Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2002 Dec;46(12):3739–3743. doi: 10.1128/AAC.46.12.3739-3743.2002

Distribution of Extended-Spectrum β-Lactamases in Clinical Isolates of Enterobacteriaceae in Vietnam

Van Cao 1,2, Thierry Lambert 1,3,*, Duong Quynh Nhu 2, Huynh Kim Loan 2, Nguyen Kim Hoang 2, Guillaume Arlet 4, Patrice Courvalin 1
PMCID: PMC132739  PMID: 12435670

Abstract

Among 730 Escherichia coli, 438 Klebsiella pneumoniae, and 141 Proteus mirabilis isolates obtained between September 2000 and September 2001 in seven hospitals in Ho Chi Minh City, Vietnam, 26.6% were resistant to ceftazidime, 30% were resistant to cefotaxime, 31.5% were resistant to ceftriaxone, 15.9% were resistant to cefoperazone, and 6% were resistant to cefepime. Resistance to imipenem was found in 5.6% of the isolates. In 55 strains producing extended-spectrum β-lactamases (32 E. coli isolates, 13 K. pneumoniae isolates, and 10 P. mirabilis isolates), structural genes for VEB-1 (25.5%), CTX-M (25.5%), SHV (38.1%), and TEM (76.3%) enzymes were detected alone or in combination. Sequencing of the PCR products obtained from the K. pneumoniae isolates revealed the presence of blaVEB-1, blaCTX-M-14, blaCTX-M-17, blaSHV-2, and blaTEM-1. Molecular typing of the strains with a similar resistance phenotype to broad-spectrum cephalosporins indicated polyclonal spread. ISEcp1 was presumably responsible for dissemination of the blaCTX-M-like gene.


Resistance to broad-spectrum cephalosporins in members of the family Enterobacteriaceae can be secondary to alterations in outer membrane proteins, overproduction of chromosomal or plasmid-mediated cephalosporinases, or production of extended-spectrum β-lactamases (29). Most extended-spectrum β-lactamases in the Enterobacteriaceae belong to Ambler class A (1), and among these, the majority are plasmid-encoded TEM and SHV derivatives that remain susceptible to the penicillinase inhibitors (4; G. A. Jacoby and K. Bush [http://www.lahey.org/studies/webt.htm]). However, other families of class A enzymes, such as CTX-M and VEB, are rapidly expanding and may play a significant role in resistance to extended-spectrum cephalosporins in Southeast Asia.

CTX-M β-lactamases are much more active against oxyimino β-lactams, such as cefotaxime and aztreonam, than against ceftazidime (34). To date, the CTX-M family comprises more than 20 members isolated from various enterobacterial species in different geographic areas. CTX-M-17, a recently added member in this group, was detected in a Klebsiella pneumoniae clinical isolate from Vietnam (5). It is closely related to blaCTX-M-14 identified in China (accession no. AF252622) and Korea (24). The blaCTX-M-17 gene is flanked downstream by an IS903-C copy and upstream by an ISEcp1-like element which provides the promoter and directs the transcription of the gene. The ISEcp1-like copy is also able to mobilize blaCTX-M-17 and has been proposed to be responsible for dissemination of the gene (5).

The VEB-1 β-lactamase was identified recently in an Escherichia coli isolated from a Vietnamese patient and is widespread in Pseudomonas aeruginosa strains from Thailand (8). Study of its genomic environment indicated that blaVEB-1 was a class 1 integron located in the chromosome (19) or on plasmids (33). The VEB-1 β-lactamase confers a higher level of resistance to ceftazidime than to cefotaxime.

In enterobacteria, extended-spectrum β-lactamases are mainly produced by E. coli, K. pneumoniae, or Proteus mirabilis strains responsible for nosocomial infections (15). These strains are disseminated worldwide (16), but little is known about their prevalence among clinical isolates from Southeast Asia (12). This region faces a serious problem of antibiotic resistance since the drugs are freely available and are used in an indiscriminate fashion.

The aim of this study was (i) to establish the prevalence of resistance to broad-spectrum cephalosporins among K. pneumoniae, P. mirabilis, and E. coli strains recovered during a 1-year period in various hospitals in Ho Chi Minh City, Vietnam, and (ii) to characterize the mechanisms responsible for resistance in representative isolates.

MATERIALS AND METHODS

Clinical isolates.

The susceptibilities of 1,309 consecutive isolates, including E. coli (730), K. pneumoniae (438), and P. mirabilis (141), isolated between September 2000 and September 2001 in seven hospitals in Ho Chi Minh City to ceftazidime, cefotaxime, ceftriaxone, cefoperazone, cefepime, and imipenem were determined by E-test (AB BIODISK, Solna, Sweden). The results obtained were interpreted according to the guidelines of the National Committee for Clinical Laboratory Standards (21). A single isolate per patient was included, and the number of isolates by hospital varied from 57 to 353. Approximately 15 isolates per hospital collected from sporadic cases in intensive care units and medicine, surgery, and pediatric wards, were selected for further analysis; however, a possible link of the sporadic isolates with an outbreak cannot be excluded. The method for susceptibility testing was uniform in all hospitals participating in this study.

One hundred randomly selected isolates resistant to extended-spectrum cephalosporins were studied by the double-disk test (10). The identifications of 55 isolates (E. coli, 32 isolates; K. pneumoniae, 13 isolates; and P. mirabilis, 10 isolates) which displayed synergy between ceftazidime or cefotaxime and clavulanic acid (3, 10) were confirmed with the API 20E test (bioMérieux, Lyon, France). Strains were grown in brain-heart infusion broth and agar (Difco) at 37°C.

Antibiotic susceptibility testing and screening for production of extended-spectrum β-lactamases.

The antibiotic susceptibility of the 55 enterobacteria was determined by disk diffusion on Mueller-Hinton agar (Bio-Rad, Marnes-la-Coquette, France). The MICs of β-lactams were determined, alone or in combination with a fixed concentration of clavulanic acid (2 μg/ml), by agar dilution with an inoculum of 104 CFU per spot on Mueller-Hinton medium after 16 h of incubation at 37°C.

DNA manipulations.

Total DNA was prepared as described previously (30), and plasmid DNA was purified by using the Wizard Minipreps DNA kit (Promega, Madison, Wis.).

PCR detection of blaTEM, blaSHV, blaPER-1, blaVEB-1, blaOXA-10, blaCTX-M, and blaGES-1 was performed with specific oligodeoxynucleotides (Table 1). The combination of primers ISEcp1 and CTX-2S, complementary to internal portions of blaCTX-M-17, was used to screen for the presence of ISEcp1 upstream from blaCTX-M-17. PCR was performed in 100-μl reaction mixtures consisting of 1× Pfu DNA polymerase buffer, 2 U of Pfu DNA polymerase (Stratagene, La Jolla, Calif.), 1.5 mM MgCl2, 200 μM deoxynucleoside triphosphates, 50 pmol of each primer, and 25 ng of DNA in a GeneAmp PCR system 2400 (Perkin-Elmer Cetus, Norwalk, Conn.). The PCR mixture was submitted to a denaturation step (2 min at 94°C), which was followed by 30 cycles of amplification (45 s of denaturation at 94°C, 1 min of annealing at 52°C, 1 min of elongation at 72°C) and 10 min at 72°C for the last step. The PCR products were analyzed by electrophoresis in a 1.2% agarose gel.

TABLE 1.

Sequence of primers for detection of bla genes or genotyping of strains

Target Primer name Primer sequence (5′-3′) Position Reference or accession no.
Detection primers
    blaSHV OS-5 TTA TCT CCC TGT TAG CCA CC 23-42 Y11069
     OS-6 GAT TTG CTG ATT TCG CTC GG 799-818
    blaTEM C TCGGGGAAATGTGCGCG 90-105 32
     D TGCTTAATCAGTGAGGCACC 1042-1062
    blaCTX-M MA-1 SCS ATG TGC AGY ACC AGT AA 270-289 X92506
     MA-2 CCG CRA TAT GRT TGG TGG TG 794-813
    blaCTX-M-14, 17 Toho-2 M9U ATG GTG ACA AAG AGA GTG CA 112-131 D89862
     M9L CCC TTC GGC GAT GAT TCT C 957-975
    blaVEB-1 VEBcas-F CGA CTT CCA TTT CCC GAT GC 128-151 AF010416
     VEBcas-B GGA CTC TGC AAC AAA TAC GC 1198-1180
    blaOXA-10 OXA-10scaF TTA GGC CTC GCC GAA GCG 7331-7348 AF205943
     OXA-10casB CTTTGTTT TAG CCA CCA ATG ATG 8297-8319
    blaPER-1 PER-A ATG AAT GTC ATT ATA AAA GC 309-328 22
     PER-B AAT TTG GGC TTA GGG CAG AA 1233-1214
    blaGES-1 GES-1A ATG CGC TTC ATT CAC GCA C 1322-1340 28
     GES-1B CTA TTT GTC CGT GCT CAG G 2095-2077
    blaCTX-M upstream ISEcpl-L CCT AGA TTC TAC GTC A 1138-1159 5
     CTX-2S TTG CTG CAC CGC ACT CGT 3211-3194
Genotyping primer (rep-PCR)
BOX-A1 CTACGGCAAGGCGACGCTGACG 11
ER1C2 AAGTAAGTGACTGGGGTGAGCG 35

The PCR-NheI method was used to discriminate between blaSHV-BLSE and blaSHV-nonBLSE genes (23).

The amplification products were purified with the QIAquick PCR purification kit (Qiagen, Courtaboeuf, France) and sequenced directly on both strands using a CEQ 2000 DNA analysis system automatic sequencer (Beckman Instruments, Inc., Palo Alto, Calif.).

Colony hybridization.

The search for blaVEB-1 by colony hybridization was carried out as follows. Bacteria spotted with a multiple inoculator on sterile nitrocellulose filters were lysed after 3 h of incubation on Mueller-Hinton agar, and hybridization was performed in 50% formamide at 42°C as described previously (30). The amplification product internal to blaVEB-1 used to generate the probe was labeled with [α-32P]dCTP (3,000 Ci/mmol; Amersham Radiochemical Center, Amersham, England) using a nick translation kit (Amersham).

Computer analysis of sequence data.

Nucleotide and amino acid sequences were analyzed with the Genetics Computer Group (Madison, Wis.) sequence analysis software package (version 7). The GenBank and SwissProt databases were screened for sequence similarity.

Strain typing.

Total DNA was amplified by repetitive extragenic palindromic PCR (rep-PCR) with primers ERIC2 or BOX-A1 (Table 1) as described previously (11). PCR products were electrophoresed in 1.2% agarose, stained with ethidium bromide, and visualized using a UV transilluminator and a digital image capture system (Gel Doc; Bio-Rad, Hercules, Calif.)

RESULTS AND DISCUSSION

Prevalence of resistance to broad-spectrum cephalosporins in Enterobacteriaceae.

During a 1-year period, from September 2000 to September 2001, the susceptibilities to broad-spectrum cephalosporins of a total of 1,309 clinical isolates of K. pneumoniae, P. mirabilis, and E. coli were tested in seven hospitals in Ho Chi Minh City (Table 2). Strains resistant or intermediate to ceftazidime were more predominant in E. coli (32%) and P. mirabilis (30%) than in K. pneumoniae (17%). These figures are similar to those recently reported from Thailand, where 35% of enterobacteria were resistant to ceftazidime (6), but much higher than those in European countries (9, 25). Resistance to cefotaxime and cefpirome ranged from 25 to 35% and was equally distributed in all three groups. Imipenem and cefepime were the most active, but resistance was detected in the three species, in particular in P. mirabilis, with resistance to cefepime and to imipenem of 9 and 4%, respectively.

TABLE 2.

Prevalence of resistance to cephalosporins and imipenem among enterobacteria

Strain (no. of isolates) % (no.) of isolates resistant toa:
CAZ CTX CRO CFP FEP IMP
E. coli (730) 32 (233) 30 (219) 30 (219) 15 (109) 3 (22) 3 (22)
P. mirabilis (141) 30 (42) 25 (35) 28 (40) 11 (16) 9 (13) 4 (7)
K. pneumoniae     (438) 17 (74) 32 (140) 35 (153) 19 (83) 10 (44) 10 (44)
    Total (1,309) 26 (349) 30 (394) 31.5 (412) 15.9 (208) 6.0 (79) 5.6 (73)
a

Abbreviations: CAZ, ceftazidime; CFP, cefoperazone, CRO, ceftriaxone; CTX, cefotaxime; FEP, cefepime, IMP, imipenem.

β-Lactam susceptibilities of strains producing extended-spectrum β-lactamases.

Fifty-five randomly selected isolates resistant to cephalosporins, including 32 E. coli, 13 K. pneumoniae, and 10 P. mirabilis isolates, were studied further. Synergy between a disk impregnated with ceftazidime or cefotaxime and a disk containing clavulanate was observed for all strains, suggesting the production of an extended-spectrum β-lactamase by every isolate (10). The MICs of β-lactams for the strains of K. pneumoniae are listed in Table 3. All isolates were resistant to amoxicillin, cephalothin, and cefuroxime but displayed various degrees of resistance to ceftazidime and cefotaxime. Resistance (MIC ≥ 16 μg/ml) to ceftazidime was observed in 5 out of 13 strains (38.4%), and resistance to cefotaxime was observed in 8 of 13 strains (61.5%). Production of an extended-spectrum β-lactamase was confirmed in all strains based on an 8- to 16-fold reduction in the MIC of the cephalosporins when combined with clavulanic acid (2 μg/ml).

TABLE 3.

bla genotypes and β-lactam resistance phenotypes of K. pneumoniae isolates

K. pneu- moniae isolate Gene content
MIC (μg/ml)a
blaTEM blaSHV blaVEB blaCTX PIP CF CXM FOX CTX CAZ ATM CAZ + CA FOX + CA CF + CA PIP + CA CTX + CA AMX
BM4498 − − − + 128 >256 >256 8 64 4 16 0.25 2 16 4 <0.125 >256
BM4499 − + − − 128 256 16 8 8 8 4 0.5 8 4 8 <0.125 256
BM4500 − + − + 128 >256 >256 4 32 2 4 0.25 8 16 4 <0.125 >256
BM4501 + + − + 64 >256 >256 4 16 1 8 <0.125 4 16 1 <0.125 >256
BM4502 + − + + 64 256 128 2 8 128 32 0.25 2 4 2 <0.125 >256
BM4503 − + − − 128 >256 32 4 8 16 8 1 4 4 >4 <0.125 >256
BM4504 − + − + 128 >256 >256 4 32 2 8 0.5 4 8 4 <0.125 >256
BM4505 − − + − 32 64 64 4 8 256 256 0.5 4 4 4 <0.25 >256
BM4506 + − − + 128 >256 >256 16 64 16 32 0.25 32 32 1 <0.125 >256
BM4507 + − − + 256 >256 >256 8 32 4 8 0.5 4 32 4 <0.125 >256
BM4508 − − − − 128 >256 32 4 16 16 8 1 4 4 4 <0.125 >256
BM4509 + + − − 64 256 8 4 4 4 1 <0.125 4 4 0.25 <0.125 >256
BM4510 − + − + 256 >256 >256 4 64 8 8 0.25 2 >16 4 0.25 >256
a

Abbreviations: AMX, amoxicillin; ATM, aztreonam; CA, clavulanic acid at a fixed concentration of 2 μg/ml; CAZ, ceftazidime; CF, cephalothin; CTX, cefotaxime; CXM, cefuroxime; FEP, cefepime; FOX, cefoxitin; IMP, imipenem; PIP, piperacillin.

K. pneumoniae is intrinsically resistant to amino-, carboxy-, and acylureido-penicillins due to the chromosomal blaLEN-1-like gene, whereas despite low expression of chromosomal ampC, E. coli remains susceptible. By contrast, P. mirabilis is naturally susceptible to these antibiotics. Taking into account the natural characteristics of these species, the resistance genotypes of the 55 strains were analyzed.

Characterization of genes for extended-spectrum β-lactamases and of their environment.

PCR experiments with primers specific for blaTEM, blaSHV, blaVEB-1, blaOXA-10, blaCTX-M, blaGES-1, and blaPER-1 genes were performed on total DNA as a template (Table 4). Five out of the seven genes were found alone or in various combinations. blaTEM-like and blaSHV-like genes were found in 42 of 55 and in 21 of 55 of the strains, respectively. blaVEB-1-like and blaCTX-M-like genes were detected in 14 out of the 55 isolates.

TABLE 4.

bla gene content of enterobacteria as detected by PCR

Strain (no. of isolates) No. (%) of strains containing:
blaCTX-M-like blaVEB-1-like blaTEM-like blaSHV-like
E. coli (32) 6 6 27 14
P. mirabilis (10) 0 6 10 0
K. pneumoniae (13) 8 2 5 7
    Total (55) 14 (25.5) 14 (25.5) 42 (76.3) 21 (38.1)

One K. pneumoniae and two E. coli isolates were resistant to broad-spectrum cephalosporins but did not give any rise to PCR product, suggesting the presence of new β-lactamases in these isolates, and are being studied further.

Sequence determination of all the PCR products obtained from the K. pneumoniae isolates confirmed the identity of the genes. The MICs of β-lactams and the enzyme contents of the strains are summarized in Table 3.

blaVEB-1.

The recently identified blaVEB-1 gene (27), which mediates resistance to ceftazidime and aztreonam, was found in the three species studied, in particular in 6 out of 10 P. mirabilis isolates (20). The sequence of two PCR products obtained from K. pneumoniae was identical to that published for blaVEB-1 (27), confirming the structural conservation of this gene observed in Thailand (6, 8). The blaOXA-10 gene has been found associated with blaVEB-1 in the same integron (19), and the K. pneumoniae isolate containing blaVEB-1 also harbored blaOXA-10 or a variant thereof.

blaCTX-M-like.

In contrast to blaVEB-1, blaCTX-M-like was detected predominantly in K. pneumoniae, in 8 out of 13 isolates (61.5%). Sequencing of the eight amplification products revealed the presence of blaCTX-M-17 in two isolates and the presence of blaCTX-M-14 in the remaining strains. The genes differ by two mutations, leading to the single Glu289→Lys substitution. blaCTX-M-like was found in only 6 of 32 (18.7%) E. coli isolates and not in P. mirabilis. It has been shown that ISEcp1 can provide the promoter and direct the transcription of the blaCTX-M-17 gene in K. pneumoniae BM4493 (5). Sequence analysis of the region upstream from the blaCTX-M-like genes of K. pneumoniae indicated the presence of ISEcp1 in six out of eight strains.

blaTEM and blaSHV.

blaTEM genes were found in all P. mirabilis isolates, in 27 of 32 (84.3%) E. coli isolates, and in 5 of 13 (38.4%) K. pneumoniae isolates. Sequencing showed the presence of blaTEM-1 in all K. pneumoniae isolates. blaSHV-like genes were also found at high frequencies: in 7 of 13 (54%) K. pneumoniae isolates and in 14 of 32 (44%) E. coli isolates but not in P. mirabilis. DNA sequencing indicated the presence of blaSHV-2 with mutation Gly238→Ser relative to blaSHV-1 (7, 13, 17). The incidence of blaSHV-2 producers appears to be higher in European countries than in the United States, and they are very common in African countries (2, 26).

The blaGES-1 and blaPER-1 genes were not detected.

Molecular characterization of K. pneumoniae.

The relationship between the 13 K. pneumoniae isolates was studied by rep-PCR using independently BOX-A1 and ERIC2 (enterobacterial repetitive intergenic consensus) primers. Amplification with ERIC2 primer provided poorly reproducible results, and only BOX-A1 gave discriminant DNA profiles of the strains (data not shown). Among the isolates resistant to ceftazidime or to cefotaxime, the various profiles obtained indicated polyclonal dissemination of resistance to broad-spectrum cephalosporins

The prevalence of resistance to antibiotics varies greatly from one geographic area to another as well as between hospitals within a community, mainly because of the differences in antimicrobial usage and infection control practices (18). In Taiwan, the prevalence of K. pneumoniae producing extended-spectrum β-lactamase is quite high (30%), involving mostly TEM-type and SHV-12 enzymes (14, 36). By contrast, in Japan, organisms producing such β-lactamases are rarely encountered, and the enzymes are mostly Toho-2 (37). In China, extended-spectrum β-lactamases have been reported, but their prevalence is unknown (31). The distribution of TEM-1, VEB-1, and SHV-like (SHV-2a, SHV-5, and SHV-12) enzymes in Thailand has been reported very recently (6).

Two highly prevalent resistance phenotypes, to cefotaxime or to ceftazidime, associated with the respective production of CTX-M-14/17 and VEB-1, were detected in K. pneumoniae (Table 3). These isolates also produced SHV-2 and TEM-1 penicillinases. The association of enzymes, up to four β-lactamases in a single strain, including the combination of VEB-1 and CTX-M-14 in one K. pneumoniae isolate, resulted in high-level resistance to both ceftazidime and cefotaxime and also to aztreonam. Enzymes VEB-1 and CTX-M-14/CTX-M-17 are newly detected extended-spectrum β-lactamases, and their origins remain unknown. The observation that strains harboring identical genes are not related clonally suggests dissemination of resistance determinants by mobile elements. The integron environment of blaVEB-1 (8, 27) and the presence of ISEcp1 and IS903 flanking blaCTX-M-14/17 (5) are consistent with this notion.

This study revealed a high prevalence of resistance to broad-spectrum cephalosporins among Enterobacteriaceae in Vietnam. It also indicated the particular widespread presence of VEB-1 and CTX-M-like extended-spectrum β-lactamases associated with TEM-1 and SHV-2 penicillinases in this country.

Acknowledgments

This work was supported in part by a Bristol-Myers Squibb Unrestricted Biomedical Research Grant in Infectious Diseases. V.C. was a recipient of a fellowship from the Réseau International des Instituts Pasteur et Instituts Associés.

We thank colleagues from the Bacteriological Laboratories of the Nguyen Tri Phuong, Nguyen Trai, 115, Hung Vuong, Tu Du, Saigon, and Binh Dan hospitals and the Medic Center in Ho Chi Minh City for collaboration.

REFERENCES

  • 1.Ambler, R. P. 1980. The structure of β-lactamases. Philos. Trans. R. Soc. Lond. Ser. Biol. Sci. 289:321-331. [DOI] [PubMed] [Google Scholar]
  • 2.Ben Hassen, A., M. Bejaoui, M. R. Lakhoua, and S. Ben Redjeb. 1993. Epidemiological pattern of the resistance of 153 Salmonella strains (S. typhi excluded) isolated in a Tunisian pediatric unit from 1985 to 1990. Pathol. Biol. 41:706-712. [PubMed] [Google Scholar]
  • 3.Ben Redjeb, S., H. Ben Yaghlane, A. Boujnah, A. Philippon, and R. Labia. 1988. Synergy between clavulanic acid and newer β-lactams on nine clinical isolates of Klebsiella pneumoniae, Escherichia coli and Salmonella typhimurium resistant to third generation cephalosporins. J. Antimicrob. Chemother. 21:263-266. [DOI] [PubMed] [Google Scholar]
  • 4.Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211-1233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cao, V. T. B., T. Lambert, and P. Courvalin. 2002. Characterization of ColE1-like plasmid pIP843 from Klebsiella pneumoniae encoding extended-spectrum β-lactamase CTX-M-17. Antimicrob. Agents Chemother. 46:1212-1217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chanawong, A., F. H. M'Zali, J. Heritage, A. Lutitanond, and P. M. Hawkey. 2001. SHV-12, SHV-5, SHV-2a and VEB-1 extended-spectrum β-lactamases Gram-negative bacteria isolated in a university hospital in Thailand. J. Antimicrob. Chemother. 48:839-852. [DOI] [PubMed] [Google Scholar]
  • 7.Garbarg-Chenon, A., V. Godard, R. Labia, and J.-C. Nicolas. 1990. Nucleotide sequence of SHV-2 β-lactamase gene. Antimicrob. Agents Chemother. 34:1444-1446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Girlich, D., L. Poirel, A. Leelaporn, A. Karim, C. Tribuddharat, M. Fennewald, and P. Nordmann. 2001. Molecular epidemiology of the integron-located VEB-1 extended-spectrum β-lactamase in nosocomial enterobacterial isolates in Bangkok, Thailand. J. Clin. Microbiol. 39:175-182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hanberger, H., D. Diekema, A. Fluit, R. Jones, M. Struelens, R. Spencer, and M. Wolff. 2001. Surveillance of antibiotic resistance in European ICUs. J. Hosp. Infect. 48:161-176. [DOI] [PubMed] [Google Scholar]
  • 10.Jarlier, V., M. H. Nicolas, G. Fournier, and A. Philippon. 1988. Extended broad-spectrum β-lactamases conferring transferable resistance to newer β-lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Rev. Infect. Dis. 10:867-878. [DOI] [PubMed] [Google Scholar]
  • 11.Johnson, J. R., and T. T. O'Bryan. 2000. Improved repetitive-element PCR fingerprinting for resolving pathogenic and nonpathogenic phylogenetic groups within Escherichia coli. Clin. Diagn. Lab. Immunol. 7:265-273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jones, R. N. 1999. Summation: β-lactam resistance surveillance in the Asia-Western Pacific region. Diagn. Microbiol. Infect. Dis. 35:333-338. [DOI] [PubMed] [Google Scholar]
  • 13.Lee, K. Y., J. D. Hopkins, T. F. O'Brien, and M. Syvanen. 1991. Gly-238-Ser substitution changes the substrate specificity of the SHV class A β-lactamases. Proteins 11:45-51. [DOI] [PubMed] [Google Scholar]
  • 14.Liu, P. Y., J. C. Tung, S. C. Ke, and S. L. Chen. 1998. Molecular epidemiology of extended broad-spectrum β-lactamase-producing Klebsiella pneumoniae isolates in a district hospital in Taiwan. J. Clin. Microbiol. 36:2759-2762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mabilat, C., and P. Courvalin. 1990. Development of “oligotyping” for characterization and molecular epidemiology of TEM β-lactamases in members of the family Enterobacteriaceae. Antimicrob. Agents Chemother. 34:2210-2216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Medeiros, A. A. 1997. Evolution and dissemination of β-lactamases accelerated by generations of β-lactam antibiotics. Clin. Infect. Dis. 24(Suppl.):19-45. [DOI] [PubMed] [Google Scholar]
  • 17.Mercier, J., and R. C. Levesque. 1990. Cloning of SHV-2, OHIO-1, and OXA-6 β-lactamases and cloning and sequencing of SHV-1 β-lactamase. Antimicrob. Agents Chemother. 34:1577-1583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Moosdeen, F. 1997. The evolution of resistance to cephalosporins. Clin. Infect. Dis. 24:487-493. [DOI] [PubMed] [Google Scholar]
  • 19.Naas, T., L. Poirel, A. Karim, and P. Nordmann. 1999. Molecular characterization of In50, a class 1 integron encoding the gene for the extended-spectrum β-lactamase VEB-1 in Pseudomonas aeruginosa. FEMS Microbiol. Lett. 176:411-419. [DOI] [PubMed] [Google Scholar]
  • 20.Naas, T., F. Benaoudia, S. Massuard, and P. Nordmann. 2000. Integron-located VEB-1 extended-spectrum β-lactamase gene in a Proteus mirabilis clinical isolate from Vietnam. J. Antimicrob. Chemother. 46:703-711. [DOI] [PubMed] [Google Scholar]
  • 21.National Committee for Clinical Laboratory Standards. 2002. Performance standards for antimicrobial susceptibility testing. Twelfth informational supplement. Approved standard M7-A2. NCCLS, Wayne, Pa.
  • 22.Nordmann, P., and T. Naas. 1994. Sequence analysis of PER-1 extended-spectrum β-lactamase from Pseudomonas aeruginosa and comparison with class A β-lactamase. Antimicrob. Agents Chemother. 38:104-114. [DOI] [PMC free article] [PubMed]
  • 23.Nüesch-Inderbinen, M. T., H. Hächler, and F. H. Kayser. 1996. Detection of genes coding for extended-spectrum SHV β-lactamase in clinical isolates by a molecular genetic method, and comparison with the E-test. Eur. J. Clin. Microbiol. Infect. Dis. 15:398-402. [DOI] [PubMed] [Google Scholar]
  • 24.Pai, H., E.-H. Choi, H.-J. Lee, J. Y. Hong, and G. A. Jacoby. 2001. Identification of CTX-M-14 extended-spectrum β-lactamase in clinical isolates of Shigella sonnei, Escherichia coli, and Klebsiella pneumoniae in Korea. J. Clin. Microbiol. 39:3747-3749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pfaller, M. A., R. N. Jones, G. V. Doern, K. Kugler, and The SENTRY Participants Group. 1998. Bacterial pathogens isolated from patients with bloodstream infection: frequencies of occurrence and antimicrobial susceptibility patterns from the SENTRY antimicrobial surveillance program (United States and Canada, 1997). Antimicrob. Agents Chemother. 42:1762-1770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Pitout, J. D. D., K. S. Thomson, N. D. Hanson, A. F. Ehrhardt, E. S. Moland, and C. C. Sanders. 1998. β-Lactamases responsible for resistance to extended-spectrum cephalosporins among Klebsiella pneumoniae, Escherichia coli, and Proteus mirabilis isolates recovered in South Africa. Antimicrob. Agents Chemother. 42:1350-1354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Poirel, L., T. Naas, M. Guibert, E. B. Chaibi, R. Labia, and P. Nordmann. 1999. Molecular and biochemical characterization of VEB-1, a novel class A extended-spectrum β-lactamase encoded by an Escherichia coli integron gene. Antimicrob. Agents Chemother. 43:573-581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Poirel, L., I. Le Thomas, T. Naas, A. Karim, and P. Nordmann. 2000. Biochemical-sequence analysis of GES-1, a novel class A extended-spectrum β-lactamase, and the class 1 integron In52 from Klebsiella pneumoniae. Antimicrob. Agents Chemother. 44:622-632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Quintiliani, R., Jr., D. Sahm, and P. Courvalin. 1998. Mechanisms of resistance to antimicrobial agents, p. 1505-1525. In P. R. Murray, E. J. Baron, M. A. Pfaller, F. C. Tenover, and R. H. Yolken (ed.), Manual of clinical microbiology, 7th ed. American Society for Microbiology, Washington, D.C.
  • 30.Sambrook, J., and D. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 31.Shen, D., D. J. Biedenbach, P. L. Winokur, M. A. Pfaller, and R. N. Jones. 1999. Phenotypic and genotypic characterization of Chinese strains of Escherichia coli producing extended-spectrum β-lactamase. Diagn. Microbiol. Infect. Dis. 34:159-164. [DOI] [PubMed] [Google Scholar]
  • 32.Sutcliff, J. G. 1978. Nucleotide sequence of the ampicillin resistance gene of Escherichia coli plasmid pBR322. Proc. Natl. Acad. Sci. USA 75:762-765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Tribuddaharat, C., and M. A. Fennewald. 1999. Integron-mediated rifampin resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 43:960-962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tzouvelekis, L. S., E. Tzelepi, P. T. Tassios, and N. J. Legakis. 2000. CTX-M-type β-lactamases: an emerging group of extended-spectrum enzymes. Int. J. Antimicrob. Agents 14:137-142. [DOI] [PubMed] [Google Scholar]
  • 35.Versalovic, J., T. Koeuth, and J. Lupski. 1991. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 19:6823-6831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yan, J. J., S. M. Wu, S. H. Tsai, J. J. Wu, and I. J. Su. 2000. Prevalence of SHV-12 among clinical isolates of Klebsiella pneumoniae producing extended-spectrum β-lactamases and identification of a novel AmpC enzyme (CMY-8) in Southern Taiwan. Antimicrob. Agents Chemother. 44:1438-1442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yagi, T., H. Kurokawa, N. Shibata, K. Shibayama, and Y. Arakawa. 2000. A preliminary survey of extended-spectrum β-lactamases (ESBLs) in clinical isolates of Klebsiella pneumoniae and Escherichia coli in Japan. FEMS Microbiol. Lett. 184:53-56. [DOI] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES