Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Jun 17.
Published in final edited form as: Exp Eye Res. 2025 Jun 26;258:110499. doi: 10.1016/j.exer.2025.110499

L-carnitine partially restores adherens junction integrity and promotes wound healing in human corneal epithelial cells exposed to hyperosmolar stress

Richard Kontoh-Twumasi a,b, Antonella Aliste a,b, Alex Scheid a,b, Joshua Glass a,b, Ashok Sharma a,b,c, Shruti Sharma a,b,c,*
PMCID: PMC13270672  NIHMSID: NIHMS2168994  PMID: 40581139

Abstract

Disruption of tear film homeostasis and increased osmolarity are key features of dry eye disease (DED), leading to inflammation, epithelial barrier dysfunction, and ocular surface damage. Adherens junctions, primarily composed of cadherins and catenins, are essential for maintaining epithelial integrity and modulating signaling pathways that regulate cell proliferation and migration. This study investigates the effects of hyperosmolarity on adherens junction proteins and wound healing, as well as the therapeutic potential of L-carnitine (LCAR) in mitigating these effects. To induce hyperosmolar stress, telomerase-immortalized human corneal epithelial cells (hTCEpi) were treated with 70, 90, and 120 mM NaCl, resulting in final osmolarities of approximately 450, 490, and 550 mOsM, respectively. LCAR supplementation (200 mM) was evaluated as a potential osmoprotective therapy. Hyperosmolarity caused a dose-dependent reduction in trans-epithelial resistance (TER), with a 30–69 % decline across treatment groups, along with significantly impaired cell migration. Adherens junction proteins (E-cadherin, β-catenin, and p120-catenin) were downregulated, while α-catenin was upregulated. Notably, L-carnitine treatment alleviated these effects, significantly restoring TER and adherens junction protein levels to near-normal. These findings demonstrate that hyperosmolarity impairs corneal epithelial barrier function and delays wound healing by altering adherens junction complex. Our results highlight the potential of L-carnitine as a therapeutic agent to restore epithelial barrier integrity and mitigate hyperosmolarity-induced damage in DED.

Keywords: Dry eye disease, Hyperosmolarity, Corneal epithelium, Adherens junctions, L-carnitine

1. Introduction

Dry eye disease (DED) is a chronic disorder of the ocular surface that significantly impairs vision and diminishes quality of life for millions of individuals worldwide (Craig et al., 2017; Farrand et al., 2017; Li et al., 2021). It is a multifactorial condition characterized by the loss of tear film homeostasis, leading to tear film instability, hyperosmolarity, ocular surface inflammation and damage, and neurosensory abnormalities. Common symptoms include dryness, irritation, redness, a gritty sensation, and episodes of blurred or cloudy vision (Zhou et al., 2022). In the United States alone, over 16 million adults are affected by DED, with higher prevalence reported in women (8.8%) than in men (4.5%) (Farrand et al., 2017).

Tear hyperosmolarity is recognized as one of the central features of DED. It is known to initiate inflammatory cascades and contribute to corneal epithelial barrier dysfunction, thereby increasing susceptibility to irritants and infections, impairing wound healing, and intensifying symptoms such as discomfort and visual disturbances (Guindolet et al., 2022; Li et al., 2021; Stuard Sambhariya, Trautmann and Robertson, 2023). In more severe cases, particularly those involving chronic ocular surface inflammation, extensive corneal damage and impaired repair mechanisms can significantly elevate the risk of vision loss (Sharma et al., 2023). Clinically, a tear film osmolarity exceeding 308 mOsm/L in either eye, or an inter-eye difference greater than 8 mOsm/L, is indicative of disrupted tear film homeostasis and is considered as a diagnostic marker for DED (Craig et al., 2017; Lemp et al., 2011).

Adherens junction proteins are vital for maintaining cell-to-cell adhesion in corneal epithelial cells (Kimura et al., 2013; Ma et al., 2021). These proteins include E-cadherin and catenins (α-catenin, β-catenin, and p120-catenin), which work together to maintain epithelial function and regulate various signal transduction pathways. Among these, E-cadherin and β-catenin are known to play a central role in epithelial cell proliferation and migration (Maltseva et al., 2013; Wang et al., 2025).

Despite advances in understanding the molecular pathways involved in DED, the precise mechanisms by which hyperosmolarity disrupts adherens junction complex and modulates wound healing in the corneal epithelium remain unclear. This study investigates the effect of hyperosmotic stress on adherens junction proteins and wound healing using an in vitro DED model. It also evaluates therapeutic potential of L-carnitine, a candidate osmoprotectant (Chen et al., 2013; Hua et al., 2015; Hua et al., 2015b; Khajavi et al., 2014), in restoring corneal epithelial barrier function and modulating its molecular targets.

2. Methods

2.1. Cell culture and hyperosmolar model

Telomerase-immortalized human corneal epithelial cells (hTCEpi) developed and characterized by Robertson and colleagues (Robertson et al., 2005) were cultured in complete Keratinocyte Growth Medium-2 (KGM, C-20111, PromoCell, Heidelberg, Germany) supplemented with 0.15 mM calcium chloride (C-34006, PromoCell), bovine pituitary extract (0.0004 mL/mL), recombinant human epidermal growth factor (0.125 ng/mL), recombinant human insulin (5 μg/mL), hydrocortisone (0.33 μg/mL), epinephrine (0.39 μg/mL), and human holo-transferrin (10 μg/mL). Cells were seeded at 3 × 105 cells per well in 12-well plates (Corning Incorporated, Kennebunk, ME, USA) and allowed to adhere overnight. Prior to experiments, cells were transferred to KGM media without supplements (basal) for 24 h. To induce hyperosmolar stress, the culture medium was supplemented with 70, 90, or 120 mM NaCl, resulting in final osmolarities of approximately 450, 490, and 550 mOsM, respectively, as previously described (Luo et al., 2007. Hyperosmolar hTCEpi cells were treated with or without 200 mM L-carnitine supplementation (8400920025, Millipore Sigma, Burlington, MA, USA) to investigate its therapeutic potential.

2.2. Epithelial barrier function measurement

Trans-epithelial electrical resistance (TER) was measured using an ECIS Z-Theta instrument (Applied Biophysics, Inc., Troy, NY, USA) to evaluate epithelial barrier function in hTCEpi cells exposed to increasing hyperosmolar stress with and without L-carnitine supplementation. The 96-well ECIS arrays (96W1E+) were pre-coated with L-cysteine (10 μM; Alfa Aesar, Haverhill, MA, USA) and fibronectin (10 μg/mL; Thermo Fisher, Waltham, MA, USA), and baseline readings were stabilized in cell-free media. hTCEpi cells were seeded at 70,000 cells per well in complete KGM media until confluency and then switched to basal media for 24 h. Hyperosmolar stress was induced by the addition of 70, 90, or 120 mM NaCl. Epithelial barrier function was assessed by recording resistance readings at 4000 Hz, every 5 min for 24 h and data normalized to the initial resistance values.

2.3. Wound healing assay

Wound healing and cell migration were assessed using the automated wounding function of the ECIS Z-Theta system with 96W1E + electrode arrays. Unlike the conventional scratch assay, which involves manually disrupting the monolayer with pipette tips or needles, ECIS offers key advantages, including eliminating user variability, preserving the extracellular matrix, restricting the wound area to a defined region, and providing real-time, quantitative monitoring of both cell migration and barrier function. The coating, stabilization, cell seeding, and treatment protocols described above in the barrier function assay were used. Uniform wounds were generated by applying a 5000 μA current for 30 s across two circular electrodes (radius: 177 μm; area: 0.256 mm2). This method has been shown to selectively kill cells on the electrodes (Ebrahim et al., 2022, 2023; Gamal et al., 2015; Keese et al., 2004; Vereb et al., 2016) without physically dislodging them as in a scratch assay. The automated electric fence function of ECIS was also applied for 1 min to prevent immediate hTCEpi cell migration to the wounded areas. Wound closure was monitored every 5 min for 24 h, with resistance values normalized to the baseline readings. Migration rate (V) was determined using formula V = R/T, where R is the known radius of the electrodes and T is the migration time calculated from the TER drop at wounding to its recovery.

2.4. RT-PCR analysis

RNA was extracted from hTCEpi cells by the phenol-chloroform method using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), followed by cDNA synthesis with the High-Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems, Foster City, CA, USA). Primers were designed using NCBI Primer-BLAST and purchased from Integrated Device Technology (San Jose, CA, USA) (Table 1). RT-PCR was performed using 2X Universal SYBR Green Fast qPCR Mix (RK21203, ABclonal, Woburn, MA, USA) and the Bio-Rad CFX Connect Thermocycler. Relative gene expression was calculated as 2−ΔΔCq relative to GAPDH expression and expressed as fold change relative to untreated.

Table 1.

List of primers used in the study.

Gene Forward Primer (5’ → 3′) Reverse Primer (5’ → 3′)
E-cadherin (CDH1) GCTGGACCGAGAGAGTTTCC GGTGTATACAGCCTCCCACG
β-catenin (CTNNB1) ATTGTCCACGCTGGATTTTC TCGAGGACGGTCGGACT
α-catenin (CTNNA1) GCTCACAGTGTAATAGGGGAGA TGGACAGCAGTCATTTTGCAG
p120-catenin (CTNND1) AGAGCGTTACCAAGAGGCAG GGAGAACCACTCATCTTTGCC
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) AATGAAGGGGTCATTGATGG AAGGTGAAGGTCGGAGTCAA
Open in a new tab

2.5. Western blotting

Cell lysates were prepared in RIPA buffer (AKR191, Cell Biolabs, Inc., San Diego, CA, USA) containing protease inhibitor (P8340, Sigma-Aldrich, St. Louis, MO, USA) and phosphatase inhibitor (P5726, Sigma-Aldrich) and lysed by sonication followed by centrifugation. Protein concentrations were determined by Bradford Protein Assay (23200, Thermo Scientific, Waltham, MA, USA). Equal amounts of protein (20–30 μg) were separated on 4–20 % SDS-PAGE gels and transferred to nitrocellulose membranes. Membranes were blocked with 5 % non-fat milk dissolved in tris-buffered saline with 0.1 % Tween-20 (TBS-T) and incubated overnight with primary antibodies against E-cadherin and β-catenin (1:1000, #3195 and #8480 respectively, Cell Signaling Technology, Danvers MA, USA). Membranes were washed in TBS-T, incubated with HRP-conjugated anti-rabbit secondary antibody (1:5000, #31460, Invitrogen) and then developed using ECL substrate (Thermo Scientific), and bands were visualized using the ChemiDoc Imaging System (Bio-Rad). Densitometric analysis was performed using ImageJ (NIH), and protein levels were normalized to β-actin (1:5000, #AC028, ABclonal, Woburn, MA, USA). Data were presented as fold change relative to untreated hTCEpi cells.

2.6. Immunofluorescence

hTCEpi cells were cultured on 96-well plates (Greiner 655090, Fisher Scientific, Waltham, MA, USA) at a density of 70,000 cells per well and treated with 90 mM NaCl (490 mOsM) with or without 200 mM L-carnitine as described above. Cells were washed with DPBS, fixed in 4 % paraformaldehyde, permeabilized with 0.3 % Triton X-100, and blocked with 3 % BSA at room temperature. Primary antibodies against E-cadherin and β-catenin were applied at 1:1000 and 1:400 dilutions, respectively, and Alexa Fluor 488 and 546-conjugated secondary antibodies (1:500, Invitrogen, Carlsbad, CA, USA) were used for fluorescence detection. Images were acquired using a Leica STELLARIS Confocal Microscope (Buffalo Grove, IL, USA) at 40x magnification and quantified using ImageJ software (NIH) measuring the relative fluorescence intensity (RFI) normalized to total cell count.

2.7. Statistical analysis

Statistical analyses were performed using GraphPad Prism software version 10 (GraphPad Software, Inc., San Diego, CA, USA), using one-way ANOVA with Tukey’s post hoc test or a student’s t-test. P-value of <0.05 was considered significant and data are expressed as mean ± standard deviation (SD).

3. Results

3.1. Hyperosmolarity induces a dose-dependent decline in human corneal epithelial barrier function

Corneal epithelial cells exposed to increasing concentrations of NaCl (70, 90, and 120 mM, corresponding to final osmolarities of ~450, 490, and 550 mOsm/L, respectively) for 24 h exhibited a dose-dependent reduction in trans-epithelial resistance (TER), as measured by ECIS apparatus (Fig. 1). A significant decline of 30%, 54%, and 69% was observed in cells treated with 70, 90, and 120 mM NaCl respectively, relative to untreated controls. These findings indicate that elevated hyperosmolarity disrupts corneal epithelial barrier integrity.

Fig. 1. Hyperosmolarity induces a dose-dependent decline in human corneal epithelial barrier function.

Fig. 1.

Open in a new tab

Telomerase-immortalized human corneal epithelial cells (hTCEpi) treated with 70, 90, and 120 mM NaCl corresponding to final osmolarities of ~450, 490, and 550 mOsM, respectively, for 24 h exhibited a dose-dependent reduction (30–69 %) in trans-epithelial electrical resistance (TER). Timepoint zero (0) indicates when NaCl treatments were added to the cells. Results are presented as mean ± SD, n = 19–20/group, with ****p < 0.0001 compared to untreated (UT).

3.2. Hyperosmolar stress reduces adherens junction protein levels in corneal epithelial cells

To investigate molecular mechanisms underlying barrier dysfunction, the expression of key adherens junction components, E-cadherin and β-catenin, was analyzed. RT-PCR analysis showed significant downregulation of E-cadherin expression with a 0.49-fold decrease in the 490 mOsM group and a 0.31-fold decrease in the 550 mOsM group (Fig. 2A–C). Western blot analysis revealed corresponding decreases in protein levels of 0.41-fold and 0.28-fold in the 490 and 550 mOsM groups, respectively (Fig. 2B–D) (Supplementary Fig. S1 and S2).

Fig. 2. Hyperosmolar stress decreases E-cadherin levels in human corneal epithelial cells.

Fig. 2.

Open in a new tab

hTCEpi cells exposed to media with 490 mOsM (A, B) and 550 mOsM (C, D) for 24 h showed a significant reduction in E-cadherin RNA expression and protein levels. Gene expression was normalized to GAPDH, and protein levels were normalized to β-actin. Results are presented as mean ± SD, n = 4–8/group, with *p < 0.05, ****p < 0.0001 compared to untreated (UT).

β-catenin RNA levels remained unchanged at 490 mOsM but decreased significantly by 0.42-fold at 550 mOsM (Fig. 3A–C). β-catenin protein levels decreased by 0.38-fold in 490 mOsM and 0.05-fold in the 550 mOsM groups (Fig. 3B–D). Analysis of other adherens junction proteins revealed that p120-catenin RNA expression decreased by 0.62-fold and 0.49-fold in 490 and 550 mOsM groups, respectively (Fig. 4A and B). In contrast, α-catenin expression increased by 2.7-fold at 490 mOsM but remained unchanged at 550 mOsM (Fig. 4C and D).

Fig. 3. Increased osmolarity leads to decreased β-catenin levels in human corneal epithelial cells.

Fig. 3.

Open in a new tab

hTCEpi cells treated with 90 and 120 mM NaCl corresponding to osmolarities of 490 and 550 mOsM for 24 h exhibited a significant decline in β-catenin protein levels (B, D). No significant changes in β-catenin RNA expression were observed with 490 mOsM treatment (A), but a significant decrease was observed in the 550 mOsM group (C). Gene expression was normalized to GAPDH, and protein levels were normalized to β-actin. Results are presented as mean ± SD, n = 4–24/group, with *p < 0.05, **p < 0.01 compared to untreated (UT); ns = non-significant.

Fig. 4. Increased osmolarity alters α-catenin and p120-catenin expression in human corneal epithelial cells.

Fig. 4.

Open in a new tab

hTCEpi cells exposed to media with 490 and 550 mOsM for 24 h showed a significant decline in p120-catenin gene expression (A, B). α-catenin mRNA levels were significantly elevated following 490 mOsM treatment but showed no significant change with 550 mOsM (C, D). Results are presented as mean ± SD, n = 6–30/group, with **p < 0.01, ****p < 0.0001 compared to untreated (UT); ns = non-significant.

3.3. L-carnitine supplementation partially restores hyperosmolarity-induced loss of adherens junction protein integrity

We next examined whether L-carnitine could protect adherens junction integrity under hyperosmolar stress. Immunofluorescence analysis revealed reduced fluorescence intensity of E-cadherin and β-catenin in cells exposed to 490 mOsM. L-carnitine supplementation restored fluorescence levels to near control values (0.99-fold and 1.23-fold, respectively) (Fig. 5A, B and D, E). Our RT-PCR analysis showed that L-carnitine enhanced E-cadherin expression by 7.56-fold and β-catenin expression by 2.8-fold as compared to cells treated with 490 mOsM alone (Fig. 5C–F). These findings indicate that L-carnitine mitigates the hyperosmolarity-induced damage and supports adherens junction stability and epithelial barrier function.

Fig. 5. L-carnitine supplementation partially restores hyperosmolarity-induced loss of adherens junction protein integrity.

Fig. 5.

Open in a new tab

Immunostaining of E-cadherin (red) and β-catenin (green) showed decreased levels in the 490 mOsM group compared to untreated (UT). However, L-carnitine (LCAR) supplementation significantly improved E-cadherin (A,B) and β-catenin (D,E) fluorescence intensity and RNA expression (C, F). Arrows indicate intercellular adherens junctions. For immunostaining results, the relative fluorescence intensity (RFI) was measured (8–10 images/group) and normalized to total cell count. RT-PCR results are presented as mean ± SD, n = 5–10/group, with *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Scale bar = 50 μm.

3.4. L-carnitine partially improves epithelial barrier function and wound healing under hyperosmolar stress

To study the osmoprotective effects of L-carnitine on corneal epithelial barrier integrity under hyperosmolar conditions, TER analysis was performed. Cells exposed to 490 mOsM exhibited a significant reduction in corneal epithelial cell resistance. However, supplementation with 200 mM L-carnitine significantly enhanced TER, partially restoring epithelial barrier function (Fig. 6A).

Fig. 6. Hyperosmolarity-induced epithelial barrier dysfunction and wound healing are partially restored after L-carnitine treatment.

Fig. 6.

Open in a new tab

hTCEpi cells exposed to media with 490 mOsM with and without 200 mM L-carnitine (LCAR) supplementation showed partially restored epithelial barrier function (A). Wound healing assay (5000 μA current for 30 s) in hTCEpi cells treated with 490 mOsM demonstrated delayed cell migration rate. However, L-carnitine treatment showed protection against the induced wound (B). Graphs depict normalized trans-epithelial resistance (TER) measured at a frequency of 4000 Hz. Results are presented as mean ± SD, n = 4–6/group, with ****p < 0.0001 compared to untreated (UT); W = wounding.

Furthermore, the ability of the corneal epithelial cells to repair themselves after injury was evaluated using the ECIS wound healing assay, which continuously measures impedance over time, reflecting both cell migration into the wounded area and the reformation of intercellular junctions. After induction of the electric wound, the untreated cells exhibited a substantial drop in TER, which was quickly recovered, corresponding to a migration rate (V) of 59 μm/h, indicating efficient repair. With exposure to 490 mOsM media, TER readings dropped considerably, and migration was markedly delayed, with a reduced migration rate of 7.6 μm/h. Interestingly, the administration of L-carnitine protected hTCEpi cells from the effects of the electrical wound, as TER measurements remain stable despite hyperosmolar conditions (Fig. 6B). Together, these findings suggest that hyperosmolar stress severely impairs the corneal epithelium’s intrinsic repair mechanisms while L-carnitine may protect epithelial cells from damage and promote repair.

4. Discussion

Ocular surface damage in dry eye disease is associated with increased tear osmolarity, epithelial barrier dysfunction, and impaired wound healing (Guzman-Aranguez et al., 2017; Pflugfelder et al., 2005; Redfern et al., 2013). In this study, using the telomerase-immortalized human corneal epithelial (hTCEpi) cells, we investigated the effects of hyperosmolar stress on adherens junction proteins, wound healing, and corneal epithelial integrity. Additionally, we evaluated the therapeutic potential of L-carnitine as an osmoprotectant to mitigate the adverse effects of hyperosmolarity.

Our findings indicate that hyperosmolar stress leads to a progressive decline in corneal epithelial barrier function. Chronic, unmanaged DED is known to cause a gradual breakdown of the corneal epithelial barrier, increasing the risk of microbial infections and environmental insults that further exacerbate ocular surface pathology. These findings are consistent with previous studies that have shown a decline of epithelial barrier integrity in corneal epithelial cells exposed to hyperosmolar conditions (Bildin et al., 2003; Woodward et al., 2012). Furthermore, our results demonstrate that E-cadherin, β-catenin, and p120-catenin were significantly reduced under hyperosmolar conditions, highlighting their essential role in corneal epithelial homeostasis.

Several studies have focused on the role of other junctional proteins in various DED models. For example, elevated matrix metalloproteinase (MMP-9) has been shown to degrade occludin, a tight junction protein, contributing to increased corneal epithelial permeability in mouse models of DED (Pflugfelder et al., 2005). Similarly, ZO-1 disruption was observed in corneal epithelial cells exposed to 450 mOsM hyperosmolar stress (Li et al., 2024). In our study, we focused on adherens junction proteins due to their role in regulating cell-to-cell adhesion through the formation of the cadherin/catenin complex, which is linked to actin cytoskeleton and contributes to the epithelial barrier integrity (Giasson et al., 2014; Kimura et al., 2013). The E-cadherin/β-catenin complex regulates several signal transduction pathways, including the PI3K/Akt, NF-κB, and Wnt/β-catenin signaling, which are involved in essential biological processes such as proliferation and wound healing (Liu et al., 2022; Van den Bossche et al., 2012; Wang et al., 2025).

In this study, we employed an electrically induced wound healing assay that provides real-time assessment of cell migration. Our results demonstrate that hyperosmolar stress impairs migration of corneal epithelial cells, compromising their ability to repair ocular surface damage and exacerbating corneal barrier dysfunction. Previous studies have also shown impaired corneal epithelial wound healing in DED models (Bian et al., 2015; Raz et al., 2024; Song et al., 2024; Voss et al., 2023).

Current DED therapies primarily offer symptomatic relief, including artificial tears, by using anti-inflammatory drugs, and tear retention strategies, along with emerging options such as intense pulse light therapy (Shen et al., 2023; Yurttaser Ocak et al., 2020). L-carnitine aids in transporting long-chain fatty acids into the mitochondria for β-oxidation (Caballero-Garcia et al., 2023). It has also been studied as an osmoprotectant where it counters the effects of osmotic imbalance between cells and their environment (Khajavi et al., 2014). Studies have shown that L-carnitine is effective in suppressing inflammation and reducing oxidative stress in corneal epithelial cells exposed to hyperosmotic stress with the exact mechanism not known (Chen et al., 2013; Hua et al., 2015; Hua et al., 2015b).

Hua et al. (2015) investigated the anti-inflammatory effects of osmoprotectants in corneal epithelial cells exposed to hyperosmolar media. They reported that elevated osmolarity induced a dose-dependent increase in TNF-α, IL-1β, and IL-6, as well as chemokines, IL-8, CCL2, and CCL20 levels. Interestingly, L-carnitine supplementation showed a 54–77% efficacy in downregulating the expression of these inflammatory mediators (Hua et al., 2015b). Additionally, L-carnitine was found to attenuate oxidative damage in primary corneal epithelial cells exposed to hyperosmotic media, as evidenced by reduced cytotoxic membrane lipid peroxidation markers, including malondialdehyde and hydroxynonenal, along with decreased levels of 8-OHdG and aconitase-2 (Hua et al., 2015). In a murine model of desiccation-induced DED, L-carnitine treatment significantly reduced corneal staining and decreased TNF-α and IL-17 levels in both prevention and the treatment protocols (Chen et al., 2013). Overall, our results demonstrate that L-carnitine supplementation showed therapeutic potential by improving corneal epithelial barrier function, restoring adherens junction protein levels, and enhancing wound healing disrupted by NaCl-induced hyperosmolar stress.

5. Conclusion

This study demonstrates that hyperosmolarity disrupts adherens junction proteins, leading to corneal epithelial barrier dysfunction and impaired wound healing. Our findings suggest that L-carnitine supplementation can partially repair the disrupted cadherin/catenin complex and restore barrier function. Future studies targeting Wnt/β-catenin signaling and further elucidating the mechanisms of L-carnitine action may contribute to the development of effective therapies to mitigate hyperosmolar stress and improve outcomes in DED. Investigating the long-term protective effects of L-carnitine in animal models and exploring combinatorial therapies targeting inflammatory and oxidative pathways may further advance treatment strategies for DED.

Supplementary Material

1

Acknowledgement

The authors would like to thank Prof. Danielle Robertson (UT Southwestern, TX, USA) who kindly provided us with the telomerase-immortalized human corneal epithelial cells. This study was supported by grants from the National Eye Institute, NIH (Bethesda, MD, USA) R01 EY036114 awarded to Shruti Sharma, PhD and a Center Core Grant for Vision Research (P30 EY031631) to Augusta University.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.exer.2025.110499.

Footnotes

Declaration of interest

The authors declare that they have no conflicts of interest. The funding agency did not contribute to the study’s design, data collection, analysis, interpretation, manuscript writing, or decision to publish the results.

CRediT authorship contribution statement

Richard Kontoh-Twumasi: Writing – review & editing, Writing – original draft, Methodology, Conceptualization. Antonella Aliste: Writing – original draft, Methodology. Alex Scheid: Writing – original draft, Methodology. Joshua Glass: Writing – original draft, Methodology. Ashok Sharma: Writing – review & editing, Formal analysis. Shruti Sharma: Writing – review & editing, Writing – original draft, Supervision, Resources, Project administration, Investigation, Funding acquisition, Conceptualization.

Data availability

Data will be made available on request.

References

  1. Bian F, Pelegrino FS, Pflugfelder SC, Volpe EA, Li DQ, de Paiva CS, 2015. Desiccating stress-induced MMP production and activity worsens wound healing in alkali-burned corneas. Investig. Ophthalmol. Vis. Sci. 56 (8), 4908–4918. 10.1167/iovs.15-16631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bildin VN, Wang Z, Iserovich P, Reinach PS, 2003. Hypertonicity-induced p38MAPK activation elicits recovery of corneal epithelial cell volume and layer integrity. J. Membr. Biol. 193 (1), 1–13. 10.1007/s00232-002-2002-8. [DOI] [PubMed] [Google Scholar]
  3. Caballero-Garcia A, Noriega-Gonzalez DC, Roche E, Drobnic F, Cordova A, 2023. Effects of L-Carnitine intake on exercise-induced muscle damage and oxidative stress: a narrative scoping review. Nutrients 15 (11). 10.3390/nu15112587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chen W, Zhang X, Li J, Wang Y, Chen Q, Hou C, Garrett Q, 2013. Efficacy of osmoprotectants on prevention and treatment of murine dry eye. Investig. Ophthalmol. Vis. Sci. 54 (9), 6287–6297. 10.1167/iovs.13-12081. [DOI] [PubMed] [Google Scholar]
  5. Craig JP, Nelson JD, Azar DT, Belmonte C, Bron AJ, Chauhan SK, de Paiva CS, Gomes JAP, Hammitt KM, Jones L, Nichols JJ, Nichols KK, Novack GD, Stapleton FJ, Willcox MDP, Wolffsohn JS, Sullivan DA, 2017. TFOS DEWS II report executive summary. Ocul. Surf. 15 (4), 802–812. 10.1016/j.jtos.2017.08.003. [DOI] [PubMed] [Google Scholar]
  6. Ebrahim AS, Carion TW, Ebrahim T, Win J, Kani H, Wang Y, Stambersky A, Ibrahim AS, Sosne G, Berger EA, 2023. A novel combination therapy Tbeta4/VIP protects against hyperglycemia-induced changes in human corneal epithelial cells. Biosensors (Basel) 13 (11). 10.3390/bios13110974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ebrahim AS, Ebrahim T, Kani H, Ibrahim AS, Carion TW, Berger EA, 2022. Functional optimization of electric cell-substrate impedance sensing (ECIS) using human corneal epithelial cells. Sci. Rep. 12 (1), 14126. 10.1038/s41598-022-18182-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Farrand KF, Fridman M, Stillman IO, Schaumberg DA, 2017. Prevalence of diagnosed dry eye disease in the United States among adults aged 18 years and older. Am. J. Ophthalmol. 182, 90–98. 10.1016/j.ajo.2017.06.033. [DOI] [PubMed] [Google Scholar]
  9. Gamal W, Borooah S, Smith S, Underwood I, Srsen V, Chandran S, Bagnaninchi PO, Dhillon B, 2015. Real-time quantitative monitoring of hiPSC-based model of macular degeneration on electric Cell-substrate impedance sensing microelectrodes. Biosens. Bioelectron. 71, 445–455. 10.1016/j.bios.2015.04.079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Giasson CJ, Deschambeault A, Carrier P, Germain L, 2014. Adherens junction proteins are expressed in collagen corneal equivalents produced in vitro with human cells. Mol. Vis. 20, 386–394. https://www.ncbi.nlm.nih.gov/pubmed/24715756. [PMC free article] [PubMed] [Google Scholar]
  11. Guindolet D, Woodward AM, Gabison EE, Argueso P, 2022. Alleviation of endoplasmic reticulum stress enhances human corneal epithelial cell viability under hyperosmotic conditions. Int. J. Mol. Sci. 23 (9). 10.3390/ijms23094528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Guzman-Aranguez A, Perez de Lara MJ, Pintor J, 2017. Hyperosmotic stress induces ATP release and changes in P2X7 receptor levels in human corneal and conjunctival epithelial cells. Purinergic Signal. 13 (2), 249–258. 10.1007/s11302-017-9556-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hua X, Deng R, Li J, Chi W, Su Z, Lin J, Pflugfelder SC, Li DQ, 2015a. Protective effects of L-Carnitine against oxidative injury by hyperosmolarity in human corneal epithelial cells. Investig. Ophthalmol. Vis. Sci. 56 (9), 5503–5511. 10.1167/iovs.14-16247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hua X, Su Z, Deng R, Lin J, Li DQ, Pflugfelder SC, 2015b. Effects of L-carnitine, erythritol and betaine on pro-inflammatory markers in primary human corneal epithelial cells exposed to hyperosmotic stress. Curr. Eye Res. 40 (7), 657–667. 10.3109/02713683.2014.957776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Keese CR, Wegener J, Walker SR, Giaever I, 2004. Electrical wound-healing assay for cells in vitro. Proc. Natl. Acad. Sci. U. S. A. 101 (6), 1554–1559. 10.1073/pnas.0307588100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Khajavi N, Reinach PS, Skrzypski M, Lude A, Mergler S, 2014. L-carnitine reduces in human conjunctival epithelial cells hypertonic-induced shrinkage through interacting with TRPV1 channels. Cell. Physiol. Biochem. 34 (3), 790–803. 10.1159/000363043. [DOI] [PubMed] [Google Scholar]
  17. Kimura K, Morita Y, Orita T, Haruta J, Takeji Y, Sonoda KH, 2013. Protection of human corneal epithelial cells from TNF-alpha-induced disruption of barrier function by rebamipide. Investig. Ophthalmol. Vis. Sci. 54 (4), 2572–2760. 10.1167/iovs.12-11294. [DOI] [PubMed] [Google Scholar]
  18. Lemp MA, Bron AJ, Baudouin C, Benitez Del Castillo JM, Geffen D, Tauber J, Foulks GN, Pepose JS, Sullivan BD, 2011. Tear osmolarity in the diagnosis and management of dry eye disease. Am. J. Ophthalmol. 151 (5), 792–798 e791. 10.1016/j.ajo.2010.10.032. [DOI] [PubMed] [Google Scholar]
  19. Li JM, Lin N, Zhang Y, Chen X, Liu Z, Lu R, Bian F, Liu H, Pflugfelder SC, Li DQ, 2024. Ectoine protects corneal epithelial survival and barrier from hyperosmotic stress by promoting anti-inflammatory cytokine IL-37. Ocul. Surf. 32, 182–191. 10.1016/j.jtos.2024.03.002. [DOI] [PubMed] [Google Scholar]
  20. Li JM, Lu R, Zhang Y, Lin J, Hua X, Pflugfelder SC, Li DQ, 2021. IL-36alpha/IL-36RA/IL-38 signaling mediates inflammation and barrier disruption in human corneal epithelial cells under hyperosmotic stress. Ocul. Surf. 22, 163–171. 10.1016/j.jtos.2021.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Liu J, Xiao Q, Xiao J, Niu C, Li Y, Zhang X, Zhou Z, Shu G, Yin G, 2022. Wnt/beta-catenin signalling: function, biological mechanisms, and therapeutic opportunities. Signal Transduct Target Ther 7 (1), 3. 10.1038/s41392-021-00762-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Luo L, Li DQ, Pflugfelder SC, 2007. Hyperosmolarity-induced apoptosis in human corneal epithelial cells is mediated by cytochrome c and MAPK pathways. Cornea 26 (4), 452–460. 10.1097/ICO.0b013e318030d259. [DOI] [PubMed] [Google Scholar]
  23. Ma W, Xie Z, Chen H, Zeng L, Chen X, Feng S, Lu X, 2021. Nuclear translocation of beta-catenin induced by E-cadherin endocytosis causes recurrent erosion of diabetic cornea. Exp Biol Med (Maywood) 246 (10), 1167–1176. 10.1177/1535370220983243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Maltseva I, Chan M, Kalus I, Dierks T, Rosen SD, 2013. The SULFs, extracellular sulfatases for heparan sulfate, promote the migration of corneal epithelial cells during wound repair. PLoS One 8 (8), e69642. 10.1371/journal.pone.0069642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Pflugfelder SC, Farley W, Luo L, Chen LZ, de Paiva CS, Olmos LC, Li DQ, Fini ME, 2005. Matrix metalloproteinase-9 knockout confers resistance to corneal epithelial barrier disruption in experimental dry eye. Am. J. Pathol. 166 (1), 61–71. 10.1016/S0002-9440(10)62232-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Raz D, Ben-Yaakov K, Levi M, Bertolin M, Ferrari S, Ponzin D, Busin M, Leiba H, Marcovich AL, Eisenberg-Lerner A, Rotfogel Z, 2024. Mitochondria transplantation promotes corneal epithelial wound healing. Investig. Ophthalmol. Vis. Sci. 65 (6), 14. 10.1167/iovs.65.6.14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Redfern RL, Patel N, Hanlon S, Farley W, Gondo M, Pflugfelder SC, McDermott AM, 2013. Toll-like receptor expression and activation in mice with experimental dry eye. Investig. Ophthalmol. Vis. Sci. 54 (2), 1554–1563. 10.1167/iovs.12-10739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Robertson DM, Li L, Fisher S, Pearce VP, Shay JW, Wright WE, Cavanagh HD, Jester JV, 2005. Characterization of growth and differentiation in a telomerase-immortalized human corneal epithelial cell line. Investig. Ophthalmol. Vis. Sci. 46 (2), 470–478. 10.1167/iovs.04-0528. [DOI] [PubMed] [Google Scholar]
  29. Sharma S, Donthineni PR, Iyer G, Chodosh J, de la Paz MF, Maskati Q, Srinivasan B, Agarwal S, Basu S, Shanbhag SS, 2023. Keratoprosthesis in dry eye disease. Indian J. Ophthalmol. 71 (4), 1154–1166. 10.4103/IJO.IJO_2817_22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Shen J, Liang Y, Bi Z, Yin X, Chen C, Zhao X, Liu S, Li Y, 2023. Cyclosporin A improves the hyperosmotic response in an experimental dry eye model by inhibiting the HMGB1/TLR4/NF-kappaB signaling pathway. Exp. Eye Res. 229, 109418. 10.1016/j.exer.2023.109418. [DOI] [PubMed] [Google Scholar]
  31. Song C, Seong H, Yoo WS, Choi MY, Varga RD, Eom Y, Yun SP, Kim SJ, 2024. Diquafosol improves corneal wound healing by inducing NGF expression in an experimental dry eye model. Cells 13 (15). 10.3390/cells13151251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Stuard Sambhariya W, Trautmann IJ, Robertson DM, 2023. Insulin-like growth factor binding protein-3 mediates hyperosmolar stress-induced mitophagy through the mechanistic target of rapamycin. J. Biol. Chem. 299 (11), 105239. 10.1016/j.jbc.2023.105239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Van den Bossche J, Malissen B, Mantovani A, De Baetselier P, Van Ginderachter JA, 2012. Regulation and function of the E-cadherin/catenin complex in cells of the monocyte-macrophage lineage and DCs. Blood 119 (7), 1623–1633. 10.1182/blood-2011-10-384289. [DOI] [PubMed] [Google Scholar]
  34. Vereb Z, Poliska S, Albert R, Olstad OK, Boratko A, Csortos C, Moe MC, Facsko A, Petrovski G, 2016. Role of human corneal stroma-derived mesenchymal-like stem cells in corneal immunity and wound healing. Sci. Rep. 6, 26227. 10.1038/srep26227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Voss S, Behrmann T, Reichl S, 2023. Development of in vitro dry eye models to study proliferative and anti-inflammatory effects of allogeneic serum eye drops. Int. J. Mol. Sci. 24 (2). 10.3390/ijms24021567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wang J, Zhu R, Dong Y, Feng J, Gao J, Wang S, Lin J, Li Y, Du W, Jin X, Zhang H, 2025. YTHDF3 suppresses declines in corneal epithelial wound healing through upregulating the Wnt/beta-catenin signaling pathway and THBS2 expression in diabetic corneas. Int. J. Biol. Macromol. 285, 138267. 10.1016/j.ijbiomac.2024.138267. [DOI] [PubMed] [Google Scholar]
  37. Woodward AM, Senchyna M, Argueso P, 2012. Differential contribution of hypertonic electrolytes to corneal epithelial dysfunction. Exp. Eye Res. 100, 98–100. 10.1016/j.exer.2012.04.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Yurttaser Ocak S, Karakus S, Ocak OB, Cakir A, Bolukbasi S, Erden B, Bas E, Elcioglu M, 2020. Intense pulse light therapy treatment for refractory dry eye disease due to meibomian gland dysfunction. Int. Ophthalmol. 40 (5), 1135–1141. 10.1007/s10792-019-01278-3. [DOI] [PubMed] [Google Scholar]
  39. Zhou Y, Murrough J, Yu Y, Roy N, Sayegh R, Asbell P, Maguire MG, Ying GS, Group DSR, 2022. Association between depression and severity of dry eye symptoms, signs, and inflammatory markers in the DREAM Study. JAMA Ophthalmol 140 (4), 392–399. 10.1001/jamaophthalmol.2022.0140. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS2168994-supplement-1.pdf (322.3KB, pdf)

Data Availability Statement

Data will be made available on request.

RESOURCES