The role of IL-6 -174C/G polymorphism in hepatitis B virus infection: a genetic association study

Abstract

The development of the disease after infection with the hepatitis B virus (HBV) is linked to single-nucleotide polymorphisms (SNPs). SNPs' involvement in patients' persistent HBV infection is still unknown, though. Thus, the purpose of the current study was to assess the IL-6174C/G polymorphism in hepatitis B-infected Iraqi patients. The results revealed that serum HBV patients had higher levels of several interleukins, including IL-2, which exhibited a significant (P < 0.05) increase in individuals (237.04 ± 16.29 pg/mL) in comparison to the control group (115.42 ± 12.82 pg/mL). Serum IL-4 levels in HBV patients showed a substantial (P < 0.05) decrease as compared to healthy individuals (19.57 ± 1.63 pg/mL vs. 6.85 ± 0.53 pg/mL). When compared to the control group (13.44 ± 1.71 pg/mL), IL-6 levels showed a substantial (P < 0.05) increase in individuals (36.08 ± 1.67 pg/mL). For molecular study, in the patient hepatitis infection sample, the G allele was 65.6%, while the G allele in the control group was 31.1%. While the allele C in the sample of patients was 34.4%, compared to the allele T in the control group, which was 68.9%. The frequency of these genotypes among patients was 56.7%, 16.7%, and 26.6%, respectively, compared with 24.4%, 27.8%, and 47.8%, respectively, among controls. The frequency of GG varied significantly, according to statistics (OR = 0.21, 95% CI = 0.03–0.42, P = 0.001) and the CC genotype (OR = 1.63, 95% CI = 0.5–4.73, p = 0.031) between patients and controls. The mutant allele (allele G) was more common among patients than controls (65.6% vs. 31.1%) with a highly significant change (OR = 0.273, 95% CI = 0.31–0.13, p = 0.001).

1. Introduction

Hepatitis virus infection poses a significant risk to global public health, as the virus could be transmitted via various means, such as intravenous contact and sexual activity, and one of the common transmission methods is mother-to-child. If an infection isn't well managed, it can lead to chronic liver disease, then develop into cirrhosis, and finally lead to hepatocellular carcinoma.¹ The highest prevalence of chronic hepatitis B is found in Asia and Africa.² The World Health Organization estimates that in 2022, 254 million individuals were afflicted with chronic hepatitis B, with 1.2 million new infections occurring annually. Additionally, in that year, hepatitis B caused approximately 1.1 million fatalities, primarily due to cirrhosis and hepatocellular carcinoma (primary liver cancer).³ Individuals afflicted with HBV infection also endure stigma. In 2019, HBV-related cirrhosis accounted for approximately 331,000 fatalities, while deaths from HBV-related liver cancer were estimated at 192,000, rising from 156,000 in 2010. Concurrently, HBV is significantly underdiagnosed, and effective preventive measures against infection and disease progression are inadequately utilized.⁴ In Iraq, infections with the hepatitis virus revealed a significant challenge for public health. Viral hepatitis causes different infections resulting from various viruses; these viruses include hepatitis A, B, C, D, and E. Both hepatitis A and E typically represent acute infections, while hepatitis B, C, and D can progress to chronic conditions.¹ People who contract the hepatitis B virus (HBV) early in early childhood are at risk of developing a chronic illness,5, 6 and the virus is extremely infectious.⁷ Instead of destroying liver cells directly, the hepatitis B virus (HBV) causes inflammatory processes and necrosis of liver tissue by activating the immune system and destroying infected liver cells when the host immune system detects the virus as a foreign antigen. However, during the course of a chronic HBV infection, this process happens sporadically.8, 9 Africa and Asia have the greatest rates of HBV prevalence; over half of all chronic hepatitis B (CHB) infections globally occur in the Western Pacific.¹⁰ However, the prevalence has not been reported in part because of latent HBV infection, reactivation risk of HBsAg-negative patients, and inadequate surveillance systems across nations.¹¹ WHO projected that between 15% and 25% of individuals with CHB would need treatment in 2021.³ Persistent HBV infection is characterized by immunological tolerance.¹² Chronic hepatitis B patients are usually infected in their early years by their parents.¹³ It is noteworthy that although the host's immune system may react to HBV,¹⁴ it does not generate the immunological clearance of HBV. Until they reach immune clearance phases two to four decades later, HBV may proliferate in host cells in a quiet manner. 50% of hosts may eventually remove HBsAg by the age of 80 if HBV can be eliminated, which will stop HBV replication.¹⁰ It is commonly known that SNPs influence the course of disease after HBV infection. Controlling viral infection is largely dependent on the cell-mediated antiviral immune response that is triggered by cytokine production.¹⁵ Common SNPs in a variety of interleukin (IL) genes, including IL-12, IL-10, and IL-4, have thus been linked to HBV susceptibility and persistence or to the risk of HBV-related HCC, according to a number of candidate gene-based case-control association studies.16, 17, 18, 19 The dysregulation in the production of cytokines may lead to an inefficient immune response; such a response will improve viral persistence and then induce the progression of chronic viral hepatitis.²⁰ Many studies demonstrated that an association occurs between human viral infections and some cytokine polymorphisms. In HBV infection, IL-6 contributes to the establishment of immune tolerance by suppressing IL-1 and tumor necrosis factors, which possess anti-inflammatory effects and protect against cellular damage. Interleukin-6 (IL-6) may play a significant role in hepatitis B virus (HBV)-induced hepatocellular carcinoma, liver fibrosis, and liver cirrhosis. IL-6 levels were elevated in individuals infected with the hepatitis B virus, and genetic predisposition was noted in viral infections. The IL-6 GG genotype and G allele may correlate with susceptibility to HBV infection in Iraqi individuals, and the IL-6 gene potentially contributes to the pathogenicity of HBV infection.²¹ This study aimed to assess the IL-6174C/G polymorphism in Iraqi patients with hepatitis B infection.

2. Materials and method

2.1. Subjects

This study was conducted from February 2024 to May 2025, involving a total of ninety patients aged 10 to 40 years. Ethical approval was obtained from the University of Technology and the Iraqi Ministry of Health (Reference No. Ref. No. 14/DAS/2023). Manuscript.²² For comparison, 90 healthy participants were included in the current study. Informed consent was obtained from all subjects and/or their legal guardian. The demographic data were listed in Table 1.

Table 1.

Demographic data.

Variable	Category	Frequency	Percentage
Gender	Male	51	56.66
	Female	39	43.33
Ethnicity	Iraqis	90	100
Education level	Primary school or less	16	17.7
	Secondary school	13	14.4
	University degree or higher	61	67.7
Monthly income	Low income	18	20
	Middle income	57	63.33
	High income	15	16.66

2.2. Inclusion and exclusion criteria

The study included all patients who were confirmed to have a hepatitis B virus infection for more than 6 months by using a specialized clinical examination and blood screening test for HBV antibodies (Core Antibody), while all individuals suffering from other chronic diseases were excluded.

2.3. Sample collection and handling

Blood samples were collected for the current study and were divided into two portions.

2.3.1. Serum Samples has been used for cytokine measurement

A blood sample of about 3–5 mL was transferred to a serum-separating tube (plain tube) and left at room temperature for about 20–30 min to allow for clot formation. For serum separation, samples were centrifuged at 3000 rpm for 10 min. The obtained serum was carefully aliquoted into sterile marked Eppendorf tubes and stored at −20 °C until analysis of cytokine levels using the enzyme-linked immunosorbent assay (ELISA) technique.²³

2.3.2. Whole blood for DNA extraction and PCR analysis

For molecular analysis, about 2–5 mL of blood samples were collected into anticoagulant tubes (EDTA tubes). Genomic DNA was extracted using a commercial DNA extraction kit according to the manufacturer's instructions. Then the extracted DNA was stored at −20 °C until the polymerase chain reaction (PCR) was performed. To maintain participant confidentiality, all samples were properly labeled with codes that include all required information. Repeated freeze–thaw cycles were avoided to preserve the stability of cytokines and nucleic acids.

2.4. ELISA assay

Cytokine levels of human IL-2, IL-4, and IL-6 were quantified using Enzyme-Linked Immuno-Sorbent Assay (ELISA) kits provided by SUNLONG, China. The concentrations of IL-2, IL-4, and IL-6 in the specimens were quantified by comparing their optical density to a calculated standard curve. To guarantee precision and uniformity, all standards, samples, and reagents were meticulously prepared in complete accordance with the instructions outlined in the kit leaflet.

2.5. Extraction of DNA

Genomic DNA was extracted from whole blood using the Wizard® Genomic DNA Purification Kit. 50 μl of sample was mixed with 150 μl of cell lysis solution and mixed by pipetting for about 2 to 3 min, then incubated for 10 min for red blood cell lysis. After centrifugation the supernatant was discarded, and the pellet was mixed with 50 mL of nuclei lysis solution to complete lysis of white blood cells. Then 16.5 μl of protein precipitation solution was added, followed by vortexing and centrifugation. The supernatant containing DNA was carefully transported to a clean tube containing 50 μl of isopropanol at room temperature to precipitate the DNA. After centrifugation for 1 min, the supernatant was discarded, and the pellet was rinsed with 30:70 water:EtOH. The pellet was air-dried, rehydrated in 100 μL of DNA, and stored at −20 °C until further use.

2.6. PCR Premix kit

According to the Korean company BIONEER's accompanying paper, an AccuPower® PCR PreMix kit was used for ARMS-PCR technology research.

2.6.1. Primers

The IL-6 mutant gene was identified using three of the unique primers, where the antisense was:

IF4 TCCCCCTAGTTGTGTCTTCCC 21.

IR4 GCAATGTGACGTCCTTTAGCTTC 23.

OF4 AAGACATGCCAAAGTGCTGAGTC 23.

OR4 ATGAGCCTCAGACATCTCCAGTC 23.

Base pair for C allele: 197, base pair for G allele: 149, base pair of two outer primers: 302.

2.6.2. The recognition of IL-6174C/G

The IL-6174C/G gene was characterized utilizing the polymerase chain reaction technique of the ARMS-PCR replication system, with a slight deviation observed in the master mix manufacturing protocol. In accordance with the BIONEER protocol, investigations utilizing ARMS-PCR technology were conducted with the AccuPower® kit. The PCR reaction was prepared in a final volume of 25 μL per sample, comprising 12.5 μL PCR Master Mix, 8.5 μL nuclease-free water, 2 μL template DNA, and 1 μL reverse primer (10 pmol) for each primer. The specific A primer and the antisense primer were utilized to identify the A allele, whereas the specific T primer and the antisense primer were employed to identify the T allele. The instrument software was adjusted to achieve optimal interaction conditions, and the samples were positioned in a thermocycler for DNA replication. Table 2 presented the optimal conditions for the detection and identification of IL-6174C/G.

Table 2.

The optimum condition of detection recognition of IL-6174C/G.

Phase	T	Time	No. of cycle
Denaturation	95 °C	15 s	1 cycle
Denaturation	96 °C	30 s	30 cycle
Annealing	65 °C	50 s
Extension	72 °C	40 s

2.7. In silico analysis

The 3D structural data for a wide variety of proteins, including interleukin-6 (IL-6), can be analyzed by the PDB ID: 1ALU. The PDB entries that describe IL-6 typically include both its native structure and complexes with its receptors. PDB (Protein Data Bank) (https://www.rcsb.org/) description of IL-6 structure.²⁴ The resource that provides specific details on the expression and distribution of human proteins in various tissues, organs, and cells is the Human Protein Atlas (HPA) (https://www.proteinatlas.org/). By combining information from many high-throughput methods, including RNA sequencing, immunohistochemistry, and antibody-based tests, it allows scientists to investigate the location and role of proteins in human biology. From studying the biological roles of proteins to identifying biomarkers and possible targets for drug development, the HPA is an invaluable tool for a variety of studies.²⁵ A useful bioinformatics technique for comprehending the biological networks and pathways in which genes and proteins are involved is KEGG Pathway Analysis (https://www.genome.jp/kegg/pathway.html). The Kyoto Encyclopedia of Genes and Genomes, or KEGG for short,26, 27 is a comprehensive database that combines information on systemic, chemical, and genetic functions. Researchers can investigate the biological pathways that may be impacted in a particular illness, organism, or experimental state with the use of KEGG Pathway Analysis. This study is very useful for comprehending medication targets, gene function, disease causes, and how mutations affect cellular functions. SNP analysis by NCBI (National Center for Biotechnology Information) (https://www.ncbi.nlm.nih.gov/SNP) is the process of analyzing rs1800795 using the tools and resources that NCBI provides.²⁸ SNPs are the most prevalent kind of genetic variation in people and can significantly affect genetic features, pharmacological reactions, and disease risk.

2.8. Statistical analysis

To identify whether averages differed significantly of different factor of this study, PCR product data were compared using Fisher's at P < 0.05 using the SPSS statistical software. Genotypes, allele frequencies, odds ratios (OR), and confidence intervals (CI) were assessed using the Compare 2 Ver.3.04 software.²⁰ According to the www.had2know.com website, the results were examined using the Hardy-Weinberg equilibrium rule.

3. Results and discussion

3.1. Circulating IL-6, IL-4 and IL-2 in HBV infected patients and healthy controls

Some interleukin levels in serum HBV patients are shown in Table 3. IL-2 levels showed a significant (P < 0.05) elevation in individuals (237.04 ± 16.29 pg/mL) in comparison to the control group (115.42 ± 12.82 pg/mL). Serum IL-4 levels in HBV patients showed a significant (P < 0.05) lowering as compared to healthy individuals (19.57 ± 1.63 pg/mL vs. 6.85 ± 0.53 pg/mL). When compared to the control group (13.44 ± 1.71 pg/mL), IL-6 levels showed a substantial (P < 0.05) increase in individuals (36.08 ± 1.67 pg/mL).

Table 3.

Concentrations of interleukins in the groups under study.

Parameters	Control (90)	Patients (90)	P-Value
IL-2 pg/mL	115.42 ± 12.82	237.04 ± 16.29*	0.001
IL-4 pg/mL	19.57 ± 1.63	6.85 ± 0.53*	0.001
IL-6 pg/mL	13.44 ± 1.71	36.08 ± 1.67*	0.001

IL-2 has been examined in CHB in the current study, primarily because of its function in HBV-specific T-cells.²¹ In one of the earliest investigations to measure IL-2 activity in CHB patients, Anastassakos et al.²⁹ demonstrated that the mononuclear cells of CHB patients had noticeably lower IL-2 activity in comparison to controls. However, in contrast to Debnath et al.,³⁰ Ozeki et al.³¹ demonstrated that blood IL-2 levels in CHB patients were greater than in controls and linked with the extent of liver injury. Consistent with our research, Rossol et al.³² found that necro-inflammatory individuals had greater levels of IL-2 than chronic HBV carriers with less histological activity. They also observed that serum levels of IL-2 were enhanced in chronic HBV infection. According to the findings, chronic HBV patients had significantly lower levels of cytokine IL-4 than did healthy people. Monsalve-De Castillo et al.³³ found similar outcomes, indicating a notable reduction in IL-4 levels during the acute and convalescent stages of HBV infection. Additionally, it has been suggested that the auto-regulatory mechanism of IL-10 may be the cause of the reduction in IL-4 levels. Penna et al.³⁴ reported that acute self-limited hepatitis B infection was associated with elevated levels of IL-4 and IL-5. In chronic HBV patients, levels of circulating IL-4 and IL-6 were found to positively correlate with viral load.³⁵ Therefore, in chronic HBV patients, a drop in IL-4 clearly suggests a decreased viral load. According to some published research, there is a connection between inflammatory alterations in the liver and IL-6 serum levels. According to Kakumu et al., people with chronic active hepatitis B had higher serum levels of IL-6.³⁶ During the acute phase of cirrhosis and hepatitis, IL-6 levels have been demonstrated to be significantly higher than normal; in cases of severe cirrhosis, these levels increased even more.³⁷ According to this study, the IL-6 level in the HVB group was significantly higher than in the control group for HBV individuals.

3.2. Detection of gene polymorphisms of IL-6 -174C/G by allele specific PCR

Hardy-Weinberg Equilibrium (HWE) was well-aligned with the genotype distribution in both polymorphisms for both patients and controls. As illustrated in Fig. 1, AS-PCR revealed that this polymorphism manifested in three genotypes in both patients and controls: GG, GC, and CC. The G allele was 65.6% in the patient's hepatitis infection sample, compared to 31.1% in the control group. However, Table 4 shows that the allele T in the control group was 68.9%, whereas the allele C in the sick sample was 34.4%.

Fig. 1.

The IL-6174C/G gene electrophoresis demonstrates the presence of both alleles, G and C, in samples.

Table 4.

Showed the repeats of two alleles G and C.

Gene	Type of allele	HBV (90)	Healthy people (90)	OR (95%CI)	P value
IFN-γ	G	59(65.6%)	28(31.1%)	0.273(0.31–0.13)	*0.001
	P·F	46.55%
	C	31(34.4%)	62(68.9%)	3.46(1.41–6.42)
	E.F	35.17%

PF = Preventive faction, EF = Etiological faction.

The frequency of these genotypes among patients was 56.7%, 16.7%, and 26.6%, respectively, compared with 24.4%, 27.8%, and 47.8%, respectively, among controls (Table 5). The frequency of GG varied significantly (OR = 0.21, 95% CI = 0.03–0.42, P = 0.001) and the CC genotype (OR = 1.63, 95% CI = 0.5–4.73, P = 0.031) between patients and controls (Table 5). The mutant allele (allele G) was more common among patients than controls (65.6% vs. 31.1%) with a highly significant difference (OR = 0.273, 95% CI = 0.31–0.13, p = 0.001), displayed in Table 5.

Table 5.

The frequency of IL-6174C/G mutant gene genotypes.

Gene name	The genotype	HBV (90)	Healthy people (90)	OR (95%CI)	P value
IL-6	GG	51(56.7%)	22(24.4%)	0.21(0.03–0.42)	*0.001
	P·F	41.3%
	GC	15(16.7%)	25(27.8%)	2.98(8.83–0.68)	*0.182
	E.F	14.1%
	CC	24(26.6%)	43(47.8%)	1.63(0.5–4.73)	0.031
	E.F	36.5%

EF = Etiological faction, CI = Confidence Intervals, OR = Odds ratio, PF = Preventive faction.

According to the current study, Iraqi patients who had the homozygous polymorphism (CC) genotype were at lower risk of contracting HBV infection, but those who had the GG genotype were at higher risk. According to Wang et al.'s meta-analysis study,³⁸ the GC genotype was associated with an increased risk of contracting hepatitis C. On the other hand, the GG genotype and the combination of the GG + GC genotype were linked to the likelihood of developing hepatitis B. The population under evaluation appears to have an impact on the relationship between genotypes and hepatitis B risk. However, in the current investigation, the GG genotype was linked to elevated viral load and IL-6 levels in HCV infection, which exacerbated the chronic infection. These findings imply that the effect of the IL6-174G/C on viral hepatitis may vary according to the population's ethnic composition. According to other research, the GG genotype is linked to an increased risk of developing chronic hepatitis B.39, 40 For the first time, a connection between the progression of chronic HBV infection and the IL-6 polymorphism (−174G > C) was documented in 2009 by Fabris et al.⁴¹ They used a restriction fragment length polymorphism assay based on the polymerase chain reaction to analyze polymorphism. Although the C allele was more common in HCV-infected patients than in controls, this association was not significant when confounders were taken into account, according to a different study that looked for a correlation between hepatitis C virus infection and interleukin-6 Gene (−174 G > C) polymorphisms. In both groups, the most prevalent genotype was the GG polymorphism (P = 0.44), whereas the least prevalent genotype was the CC polymorphism (P = 0.12).⁴² Additionally, Yalcin et al.⁴³ reported that, in comparison to hepatitis B virus carriers and non-infected persons with HBV, a statistically limited connection was found between IL-6 polymorphism (G/G, G/C, and C/C genotypes) with chronic hepatitis B and cirrhosis (p = 0.045).

3.3. Structure analysis of interleukin-6

The IL-6 gene encodes one of the cytokine interleukin-6 proteins, which is also known as CDF, HGF, HSF, BSF2, IL-6, BFF-2, IFN B2, or IFN-beta-2. This gene consists of 5 exons located at 7p15.3, with a length of 4799 bp between the regions 22,727,200 and 22,731,998. Understanding the structure of the IL-6 protein is essential because it determines how it interacts with its receptors, such as the IL-6 receptor (IL-6R), and its signaling pathways. This monomeric protein, made up of 211 amino acids, two tartaric acids, and 8 sulfate ions, also contains disulfide bonds that help stabilize its three-dimensional structure,⁴⁴ Fig. 2. The N-terminal region of IL-6 contains conserved residues involved in receptor binding. The 3D structure of human IL-6 has been elucidated by the technique of X-ray crystallography, with PDB ID: 1ALU.

Fig. 2.

The quarterly structure of IL-6 protein with PDB ID: 1ALU, (A) the monomeric structure of interleukin-6 protein, (B) the position of two tartaric acid ligands, (C) the position of 8 sulfate ions, and (D) the 3D monomeric structure of IL-6 protein with ligands and ions.

The anti-inflammatory and antioxidant properties of tartaric acid could influence the production and signaling of the two ligands of tartaric acid with the molecular formula C₄H₆O₆ in the IL-6 protein structure. By reducing oxidative stress and modulating immune cell functions, tartaric acid may indirectly lower IL-6 levels and help manage inflammation in conditions where IL-6 is elevated. While 8 sulfate ions play an important role in modulating the biological activity of IL-6 by enhancing its binding to its receptor complex, facilitating more efficient signaling and increasing its stability, see Fig. 3.

Fig. 3.

The position of the ligands and ions atoms, (A) the structure and position of the tartaric acid (TLA300) ligand, and (C) the structure and position of the sulfate ion (SO₄ 293).

3.4. Related between IL-6 protein and disease

The IL-6 gene encodes the cytokine interleukin-6, which is significant in various diseases and is involved in inflammation and B cell maturation. Moreover, the encoded protein functions as an endogenous pyrogen, capable of eliciting fever in individuals with autoimmune disorders or infections. The protein is predominantly synthesized at locations of acute and chronic inflammation, where it is released into the serum and triggers a transcriptional inflammatory response via the interleukin 6 receptor alpha. This gene's function is associated with various inflammation-related diseases, including susceptibility to diabetes mellitus and systemic juvenile rheumatoid arthritis. Increased concentrations of the encoded protein have been observed in viral infections, including HBV.⁴⁵ The relative plasma concentrations of IL-6 protein in the blood of patients with various diseases were assessed using a proximity extension assay (PEA), as illustrated in Fig. 4.

Fig. 4.

The IL-6 protein concentration in the disease cohort.

The IL-6 gene is upregulated in various diseases, including streptococcal soft tissue infection, Pneumococcal pneumonia, Staphylococcus aureus bacteremia, E. coli pyelonephritis, Mycoplasma pneumonia, alcohol-related liver disease, pediatric systemic inflammatory disease, chronic liver disease, hepatocellular carcinoma, malaria, pediatric lymphoma, influenza, pediatric renal tumor, viral hepatitis-related cirrhosis, and bacterial gastroenteritis. Acute venous thromboembolism, rheumatoid arthritis, pediatric retinoblastoma, pancreatic carcinoma, acute myeloid leukemia, MASLD, bipolar disorder, dengue fever, diffuse large B-cell lymphoma, systemic lupus erythematosus, myositis, ovarian carcinoma, lung carcinoma, acute coronary syndrome, systemic sclerosis, myeloma, melanoma, schizophrenia, and abdominal aortic aneurysm. A gene is deemed upregulated in a disease if the mean concentration across all samples of that disease is significantly elevated (adjusted P-value <0.005 and NPX difference ≥ 1) compared to the mean concentration of samples from all diseases, as assessed by PEA. Plasma proteomes from 59 diseases and 6121 patients, incorporated in a pan-disease study, have been examined.⁴⁶ This study encompasses diseases from multiple categories, including cardiovascular, metabolic, oncological, psychiatric, autoimmune, infectious, and pediatric disorders. The HBV disease is classified within the metabolic category, as illustrated in Fig. 5.

Fig. 5.

The 7 classes include different disease views; the metabolic class involves viral hepatitis-related cirrhosis.

The IL-6 protein concentration in different metabolic diseases in the present study highlights viral hepatitis-related cirrhosis. An IL-6 NPX value of 2.2 (Table 6) indicates that IL-6 levels are elevated in the expression of the samples when compared with NPX in healthy samples that suggest (−0.5) indicates low IL-6 levels,⁴⁷ typical of individuals without significant inflammation or disease. This suggests that IL-6 is likely playing a role in the inflammatory processes associated with viral hepatitis-related cirrhosis.⁴⁸ However, the substantial difference in IL-6 between the two groups (2.7 NPX difference) underscores the inflammatory nature of cirrhosis and the role of IL-6 in chronic liver disease. This difference can be used for diagnostic and monitoring purposes in clinical settings.

Table 6.

The level of IL-6 protein for metabolic disease.

No.	Type of metabolic disease	Number of samples	IL-6 protein concentration (NPX)
1.	Healthy	834	−0.5
2.	Viral hepatitis related cirrhosis	77	2.2
3.	Type 2 diabetes	78	0.3
4.	Obesity	243	0
5.	Metabolic syndrome	353	0
6.	MASLD	1	1
7.	Chronic liver disease	39	4.3
8.	Alcohol-related liver disease with	14	4

Hepatitis is most commonly caused by infections with one or more of the following viruses: hepatitis A, B, C, D, or E. These viral illnesses are caused by either consuming fecal-contaminated food and/or drinks (hepatitis A and E) or coming into touch with infected biofluids (hepatitis B, C, and D) (WHO).

Hepatitis B, C, and D infections are the most common cause of CLD. While hepatitis B tends to be a short-term disease, it can lead to cirrhosis, cancer, and liver failure when it becomes chronic. Hepatitis C, unlike hepatitis B, usually leads to chronic illness.⁴⁹ Chronic hepatitis C, if not treated properly, can develop into hepatocellular cancer. Hepatitis D, the least prevalent of the bunch, is a satellite virus that only spreads alongside hepatitis B. However, with timely diagnosis, antiviral therapy for hepatitis B, C, or D can hinder disease progression and increase survival chances.⁵⁰

3.5. Pathway analysis of HBV and related with IL-6

The genome of the encapsulated hepatitis B virus (HBV) consists of partially double-stranded relaxed circular DNA (RC-DNA). HBV RC-DNA infiltrates hepatocytes, translocates to the nucleus, and converts into cccDNA, a covalently closed circular entity. The pregenomic RNA (pgRNA), which encodes seven viral proteins—the large, middle, and small envelope proteins (LHBs, MHBs, and SHBs) constituting the surface antigen (HBsAg), the core antigen (HBcAg), the e antigen (HBeAg), the HBV polymerase, and the regulatory protein X (HBx)—is transcriptionally derived from the cccDNA.⁵¹ The encapsidation process into the core particles commences with the interaction between pgRNA and the viral polymerase protein. The core particles complete their assembly with envelope proteins via the endoplasmic reticulum and are subsequently released. HBV infection results in a diverse array of liver diseases, including chronic hepatitis, cirrhosis, and hepatocellular carcinoma. The etiology of hepatic injury remains ambiguous. HBV proteins, however, interact with host proteins that participate in diverse functions, thereby modulating transcription, cellular signaling pathways, proliferation, differentiation, and apoptosis.

3.6. Single nucleated polymorphism analysis (SNP: rs1800795)

Single-nucleotide polymorphism (SNP) analysis concentrates on identifying variations at particular single-nucleotide sites in the genome where individuals exhibit differences in their DNA sequences.

The rs1800795 denotes a particular single nucleotide polymorphism (SNP) located in the promoter of the IL6 gene at position 22,727,026, specifically at position 21 within the promoter region. The interleukin-6 protein, encoded by the IL-6 gene located at 7p15.3, comprises 5 exons and 4 introns, totaling 4799 bp within the region 22,727,200 to 22,731,998⁵².

This SNP features a substitution of guanine (G) with cytosine (C) at position −174, which is measured relative to the transcription start site of the IL6 gene. The two alleles present at rs1800795 are G (guanine) and C (cytosine), and this polymorphism is commonly represented as -174G/C. The position of SNP rs1800795 was on chr7 at position 22,727,026 bp (upstream variant) (Fig. 6). The variation type was SNV (single nucleotide variation). Alleles, which include the C > G / C > T, the present study highlights on SNP: rs1800795 C > G. More specifically, the SNP view on the enhancer (BRD4-independent group 4 enhancer),⁵³ Fig. 7, located on chr7 at region 22,766,269–22,767,468 (chr7:22766269–22,767,468) with enhancer ID: enh111220, is 1200 nt in length.

Fig. 6.

Shows the position of (SNP:rs1800795) on the negative strand at the short arm (q) of chromosome 7.

Fig. 7.

Shows the location of SNP rs1800795 (NC_000007.14) on the BRD4-independent group 4 enhancer, at position 22,727,026, where the region of the enhancer is between 22,766,269 and 22,767,468.

3.7. Enhancer (BRD4-independent group 4 enhancer) analysis

The BRD4-independent group 4 enhancers are a category of enhancers that drive gene expression through mechanisms not involving the BRD4 protein. These enhancers still play critical roles in regulating genes, possibly by using alternative transcriptional co-factors or chromatin regulators.⁵⁴ They represent a distinct class of regulatory elements and may have significant biological implications, particularly in contexts such as development, disease (including cancer), and potential resistance to BRD4-targeted therapies. Located at Chr7 region 22,766,269–22,767,468 (chr7:22766269–22,767,468), enhancer ID:enh111220, the length is 1200 nt. The IL6 gene's promoter region has a functional polymorphism known as rs1800795 that influences the rate of IL6 expression. Higher IL-6 levels are linked to the G allele, whereas lower levels are linked to the C allele. Numerous illnesses, especially those involving inflammation, like autoimmune diseases, cardiovascular problems, cancer, and metabolic diseases, have been linked to this SNP.⁵⁵

4. Conclusions

The current study reveals that the hepatitis B virus (HBV) infection disrupts the host immune response in selected Iraqi patients. This work was proven by a pronounced shift in circulating cytokine profiles. Particularly, HBV patients showed elevated serum levels of IL-2 and IL-6. In addition to that, they exhibited decreased IL-4 levels, indicating an immune imbalance that drives viral persistence and liver inflammation. Besides that, molecular analysis of the IL-6 -174C/G polymorphism (rs1800795) demonstrated a strong genetic tendency toward HBV susceptibility. The mutant G allele and the homozygous GG genotype were more frequent in the patient group, suggesting that the GG genotype acts as a risk factor for developing chronic hepatitis B. On the contrary, the CC genotype appears to confer a protective effect against the infection. The current results were supported by structural and pathway analyses achieved via bioinformatics tools. The bioinformatics findings highlight the critical role of the IL-6 gene—and its regulatory enhancer regions—in the pathogenesis of HBV and related liver diseases such as cirrhosis. Moreover, this research suggests that the IL-6 -174C/G polymorphism and specific cytokine levels could serve as valuable diagnostic and prognostic biomarkers for HBV susceptibility and progression. This study recommends future targeted clinical monitoring and personalized therapeutic strategies.

CRediT authorship contribution statement

Nawar B. Abdulsahib: Writing – review & editing, Writing – original draft, Methodology, Conceptualization. Ahmed S. Khalaf: Writing – review & editing, Writing – original draft, Methodology. Maryam Dhary: Writing – review & editing, Writing – original draft. Ragheed H. Yousif: Writing – review & editing, Writing – original draft, Software. Ghassan M. Sulaiman: Writing – review & editing, Writing – original draft, Conceptualization. Hamdoon A. Mohammed: Writing – review & editing, Software, Investigation. Majid S. Jabir: Writing – review & editing, Writing – original draft. Khaled Haidar: Writing – review & editing, Investigation. Akram B. Sultan: Writing – review & editing, Writing – original draft, Investigation.

Ethics approval and consent to participate

All protocols employed in these experiments received approval from the Human Care and Ethics Committee, Division of Biotechnology, Department of Applied Sciences, University of Technology—Iraq (Ref. No. 14/DAS/2023). The work was carried out in accordance with the Code of Ethics of the World Medical Association (Declaration of Helsinki). The WHO and European Association for the Study of the Liver (EASL) guidelines on HBV testing were followed.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.