 5843904, 10.1155/2020/5843904, 32184910. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0043] 43. Eltai N. O., Al Thani A. A., Al-Ansari K., Deshmukh A. S., Wehedy E., Al-Hadidi S. H., and Yassine H. M., Molecular Characterization of Extended Spectrum β-Lactamases Enterobacteriaceae Causing Lower Urinary Tract Infection Among Pediatric Population, Antimicrobial Resistance and Infection Control. (2018) 7, no. 7, 10.1186/s13756-018-0381-6, 30069306. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0044] 44. Mohamed E. S., Khairy R. M. M., and Abdelrahim S. S., Prevalence and Molecular Characteristics of ESBL and AmpC β-Lactamase Producing Enterobacteriaceae Strains Isolated From UTIs in Egypt, Antimicrobial Resistance and Infection Control. (2020) 9, no. 1, 10.1186/s13756-020-00856-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0045] 45. Dikoumba A. C., Onanga R., Boundenga L., Bignoumba M., Ngoungou E. B., and Godreuil S., Prevalence and Characterization of Extended-Spectrum Beta-Lactamase-Producing Enterobacteriaceae in Major Hospitals in Gabon, Microbial Drug Resistance. (2021) 27, 1525–1534, 10.1089/mdr.2020.0497. [DOI] [PubMed] [Google Scholar]

[bib-0046] 46. Gebremichael S., Tekele T. D. S., Tullu K. D., Birru K., and Legese M. H., Extended-spectrum Beta-lactamase and AmpC Beta-Lactamases Producing Gram Negative Bacilli Isolated From Clinical Specimens at International Clinical Laboratories, Addis Ababa, Ethiopia, PLoS One. (2020) 15, no. 11, e0241984, 10.1371/journal.pone.0241984, 33180785. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0047] 47. Partridge S. R., Kwong S. M., Firth N., and Jensen S. O., Mobile Genetic Elements Associated With Antimicrobial Resistance, Clinical Microbiology Reviews. (2018) 31, no. 4, 10–1128, 10.1128/CMR.00088-17. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0048] 48. Jules G. C., Adébayo A. S. C., Yempabou S., and François D., Résistance Bacterienne Au Cours Des Infections Urinaires Chez Les Patients Diabetiques Au Cnhu-Hkm De Cotonou, Benin, Journal de la Société de Biologie Clinique du Bénin. (2016) 24, no. 1, 69–72. [Google Scholar]

[bib-0049] 49. Manyahi J., Moyo S. J., Tellevik M. G., Ndugulile F., Urassa W., Blomberg B., and Langeland N., Detection of CTX-M-15 Beta-Lactamases in Enterobacteriaceae Causing Hospital- and Community-Acquired Urinary Tract Infections as Early as 2004, in Dar Es Salaam, Tanzania, BMC Infectious Diseases. (2017) 17, no. 1, 10.1186/s12879-017-2395-8, 28415986. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0050] 50. Perera P. D. V. M., Gamage S., De Silva H. S. M., Jayatilleke S. K., de Silva N., Aydin A. et al., Phenotypic and Genotypic Distribution of ESBL, AmpC β-Lactamase and Carbapenemase-Producing Enterobacteriaceae in Community-Acquired and Hospital-Acquired Urinary Tract Infections in Sri Lanka, Journal of Global Antimicrobial Resistance. (2022) 30, 115–122, 10.1016/j.jgar.2022.05.024, 35667644. [DOI] [PubMed] [Google Scholar]

[bib-0051] 51. Rodriguez-Baño J., Gutiérrez-Gutiérrez B., Machuca I., and Pascual A., Treatment of Infections Caused by Extended-Spectrum-Beta-, Clinical Microbiology Reviews. (2018) 31, no. 2, e00017–e00079, 10.1128/CMR.00079-17. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0052] 52. Madec J. Y., Haenni M., Nordmann P., and Poirel L., Extended-Spectrum β-Lactamase/AmpC- and Carbapenemase-Producing Enterobacteriaceae in Animals: A Threat for Humans?, Clinical Microbiology Infection. (2017) 23, 826–833, 10.1016/j.cmi.2017.01.013. [DOI] [PubMed] [Google Scholar]

[bib-0053] 53. Shaaban M., Elshaer S. L., and Abd El-Rahman O. A., Prevalence of Extended-Spectrum β-Lactamases, AmpC, and Carbapenemases in Proteus mirabilis Clinical Isolates, BMC Microbiology. (2022) 22, no. 1, 10.1186/s12866-022-02662-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0054] 54. Dikoumba A.-C., Onanga R., Jean-Pierre H., Didelot M.-N., Dumont Y., Ouedraogo A.-S., Ngoungou E. B., and Godreuil S., Prevalence and Phenotypic and Molecular Characterization of Carbapenemase-Producing Gram-Negative Bacteria in Gabon, American Journal of Tropical Medicine and Hygiene. (2023) 108, no. 2, 268–274, 10.4269/ajtmh.22-0168, 36535247. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0055] 55. Dwomoh F. P., Kotey F. C. N., Dayie N. T. K. D., Osei M. M., Amoa-Owusu F., Bannah V., Alzahrani F. M., Halawani I. F., Alzahrani K. J., Egyir B., and Donkor E. S., Phenotypic and Genotypic Detection of Carbapenemase-Producing Escherichia coli and Klebsiella pneumoniae in Accra, Ghana, PLoS One. (2022) 17, no. 12, e0279715, 10.1371/journal.pone.0279715, 36584159. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0056] 56. Mediavilla J. R., Patrawalla A., Chen L., Chavda K. D., Mathema B., Vinnard C. et al., Colistin-and carbapenem-resistant Escherichia coli harboring mcr-1 and bla NDM-5 Causing a Complicated Urinary Tract Infection in a Patient from the United States, American Society for Microbiology. (2016) 7, no. 4, e01116–e01191, 10.1128/mBio.01191-16. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0057] 57. Vaara M., Polymyxin Derivatives That Sensitize Gram-Negative Bacteria to Other Antibiotics, Molecules. (2019) 24, no. 2, 10.3390/molecules24020249. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0058] 58. Krir A., Dhraief S., Messadi A. A., and Thabet L., Profil bactériologique et résistance aux antibiotiques des bactéries isolées dans un service de réanimation des brûlés durant sept ans, Annals of Burns and Fire Disasters. (2019) 32, no. 3, 197–202, 32313533. [PMC free article] [PubMed] [Google Scholar]

[bib-0059] 59. Mazzariol A., Bazaj A., Cornaglia G., Mazzariol A., Bazaj A., and Cornaglia G., Multi-Drug-Resistant Gram-Negative Bacteria Causing Urinary Tract Infections: A Review, Journal of Chemotherapy. (2017) 29, no. Supplement 1, 2–9, 10.1080/1120009X.2017.1380395. [DOI] [PubMed] [Google Scholar]

[bib-0060] 60. Golikova M. V., Alieva K. N., Strukova E. N., Kondratieva D. A., Petrova N. F., Petrova M. A., and Zinner S. H., Comparative Meropenem Pharmacodynamics and Emergence of Resistance Against Carbapenem-Susceptible Non-Carbapenemase-Producing and Carbapenemase-Producing Enterobacterales: A Pharmacodynamic Study in a Hollow-Fiber Infection Model, Antibiotics. (2023) 12, no. 12, 10.3390/antibiotics12121717, 38136751. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0061] 61. Smith H. Z., Hollingshead C. M., and Kendall B., Carbapenem-Resistant Enterobacterales, StatPearls Treasure Island, 2024, StatPearls Publishing. [PubMed] [Google Scholar]

[bib-0062] 62. Rebelo A. R., Bortolaia V., Kjeldgaard J. S., Pedersen S. K., Leekitcharoenphon P., Hansen I. M., Guerra B., Malorny B., Borowiak M., Hammerl J. A., Battisti A., Franco A., Alba P., Perrin-Guyomard A., Granier S. A., de Frutos Escobar C., Malhotra-Kumar S., Villa L., Carattoli A., and Hendriksen R. S., Multiplex PCR for Detection of Plasmid-Mediated Colistin Resistance Determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for Surveillance Purposes, Eurosurveillance. (2018) 23, no. 6, 17–00672, 10.2807/1560-7917.ES.2018.23.6.17-00672. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0063] 63. Dortet L., Bonnin R., Jousset A., Gauthier L., and Naas T., The Emergence and Spread of Plasmid-Mediated Resistance to Colistin in Enterobacteriaceae: Compromising the Last Bastion on the Way to Pan-Drug Resistance, Journal des Anti-infectieux. (2016) 18, no. 4, 139–159, 10.1016/j.antinf.2016.09.003. [DOI] [Google Scholar]

[bib-0064] 64. Fukuda A., Usui M., Okubo T., Tagaki C., Sukpanyatham N., and Tamura Y., Co-harboring of Cephalosporin (bla)/colistin (mcr) Resistance Genes Among Enterobacteriaceae From Flies in Thailand, FEMS Microbiology Letters. (2018) 365, no. 16, 10.1093/femsle/fny178, 30010911. [DOI] [PubMed] [Google Scholar]

[bib-0065] 65. Arif A., Ullah I., Zaman R., and Khan A. M., Phenotypic Identification of Different β-Lactamases in Intrinsic and Acquired Colistin Resistant Uropathogenic Gram Negative Bacteria, Pakistan Journal of Medical Sciences. (2024) 40, no. 6, 1122–1128, 10.12669/pjms.40.6.8516. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0066] 66. Touzain F., Le Devendec L., de Boisséson C., Baron S., Jouy E., Perrin-Guyomard A., Blanchard Y., and Kempf I., Characterization of Plasmids Harboring bla _CTX-M and bla _CMY Genes in E. coli From French broilers, PLoS One. (2018) 13, no. 1, e0188768, 10.1371/journal.pone.0188768, 29360838. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib-0067] 67. Piccirilli A., Pompilio A., Rossi L., Segatore B., Amicosante G., Rosatelli G., Perilli M., and di Bonaventura G., Identification of CTX-M-15 and CTX-M-27 in Antibiotic-Resistant Gram-Negative Bacteria Isolated From Three Rivers Running in Central Italy, Microbial Drug Resistance. (2019) 25, no. 7, 1041–1049, 10.1089/mdr.2019.0016, 30994417. [DOI] [PubMed] [Google Scholar]

PERMALINK

Molecular Characterization and Antibiotic Resistance of Broad‐Spectrum β‐Lactamase‐Producing Enterobacterales in Urinary Tract Infections in Libreville, Gabon

Jean Fabrice Yala

Ornella Zong Minko

Rolande Mabika Mabika

Franck Mounioko

Elvire Anita Mbongo-Kama

Annicet Clotaire Dikoumba

Alain Souza

Abstract

Background

Methods

Results

Conclusion

1. Background

2. Methods

2.1. Study Design

2.2. Isolation and Identification of Bacteria

2.3. Phenotypic Detection of the Production of Broad‐Spectrum β‐lactamases (BSβL): ESβL, AmpC and Carbapenemase

2.4. Detection of ESβL‐Producing Strains

2.5. Detection of Strains‐Producing AmpC

2.6. Detection of Strains‐Producing Carbapenemases

Table 1.

2.7. Susceptibility Profiles of BSβL‐En to the Usual and Latest Line Antibiotics

2.8. Molecular Typing of BSβL‐En Genes and Search for Resistance Genes to Colistin and Carbapenems

2.8.1. DNA Extraction

2.8.2. Characteristics of the Genes and Study Conditions

Table 2.

2.9. Ethical Considerations

2.10. Statistical Analysis

3. Results and Discussion

3.1. Results

3.1.1. Demographics and Prevalence of UTIs

Table 3.

3.1.2. Distribution and Frequency of Presumptive Isolates Containing Broad‐Spectrum β‐Lactamases Producing Enterobacterales (BSβL‐En)

Table 4.

3.1.3. Characterization of BSβL‐En and Phenotypic Resistance Profiles

Table 5.

3.1.4. Molecular Typing of BSβL‐En Strains and Characterization of Resistance Genes

Table 6.

3.1.5. Correlation Between BSβL Typing and Phenotypic Resistance Profiles

4. Discussion

5. Conclusion

Nomenclature

Author Contributions

Funding

Disclosure

Ethics Statement

Conflicts of Interest

Acknowledgments

Contributor Information

Data Availability Statement

References

Associated Data

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases