Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2026 Apr 24;16:19037. doi: 10.1038/s41598-026-48507-1

Molecular analysis of squalene epoxidase gene mutations in Trichophyton rubrum from clinical onychomycosis samples in South Korea

Mingyu Kim 1,#, Mi-Ran Seo 2,#, Dong Soo Yu 1, Young Bok Lee 1,3,✉, Yeun-Jun Chung 3,4,5,6,✉
PMCID: PMC13279821  PMID: 42031933

Abstract

Trichophyton rubrum is the primary causative pathogen of onychomycosis, and terbinafine remains the first-line treatment for both oral and topical therapy. However, increasing reports of terbinafine resistance-associated mutations in T. rubrum from India, Europe, and other parts of Asia have raised global concern. This study aimed to investigate mutations in the squalene epoxidase (SQLE) gene in T. rubrum from onychomycosis samples in South Korea. Between August 2021 and November 2023, toenail specimens from patients with KOH-positive fungal microscopy were collected from six hospitals. Fungal species were identified through internal transcribed spacer (ITS) sequencing, and mutations in the squalene epoxidase (SQLE) gene were analyzed. Among 388 clinical samples, 231 (59.5%) were ITS PCR-positive. Sanger sequencing identified T. rubrum in 185 samples (80.5%), followed by Candida parapsilosis (7), T. mentagrophytes (4), T. violaceum (2), and various other fungi (24). Among 106 SQLE-positive T. rubrum clinical samples, 3.8% (4/106) harbored resistance-associated mutations, including Phe397Leu (n = 3) and Leu393Phe (n = 1), while the remaining 102 samples showed wild-type SQLE sequences at these positions. These findings demonstrate the presence of SQLE mutations in T. rubrum from onychomycosis samples in South Korea. Further studies incorporating fungal isolation and antifungal susceptibility testing are needed to determine their clinical significance.

Keywords: Onychomycosis, Trichophyton rubrum, SQLE gene analysis, Terbinafine

Subject terms: Diseases, Medical research, Microbiology, Molecular biology

Introduction

Onychomycosis is a chronic fungal infection of the nails, characterized by discoloration, thickening, and separation of the nail from the nail bed1. It accounts for up to 50% of all nail disorders worldwide and poses a significant burden on public health due to its high prevalence and challenging treatment outcomes2. The disease is predominantly caused by dermatophytes, with Trichophyton rubrum being the most common etiological agent, followed by T. mentagrophytes and other fungal species3. Onychomycosis not only affects the aesthetic appearance of nails but can also cause pain, secondary bacterial infections, and reduced quality of life, particularly in immunocompromised individuals and older adults.

Terbinafine, an allylamine antifungal, remains a first-line treatment option for dermatophyte infections. It exerts its antifungal effect by inhibiting squalene epoxidase, a key enzyme in the ergosterol biosynthesis pathway, essential for fungal cell membrane integrity4. In recent years, increasing reports of terbinafine treatment failure have raised concerns regarding the emergence of resistance-associated mechanisms5. Mutations in the squalene epoxidase (SQLE) gene, particularly amino acid substitutions such as Phe397Leu(F397L) and Leu393Phe(L393F), have been reported in association with reduced susceptibility to terbinafine in Trichophyton species by reducing the drug’s binding affinity to its target6.

Globally, SQLE mutations in T. rubrum have been widely reported in India, Europe, and parts of Asia, often with alarming rates4,7–9. However, data regarding the presence of these mutations in clinical samples from South Korea remain limited. To date, data on SQLE mutations directly detected from clinical toenail samples in South Korea are scarce, and no multicenter molecular study focusing on terbinafine resistance-associated variants has been reported. Unlike most previous investigations that relied on cultured isolates, our study performed SQLE sequencing directly from toenail specimens collected across six hospitals, thereby reflecting real-world clinical samples more closely.

In this study, we performed molecular analysis of the SQLE gene in T. rubrum obtained from onychomycosis samples in South Korea. By identifying known mutation hotspots, we aimed to investigate the presence of resistance-associated genetic alterations in clinical samples and to provide baseline data for future epidemiological and clinical studies.

Methods

Patients

A total of 388 toenail samples were obtained from the Catholic Biobank Network. Samples were obtained from patients diagnosed with onychomycosis in the dermatology departments of secondary or tertiary hospitals (Uijeongbu St. Mary’s Hospital, Seoul St. Mary’s Hospital, Yeouido St. Mary’s Hospital, Incheon St. Mary’s Hospital, St. Vincent’s Hospital, and Eunpyeong St. Mary’s Hospital). Diagnosis was confirmed by a potassium hydroxide (KOH) test, and patients had not received any antifungal treatment prior to sampling. All procedures were performed in accordance with the relevant guidelines and regulations of the Catholic Medical Center Institutional Review Board(IRB no. UC23DDSS0100), and informed consent was obtained from all subjects or their legal guardians prior to sample collection.

DNA isolation and species identification

Fungal DNA was extracted directly from clinical nail samples using iDetect Rapid DNA Extraction kit (ConnectaGen Inc., Korea). Approximately 0.1 mg of toenail material was processed per sample according to the manufacturer’s instructions. Species identification analysis was performed based on previously published methods described by Ala-Houhala et al.10, with minor modifications. All clinical isolates were identified to the species level by conventional PCR using primer pairs its_05-F and its_05-R (Table 1). The PCR condition was as follows: 95 ℃ for 3 min, followed by 35 cycles at 95 ℃ for 1 min, 50 ℃ for 1 min, and 72 ℃ for 1 min, and then an extension cycle of 72 ℃ for 10 min. Positive controls (DNA from a reference KCTC6375 Trichophyton rubrum) and negative control (Nuclease-free water) were included in each PCR run to monitor assay performance and potential contamination. The amplified products were visualized on 2% agarose gel and were sequenced via Sanger sequencing, and the sequencing results were evaluated using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to determine the closest relatives on the NCBI website (http://www.ncbi.nlm.nih.gov).

Table 1.

PCR primers used in this study.

Purpose Primer name Sequences (5’ → 3’) References
Identification of species its_05-F GATTGAATGGCTTAGTGAGG 10
its_05-R TTGTTCGCTATCGGTCTC
SQLE amplification SQLE_F2 ATGGTTGTAGAGGCTCCTCCC 4
SQLE_R2 CTAGCTTTGAAGTTCGGCAAA

Samples identified as T. rubrum by ITS region-Sanger sequencing were considered positive. The concordance rate for mycological species identification test results (T. rubrum-positive/negative) was compared between iDetect T. rubrum Real-time LAMP kit (ConnectaGen Inc., Korea) and Sanger sequencing analysis results. The concordance rate for identification of T. rubrum between the two methods was also determined.

PCR amplification and sequencing of SQLE

The SQLE gene was amplified to identify mutations associated with terbinafine resistance. PCR amplification and sequencing of the SQLE gene were performed based on previously published methods4, with minor modifications. Primer pairs SQLE_F2 (5’-ATGGTTGTAGAGGCTCCTCCC-3’) and SQLE_R2 (5’-CTAGCTTTGAAGTTCGGCAAA-3’) were used.

PCR amplification was carried out for 35 cycles under the following conditions: denaturation at 94 ℃ for 1 min, annealing at 54 ℃ for 1 min, and extension at 72 ℃ for 1 min. Positive controls (DNA from a reference KCTC6375 Trichophyton rubrum) and negative control (Nuclease-free water) were included in each PCR run to monitor assay performance and potential contamination.

The amplified DNA fragments were electrophoresed on a 2% agarose gel with 1X TAE buffer. PCR products were sequenced by Sanger sequencing, and sequence data were analyzed using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to determine the closest relatives on the NCBI database (http://www.ncbi.nlm.nih.gov). Sequences were aligned and screened for missense mutations using BioEdit version 7.7.1. The nucleotide and predicted amino acid sequences of the SQLE gene in all T. rubrum samples were compared with reference sequences available in the GenBank database (Table 2).

Table 2.

Reference sequence for Trichophyton.

Target gene Species GenBank accession
number
Amino acid
substitution
Reference
SQLE Trichophyton rubrum OM313296 Wild type 11
Trichophyton rubrum OM313307 Phe397Leu
Trichophyton rubrum OM313304 Leu393Phe
Trichophyton rubrum OM313303 Leu393Ser
Trichophyton rubrum OM313302

Tyr414Cys,

Leu438Cys

Trichophyton rubrum OM313301 Phe415Ser
Trichophyton rubrum OM313300 Phe415Val
Trichophyton rubrum OM313299 Leu437Phe
Trichophyton rubrum OM313298 His440Tyr
Trichophyton rubrum OM313297 Ile479Val
Trichophyton indotineae MW187980 Phe397Leu 31
Trichophyton indotineae MW188000 Phe397Leu
Trichophyton indotineae MW187987

Phe397Leu,

Ala448Thr

Trichophyton indotineae MW187998

Phe397Leu,

Ala448Thr

Trichophyton indotineae MW188003

Phe397Leu,

Ala448Thr

Trichophyton indotineae MW188016 Phe415Val
Trichophyton indotineae MW188020 Leu393Ser
Trichophyton indotineae MW187976 His440Tyr
Trichophyton indotineae MW187981 Ala448Thr
Trichophyton mentagrophytes MW188025

Lys276Asn,

Leu419Phe

Results

Fungal identification

Identification was confirmed by conventional PCR of the ITS region from toenail clinical samples, 231 (59.5%) were ITS-positive and 157 (40.5%) were not amplified (Fig. 1). Results of Sanger sequencing, the most commonly isolated dermatophyte species were Trichophyton rubrum from 185 (80.1%) clinical samples followed by Candida parapsilosis (7/231, 3.0%), Saccharomyces cerevisiae (5/231, 2.2%), T. mentagrophytes (4/231, 1.7%), Arthroderma vanbreuseghemii (4/231, 1.7%) and Trichosporon spp. (4/231, 1.7%) (Table 3). The results of T. rubrum-positive/negative determination by iDetect T. rubrum Real-time LAMP kit (ConnectaGen Inc., Korea) and ITS region-Sanger sequencing of samples collected from target toenails are shown in Table 4. The T. rubrum-positive and T. rubrum-negative concordance rates between iDetect T. rubrum Real-time LAMP kit (ConnectaGen Inc., Korea) and ITS region-Sanger sequencing results were 100% (185/185 specimens, CI: 98.03 to 100%) and 100% (46/46 specimens, CI: 92.29 to 100%), respectively.

Fig. 1.

Fig. 1

Structure of internal transcribed spacer (ITS) region and verification of the fungi isolated from the onychomycosis patient samples by PCR-sequencing. (A) Verification strategy of the fungi isolated from the onychomycosis patient samples via PCR-sequencing, as described elsewhere. (B) ITS PCR-sequencing revealed Trichophyton rubrum (GenBank No. JX431933, site 4245 ~ 4846 bp) specific sequence in 20 clinical samples.

Table 3.

Species distributions of 388 dermatophyte isolates received between August 2021 and November 2023.

Species No. (%)
Arthroderma otae 1 (0.4)
Arthroderma vanbreuseghemii 4 (1.7)
Aspergillus penicillioides 1 (0.4)
Candida parapsilosis 7 (3.0)
Cutaneotrichosporon mucoides 1 (0.4)
Graphium penicillioides 1 (0.4)
Malassezia spp. 3 (1.3)
Meyerozyma guilliermondii 1 (0.4)
Microsporum canis 1 (0.4)
Perenniporia subacida 1 (0.4)
Saccharomyces cerevisiae 5 (2.2)
Sistotrema brinkmannii 1 (0.4)
Trichophyton mentagrophytes 4 (1.7)
Trichophyton rubrum 185 (80.1)
Trichophyton violaceum 2 (0.9)
Trichosporon spp. 4 (1.7)
Other species 9 (3.9)
Total 231

Table 4.

Comparison of iDetect T. rubrum real-time LAMP kit with ITS region-Sanger sequencing for mycological species identification test results.

Method ITS region-Sanger sequencing
T. rubrum (+) T. rubrum (-) Total

iDetect T. rubrum

real-time LAMP kit

T. rubrum (+)* 185 (47.7) 0 (0.0) 185 (47.7)
T. rubrum (-) 0 (0.0) 203 (52.3) 203 (52.3)
Total 185 (47.7) 203 (52.3) 388 (100)

Unit: Number of specimens (%). * Specimens in which Trichophyton rubrum was identified.

SQLE gene sequencing and mutation analysis

Among the 185 T. rubrum-positive samples, 106 (57.3%) yielded successful amplification of the SQLE gene. Nucleotide and amino acid sequences were compared to SQLE reference (Table 2). Analysis of the SQLE gene revealed several point mutations in the coding region responsible for the change in amino acid sequence. Two samples harbored a single nucleotide polymorphism (SNP) at position 1189 (T → C), which encoded Leu at codon 397 instead of Phe (F397L) and one sample harbored a SNP at position 1191 (C →A), which encoded Leu at codon 397 instead of Phe (F397L). One sample harbored a SNP at position 1177 (A → C), which encoded Phe at codon 393 instead of Leu (L393F). The remaining 102 samples showed wild-type sequences at these positions (Fig. 2). SQLE PCR amplification failed in 79 T. rubrum-positive samples, likely reflecting the suboptimal quantity and quality of fungal DNA extracted from keratin-rich toenail matrices.

Fig. 2.

Fig. 2

Comparison of the squalene epoxidase (SQLE) gene of the nucleotide sequences of the isolates of Trichophyton rubrum references and 4 clinical isolates. OM313296.1, Trichophyton rubrum (T. rubrum) SQLE wild type; OM313304, T. rubrum L393F; OM313303 T. rubrum L393S; OM313307 T. rubrum F397L; OM313302, T. rubrum Y414C, L438C; OM313301, T. rubrum F415S; OM313300, T. rubrum F415V; OM313299, T. rubrum L437P; OM313298, T. rubrum H440Y; OM313297, T. rubrum I479V.

Data availability

The dataset of SQLE sequences are deposited in the GenBank database with the accession number PX994303- PX994316.

Discussion

In this study, we performed molecular analysis of the SQLE gene in Trichophyton rubrum directly from clinical onychomycosis samples collected across multiple centers in South Korea. Our findings confirm that T. rubrum remains the predominant dermatophyte species in all six hospitals, accounting for 80.1% (185/231) of ITS-positive samples.

This distribution is consistent with global epidemiological trends. In a study from Denmark, the most frequent dermatophytes were T. rubrum (48/59, 81.4%) and T. mentagrophytes/T. interdigitale complex (11/59, 18.6%)11. Similarly, a French multicenter prospective study reported T. rubrum (436/580, 75.2%) and T. mentagrophytes/T. interdigitale (144/580, 24.8%) as the predominant species12. Studies from Japan have also demonstrated a high prevalence of T. rubrum (22/23, 95.6%)13. However, regional variation has been observed. In India, T. interdigitale (66.1%) was more frequently isolated than T. rubrum (26.3%)6, while in Iran, T. mentagrophytes (77/198, 38.4%) was predominant, followed by T. interdigitale (57/198, 28.8%), T. rubrum (34/198, 17.2%), and T. tonsurans (12/198, 6.1%)8.

Overall, these findings support that T. rubrum and T. mentagrophytes/T. interdigitale are the principal causative pathogens of onychomycosis worldwide, collectively accounting for 80–90% of onychomycosis cases7,14–20. Although geographic variation exists, Trichophyton spp. remain the dominant etiologic agents. Molecular identification methods, such as sequencing, provide improved accuracy compared to morphology-based approaches, which may be limited by overlapping phenotypic characteristics.

The concordance rate between ITS sequencing and the iDetect real-time LAMP assay was 100% for both positive and negative samples, demonstrating a high level of agreement between the two methods. This finding suggests that the LAMP-based assay may serve as a rapid and reliable tool for species identification in clinical settings.

Accurate species identification is clinically important, as treatment outcomes in onychomycosis can be influenced by the causative organism and its antifungal susceptibility profile. Onychomycosis is associated with high recurrence and reinfection rates (10–53%), often occurring within 30 months after systemic antifungal treatment. This is likely related to failure to completely eradicate the fungal pathogen or reinfection with a new causative strain after subsequent exposure21–23. While terbinafine remains a first-line therapy, increasing reports of reduced susceptibility in dermatophytes have been linked to mutations in the SQLE gene4,6,11,20,24. In India, terbinafine resistance has been reported in the dermatophytes T. mentagrophytes/T. interdigitale complex, T. rubrum, and T. indotineae20,24. Terbinafine resistance has been linked to hotspot mutations in the squalene epoxidase (SQLE) target gene of Trichophyton spp.4. These mutations lead to substitutions at one of the four amino acid positions Leu393, Phe397, Phe415, and His440, which are thought to alter drug binding affinity4,11,25–27. The introduced missense substitutions L393F and F397L have been reported to result in a more than 100-fold higher MIC26,28. These mutations at codons 393 and 397 are among the most commonly reported alterations in Trichophyton spp.

In our study, nucleotide substitutions (T1189C and C1191A) resulted in the F397L substitution in three T. rubrum samples, and one sample exhibited the L393F substitution. These mutations have been previously reported in association with reduced susceptibility to terbinafine. However, as antifungal susceptibility testing was not performed, the phenotypic impact of these mutations in our samples cannot be directly determined. Therefore, these findings should be interpreted as evidence of resistance-associated genetic alterations rather than confirmed antifungal resistance.

From a clinical perspective, the detection of such mutations may have implications for patients with treatment-refractory onychomycosis. However, further studies integrating culture-based susceptibility testing and clinical outcome data are required to clarify their clinical significance.

The relatively low PCR amplification rate observed in this study is likely due to the difficulty of extracting high-quality pure genomic fungal DNA from keratin-rich nail samples. Keratin is an insoluble protein that often interferes with efficient DNA extraction. In other studies, DNA was extracted from fresh fungal colonies obtained from clinical samples cultured on Sabouraud glucose agar (SDA) containing chloramphenicol and cycloheximide for more than 4–6 weeks, and experiments were conducted using at least 25 ng or 100–200 ng of pure DNA29,30. An important methodological feature of our study is the direct extraction of fungal DNA from clinical toenail specimens rather than from cultured isolates. This approach shortens the turnaround time by bypassing the weeks required for fungal culture and allows analysis of samples in which culture may fail because of nonviable organisms or overgrowth of contaminants. However, direct DNA extraction from keratin-rich material is technically challenging, resulting in lower DNA yield and quality and contributing to PCR failure in a subset of cases. These technical limitations highlight the need for improved molecular protocols for clinical samples. From a clinical perspective, detection of SQLE mutations such as L393F and F397L may be particularly relevant in patients with recurrent or refractory onychomycosis after adequate courses of terbinafine therapy. In such cases, molecular testing for SQLE mutations, ideally combined with in vitro antifungal susceptibility testing, could help guide individualized antifungal treatment strategies. Future multicenter studies that integrate culture-based antifungal susceptibility testing, molecular detection of resistance-associated mutations, and longitudinal clinical outcome data before and after terbinafine treatment are warranted to clarify the phenotypic and clinical impact of these mutations.

This study has several limitations. First, antifungal susceptibility testing was not performed, which precludes direct correlation between SQLE mutations and phenotypic resistance. Second, detailed clinical information, including prior antifungal treatment and treatment outcomes, was not systematically available, limiting the assessment of the clinical relevance of the detected mutations. Third, incomplete amplification in some samples may have led to underestimation of mutation frequency.

In conclusion, this study demonstrates the presence of SQLE gene mutations in T. rubrum obtained from clinical onychomycosis samples in South Korea. These findings provide molecular evidence of resistance-associated genetic alterations and underscore the need for further studies combining molecular and phenotypic analyses.

Author contributions

All authors contributed to the study design, data collection, and manuscript preparation, and have approved the final version of the manuscript.

Funding

The author wish to acknowledge the financial sup- port of The Catholic University of Korea Uijeongbu St. Mary’s Hospital Clinical Research Laboratory Foundation made in the program year of 2023.

Data availability

The DNA sequence data generated during this study have been deposited in the NCBI GenBank database and are publicly available under the following BioProject submissions:- *SQLE* sequences (n = 106): Submission ID 3036822 (including 4 resistant and 10 wild-type representative sequences)The datasets can be accessed via [https://www.ncbi.nlm.nih.gov/genbank/](https:/www.ncbi.nlm.nih.gov/genbank) using the respective submission IDs. Additional data supporting the findings of this study are available from the corresponding author upon reasonable request.

Competing interests

The authors declare no competing interests.

Ethical approval

Reviewed and approved by the Institutional Review Board at Uijeongbu St. Mary’s Hospital, Catholic University of Korea (UC23DDSS0100).

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Mingyu Kim and Mi-Ran Seo contributed equally to this work.

Contributor Information

Young Bok Lee, Email: lyb80@catholic.ac.kr.

Yeun-Jun Chung, Email: yejun@catholic.ac.kr.

References

  • 1.Gupta, A. K. et al. Onychomycosis: a review. J. Eur. Acad. Dermatol. Venereol.34, 1972–1990. 10.1111/jdv.16394 (2020). [DOI] [PubMed] [Google Scholar]
  • 2.Leung, A. K. C. et al. Onychomycosis: an updated review. Recent. Pat. Inflamm. Allergy Drug Discov. 14, 32–45. 10.2174/1872213X13666191026090713 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lee, W. J. et al. Increasing prevalence of Trichophyton rubrum identified through an analysis of 115,846 cases over the last 37 years. J. Korean Med. Sci.30, 639–643. 10.3346/jkms.2015.30.5.639 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Yamada, T. et al. Terbinafine resistance of trichophyton clinical isolates caused by specific point mutations in the squalene epoxidase gene. Antimicrob. Agents Chemother.61, 859. 10.1128/AAC.00115-17 (2017). [DOI] [PMC free article] [PubMed]
  • 5.Shen, J. J., Arendrup, M. C., Verma, S. & Saunte, D. M. L. TThe emerging terbinafine-resistant trichophyton epidemic: what is the role of antifungal susceptibility testing? Dermatology238, 60–79. 10.1159/000515290 (2022). [DOI] [PubMed] [Google Scholar]
  • 6.Rudramurthy, S. M. et al. Mutation in the squalene epoxidase gene of trichophyton interdigitale and Trichophyton rubrum associated with allylamine resistance. Antimicrob. Agents Chemother.62, 586. 10.1128/AAC.02522-17 (2018). [DOI] [PMC free article] [PubMed]
  • 7.Ebert, A. et al. Alarming India-wide phenomenon of antifungal resistance in dermatophytes: a multicentre study. Mycoses63, 717–728. 10.1111/myc.13091 (2020). [DOI] [PubMed] [Google Scholar]
  • 8.Taghipour, S. et al. Emergence of terbinafine resistant trichophyton mentagrophytes in Iran, harboring mutations in the Squalene Epoxidase (SQLE) gene. Infect. Drug Resist.13, 845–850. 10.2147/IDR.S246025 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hiruma, J. et al. Terbinafine-resistant strain of Trichophyton interdigitale strain isolated from a tinea pedis patient. J. Dermatol.46, 351–353. 10.1111/1346-8138.14809 (2019). [DOI] [PubMed] [Google Scholar]
  • 10.Ala-Houhala, M. et al. Clinical use of fungal PCR from deep tissue samples in the diagnosis of invasive fungal diseases: a retrospective observational study. Clin. Microbiol. Infect.24, 301–305. 10.1016/j.cmi.2017.08.017 (2018). [DOI] [PubMed] [Google Scholar]
  • 11.Astvad, K. M. T. et al. Increasing terbinafine resistance in Danish trichophyton isolates 2019–2020. J. Fungi (Basel)2022, 8. 10.3390/jof8020150 (2022). [DOI] [PMC free article] [PubMed]
  • 12.Moreno-Sabater, A. et al. Terbinafine resistance in dermatophytes: a French multicenter prospective study. J. Fungi (Basel). 8, 256. 10.3390/jof8030220 (2022). [DOI] [PMC free article] [PubMed]
  • 13.Noguchi, H. et al. Cluster infection caused by a terbinafine-resistant dermatophyte at a group home: the first case series in Japan. Acta Derm Venereol.101, adv00563. 10.2340/00015555-3926 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Piraccini, B. M. & Alessandrini, A. Onychomycosis: a review. J. Fungi (Basel). 1, 30–43. 10.3390/jof1010030 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Baran, R. & Kaoukhov, A. Topical antifungal drugs for the treatment of onychomycosis: an overview of current strategies for monotherapy and combination therapy. J. Eur. Acad. Dermatol. Venereol.19, 21–29. 10.1111/j.1468-3083.2004.00988.x (2005). [DOI] [PubMed] [Google Scholar]
  • 16.Westerberg, D. P., Voyack, M. J. & Onychomycosis current trends in diagnosis and treatment. Am. Fam Physician. 88, 762–770 (2013). [PubMed] [Google Scholar]
  • 17.Saunte, D. M. L. et al. Emerging terbinafine resistance in trichophyton: clinical characteristics, squalene epoxidase gene mutations, and a reliable EUCAST method for detection. Antimicrob. Agents Chemother.63, 1142. 10.1128/AAC.01126-19 (2019). [DOI] [PMC free article] [PubMed]
  • 18.Salehi, Z., Shams-Ghahfarokhi, M. & Razzaghi-Abyaneh, M. Antifungal drug susceptibility profile of clinically important dermatophytes and determination of point mutations in terbinafine-resistant isolates. Eur. J. Clin. Microbiol. Infect. Dis.37, 1841–1846. 10.1007/s10096-018-3317-4 (2018). [DOI] [PubMed] [Google Scholar]
  • 19.Bhatia, V. K. & Sharma, P. C. Determination of minimum inhibitory concentrations of itraconazole, terbinafine and ketoconazole against dermatophyte species by broth microdilution method. Indian J. Med. Microbiol.33, 533–537. 10.4103/0255-0857.167341 (2015). [DOI] [PubMed] [Google Scholar]
  • 20.Shankarnarayan, S. A. et al. Rapid detection of terbinafine resistance in Trichophyton species by Amplified refractory mutation system-polymerase chain reaction. Sci. Rep.10, 1297. 10.1038/s41598-020-58187-0 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Thomas, J. et al. Toenail onychomycosis: an important global disease burden. J. Clin. Pharm. Ther.35, 497–519. 10.1111/j.1365-2710.2009.01107.x (2010). [DOI] [PubMed] [Google Scholar]
  • 22.Gupta, A. K. et al. Onychomycosis: strategies to minimize recurrence. J. Drugs Dermatol.15, 279–282 (2016). [PubMed] [Google Scholar]
  • 23.Gupta, A. K. et al. A paradigm shift in the treatment and management of onychomycosis. Skin. Appendage Disord.7, 351–358. 10.1159/000516112 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Singh, A. et al. High terbinafine resistance in Trichophyton interdigitale isolates in Delhi, India harbouring mutations in the squalene epoxidase gene. Mycoses61, 477–484. 10.1111/myc.12772 (2018). [DOI] [PubMed] [Google Scholar]
  • 25.Mukherjee, P. K. et al. Clinical Trichophyton rubrum strain exhibiting primary resistance to terbinafine. Antimicrob. Agents Chemother.47, 82–86. 10.1128/AAC.47.1.82-86.2003 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Osborne, C. S. et al. Biological, biochemical, and molecular characterization of a new clinical Trichophyton rubrum isolate resistant to terbinafine. Antimicrob. Agents Chemother.50, 2234–2236. 10.1128/AAC.01600-05 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Siopi, M., Efstathiou, I., Theodoropoulos, K., Pournaras, S. & Meletiadis, J. Molecular epidemiology and antifungal susceptibility of trichophyton isolates in Greece: emergence of terbinafine-resistant trichophytonmentagrophytes type VIII locally and globally. J. Fungi (Basel)2021, 7. 10.3390/jof7060419 (2021). [DOI] [PMC free article] [PubMed]
  • 28.Osborne, C. S., Hofbauer, B., Favre, B. & Ryder, N. S. In vitro analysis of the ability of Trichophyton rubrum to become resistant to terbinafine. Antimicrob. Agents Chemother.47, 3634–3636. 10.1128/AAC.47.11.3634-3636.2003 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kano, R., Noguchi, H., Harada, K. & Hiruma, M. Rapid molecular detection of terbinafine-resistant dermatophytes. Med. Mycol. J.62, 41–44. 10.3314/mmj.21-00001 (2021). [DOI] [PubMed] [Google Scholar]
  • 30.Burmester, A., Hipler, U. C., Hensche, R., Elsner, P. & Wiegand, C. Point mutations in the squalene epoxidase gene of Indian ITS genotype VIII T. mentagrophytes identified after DNA isolation from infected scales. Med. Mycol. Case Rep.26, 23–24. 10.1016/j.mmcr.2019.09.001 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kong, X. et al. Antifungal susceptibility and mutations in the squalene epoxidase gene in dermatophytes of the trichophyton mentagrophytes species complex. Antimicrob. Agents Chemother.65, e0005621. 10.1128/AAC.00056-21 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The dataset of SQLE sequences are deposited in the GenBank database with the accession number PX994303- PX994316.

The DNA sequence data generated during this study have been deposited in the NCBI GenBank database and are publicly available under the following BioProject submissions:- *SQLE* sequences (n = 106): Submission ID 3036822 (including 4 resistant and 10 wild-type representative sequences)The datasets can be accessed via [https://www.ncbi.nlm.nih.gov/genbank/](https:/www.ncbi.nlm.nih.gov/genbank) using the respective submission IDs. Additional data supporting the findings of this study are available from the corresponding author upon reasonable request.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES