Abstract
Background
Endothelial dysfunction characterized by cytokine release and adhesion molecule upregulation is a major driver of atherogenesis. Tumor necrosis factor-α (TNF-α) activates NF-κB signaling and increases ICAM-1, VCAM-1, IL-6, and IL-8 expression in endothelial cells. This study aimed to investigate whether amentoflavone (AMF) modulates TNF-α-induced inflammatory and adhesion-related responses in human endothelial cells, supporting its potential to mitigate early vascular dysfunction.
Methods
Human umbilical vein endothelial cells (HUVECs) were stimulated with TNF-α (10 ng/mL) in the presence or absence of AMF. Six experimental groups were designed to determine AMF’s prophylactic, concurrent, and post-treatment influences on inflammation. Relative mRNA levels of IL-6, IL-8, ICAM-1, VCAM-1, and NF-κB were quantified by qRT-PCR, while protein levels were measured by ELISA.
Results
TNF-α markedly increased IL-6, IL-8, ICAM-1, VCAM-1, and NF-κB expression at both the mRNA and protein levels. AMF alone did not trigger any inflammatory response and notably attenuated TNF-α-induced cytokine and adhesion molecule upregulation. Both concurrent and sequential AMF treatments reduced inflammatory responses compared with TNF-α-only cells. Prophylactic AMF administration demonstrated the greatest inhibitory effect, indicating enhanced preventive potential. AMF effectively suppresses TNF-α–mediated endothelial activation by downregulating NF-κB signaling and reducing the expression of IL-6, IL-8, ICAM-1, and VCAM-1.
Conclusions
These findings suggest that AMF may represent a promising in vitro preventive candidate against TNF-α-induced endothelial activation, warranting further validation in additional experimental models.
Graphical Abstract
Keywords: Amentoflavone (AMF), Endothelial activation, HUVECs, Tumor necrosis factor-alpha (TNF-α), NF-κB signaling, Atherosclerosis
Introduction
Cardiovascular diseases (CVDs), composed of several vascular and cardiac aberrations, are the leading causes of both reduced quality of life and global mortality [21, 54] According to the World Health Organization (WHO), CVDs are responsible for approximately 18 million deaths per year, and more than 31% of all deaths globally [22, 54]. Atherosclerosis, the main underlying cause of CVDs, is a chronic arterial disease resulting from lipid oxidation and hyperlipidemia [9, 30].
Since the late 20th century, the endothelium appears to be the major player in vascular tone and structure regulation [29, 33]. As it maintains the balance of both vasoconstriction and vasodilation via inhibiting leukocyte and platelet adhesion to the endothelial surface, leukocytes cannot bind to the healthy endothelium, thus, common conditions disrupting this balance and predisposing to atherosclerosis lead to proatherogenic and proinflammatory endothelium resulting in endothelial damage [33].
Although the pathologic process leading to atherosclerosis is complex, altered cellular permeability because of increased low-density lipoprotein cholesterol concentrations slowly changes the structure of the arterial walls [6] which trigger macrophage migration into affected tissue to clear debris and recruit other immune system cells including monocytes and leukocytes as an inflammatory response [2]. The circulating monocytes attach and migrate to the sub-endothelial region and finally infiltrate the arterial-endothelial walls after being converted to foamy cells. The accumulation of these structures then leads to a thickening lesion-an atherosclerotic plaque formation which tends to plaque rupture that could result in a fatal thrombosis [57]. Besides, macrophages at this inflammation point produce the most prominent inflammatory cytokine, namely Tumor Necrosis Factor Alpha (TNF-α) [2] which induces Nuclear factor-kappa B (NF-κB), Intercellular Adhesion Molecule-1 (ICAM-1), and Vascular Cell Adhesion Molecule-1 (VCAM-1) expressions [39].
In the presence of inflammatory stimuli such as TNF-α, or interleukin (IL) -1, or IL-6, or IL-8 [23, 47], the expression of ICAM-1 increases, which leads to tight adhesion during leukocyte transendothelial migration facilitating the development of atherosclerosis [10, 25]. VCAM-1, however, attaches principally to T lymphocytes and monocytes on recently formed atheroma [29]. ICAM-1 and VCAM-1 transcriptions particularly depend on the initiation of TNF-α owing to the elevated NF-κB expression [1, 32] which may explain the connection between proinflammatory cytokines and atherosclerosis.
Flavonoids have positive effects on human health due to their anti-inflammatory, antioxidant, and anti-atherogenic activities [16, 38]. In studies on monocyte adhesion and cell damage, flavonoids have been shown to decrease in expression levels of molecules such as NF-κB, VCAM-1, and ICAM-1 [13, 14]. Amentoflavone (C30H18O10, AMF) with a chemical structure of “8-[5-(5,7-Dihydroxy-4-oxo-4H-chromen-2-yl)-2-hydroxyphenyl]-5,7-dihydroxy-2-(4-hydroxyphenyl)-4H chromen-4-one- is a bioflavonoid commonly observed in plants [12]. With the improvement in modern pharmacology, this drug has proven to have several characteristics such as antioxidant [28], anti-inflammatory [7], anti-senescence [53], anti-tumor [52], anti-viral [51], and anti-fungal [11]. It has also therapeutic benefits on both the central nervous [45] and cardiovascular systems [27] whereas there are only a few studies about its effect on endothelial damage.
While prior studies reported anti-inflammatory effects of AMF in TNF-α–stimulated endothelial cells, its impact on ICAM-1, VCAM-1, IL-6, IL-8, and NF-κB expression, as well as the comparative efficacy of prophylactic versus therapeutic treatment strategies, remains insufficiently explored. In the present study, we aimed to assess the anti-inflammatory and anti-atherosclerotic effects of AMF on ICAM-1, VCAM-1, NF-κB, IL-6 and IL-8 in TNF-α induced inflammation model of atherosclerosis in ‘human umbilical vein endothelial cells’(HUVECs) culture.
Methods & materials
Cell culture
HUVECs (RRID: CVCL_2959; CRL-1730™, ATCC) were thawed and cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U/mL penicillin, and 100 µg/mL streptomycin (Gibco) at 37 °C in a humidified atmosphere containing 5% CO₂. Cells were seeded in 6-well plates at a density of 1 × 10⁵ cells/well. The culture medium was replaced every 48 h until cells reached 80–90% confluence. All experiments were performed using cells at passage 4–5. TNF-α (10 ng/mL) was used to induce endothelial activation as an inflammation model. Cells were separated into 6 distinct groups to investigate the prophylactic, concurrent, and therapeutic effects of AMF. All cultures were studied in duplicate wells and incubated for 24 h at 37 °C.
Group 1. The control (untreated) group
HUVEC cells were used as the control group.
Group 2. The Amentoflavone (AMF)-only group
HUVECs were exposed to 20 µM AMF.
Group 3. Tumor Necrosis Factor-Alpha (TNF-α)-only group
HUVECs were exposed to 10 ng/ml TNF-α. The TNF-only group was used to confirm the presence of any inflammation.
Group 4. AMF + TNF-α group
HUVECs were exposed to concurrent 20 µM AMF and 10 ng/ml TNF-α.
Group 5. Pre-AMF + Post-TNF-α group
HUVECs were exposed to 20 µM AMF for 6 h, then 10 ng/ml TNF-α was added and the incubation time was completed to 24 h.
Group 6. Pre-TNF-α + Post-AMF group
HUVECs were exposed to 10 ng/ml TNF-α for 6 h, then 20 µM AMF was added and the incubation time was completed to 24 h.
MTT analysis
The cytotoxic effect of AMF on HUVECs was evaluated using the MTT Cell Viability Kit (Biotium Inc., Cat. No. 30006). Cells were seeded in 96-well plates at a density of 5,000–8,000 cells/well and cultured for 48–72 h to reach optimal confluence. Cells were then treated with AMF at concentrations of 4, 20, 100, and 500 µM in DMEM for 24 and 48 h. Following treatment, 10 µL of MTT solution was added to each well containing 100 µL of culture medium. After 4 h of incubation at 37 °C, the supernatant was removed and 200 µL of DMSO was added to dissolve the formazan crystals (final volume: 300 µL per well). Absorbance was measured at 570 nm with background correction at 630 nm using a spectrophotometer. Cell viability was expressed as a percentage relative to untreated control cells using the following formula:
![]() |
The IC50 value at 24 h was determined by four-parameter logistic regression analysis.
mRNA expression analysis
After the incubation period, RNA was isolated from all the cells using RiboEx (GeneAll, catalog no: 301-001, PCR Lab, Germany) and Hybrid-R (GeneAll, catalog No: 305 − 101, PCR Lab, Germany) RNA isolation kits. Complementary DNA (cDNA) synthesis was performed by GeneAll HyperScriptTM First-strand synthesis kit (Catalogue No:601-005). The expression analysis was performed in duplicate by GeneAll RealAmpTM SYBR qRT-PCR Master mix (Catalogue No:801 − 051) using ‘7500 Fast Real-Time PCR instrument (Applied Biosystems)’. The primers’ list being used are shown in Table 1. The 2ˆ (–ΔΔCT) method was used for the quantitative real-time PCR reaction data analysis.
Table 1.
The primer list of being used in the qRT-PCR experiments
| Gene | Forward (5’ to 3’) | Reverse (5’ to 3’) |
|---|---|---|
| IL-6 [15] | AGACAGCCACTCACCTCTTCAG | TTCTGCCAGTGCCTCTTTGCTG |
| IL-8 [56] | CACCGGAAGGAACCATCTCACT | TCAGCCCTCTTCAAAAACTTCTCC |
| ICAM-1 [20] | CTCCAATGTGCCAGGCTTG | CAGTGGGAAAGTGCCATCCT |
| VCAM-1 [19] | TTCCCTAGAGATCCAGAAATCGAG | CTTGCAGCTTACAGTGACAGAGC |
| NF-κB p65 [50] | ATCCCTGCTTCCCCTTTCTC | CTGTCTTATGGCTGAGGTCTGGT |
| GAPDH [43] | TGCACCACCAACTGCTTAGC | GGCATGGACTGTGGTCATGAG |
Protein immunoassay
‘Enzyme-linked immunosorbent assay’(ELISA) method was performed in duplicate to detect the presence and/or amount of total NF-κB p65 (Elabscience Biotechnology Inc., Catalogue No: E-EL-H1388), ICAM-1 (Elabscience Biotechnology Inc., Catalogue No: E-EL-H2585), and VCAM-1 (Elabscience Biotechnology Inc., Catalogue No: E-EL-H5587), and IL-6 (Elabscience Biotechnology Inc., Catalogue No: E-EL-H0102), and IL-8 (Elabscience Biotechnology Inc., Catalogue No: E-EL-H0048).
Statistical analysis
GraphPad Prism 8.0 was used for data analysis. Due to the limited number of biological replicates (n = 2), inferential statistical analyses were not applied. Data are expressed as mean ± SD of two independent experiments, each performed in duplicate. qRT-PCR data are expressed as fold-change values calculated by the 2^(−ΔΔCt) method using GAPDH as the internal reference gene. Observed trends are interpreted descriptively as preliminary findings.
Results
Cell viability
To confirm that the observed anti-inflammatory effects were not attributable to cytotoxicity, cell viability was assessed by MTT assay at four AMF concentrations (4, 20, 100, and 500 µM) after 24 and 48 h of incubation (Table 2).
Table 2.
Cell viability of HUVECs treated with AMF at different concentrations for 24 and 48 h assessed by MTT assay
| AMF (µM) | 24 h Cell Viability (%) | 48 h Cell Viability (%) |
|---|---|---|
| 0 | 100 | 100 |
| 4 | 91.9 | > 100 |
| 20 | 92.0 | 66.0 |
| 100 | 79.5 | 62.0 |
| 500 | 40.7 | 29.7 |
At 24 h, AMF at 4 and 20 µM did not exhibit significant cytotoxicity, with cell viability values of 91.9% and 92.0%, respectively. At 100 µM, viability decreased to 79.5%, while 500 µM resulted in substantial cytotoxicity (40.7% viability). The IC50 at 24 h was calculated as 112.0 µM by four-parameter logistic regression. At 48 h, a time-dependent increase in cytotoxicity was observed across all concentrations, with viability decreasing to 66.0% and 29.7% at 20 and 500 µM, respectively. Since all functional experiments in this study were performed under 24 h incubation conditions, the working concentration of 20 µM (cell viability: 92.0%) was confirmed to be within the non-cytotoxic range, well above the commonly accepted threshold of 80%.
VCAM-1 mRNA and protein level comparison between the groups
In the control group, VCAM-1 mRNA expression and protein levels were notably lower than in the AMF + TNF-α, TNF-α–only, PreAMF+PostTNF-α, and PreTNF-α + PostAMF groups. Similarly, in the AMF-only group, VCAM-1 levels were also lower than in these treatment groups. The AMF + TNF-α group displayed higher expression compared with the control and AMF-only groups, but considerably lower than the TNF-α–only group. The TNF-α–only group showed the highest VCAM-1 expression relative to the control, AMF-only, and AMF + TNF-α groups. In the PreTNF-α + PostAMF group, VCAM-1 levels were elevated compared with the control and AMF-only groups. Finally, in the PreAMF+PostTNF-α group, VCAM-1 expression was also markedly higher compared with the control and AMF-only groups (Fig. 1).
Fig. 1.
Effect of amentoflavone (AMF) on TNF-α–induced VCAM-1 expression in HUVECs. (A) Relative VCAM-1 mRNA expression levels determined by qRT-PCR, normalized to GAPDH and expressed as fold change relative to control. (B) VCAM-1 protein levels measured by ELISA and expressed as ng/mL. Data are presented as mean ± SD of two independent biological experiments (n = 2), each performed in duplicate
ICAM-1 mRNA and protein level comparison between the groups
In the control group, ICAM-1 mRNA expression and protein levels were notably lower than in the TNF-α–only and PreTNF-α + PostAMF groups. In the AMF-only group, ICAM-1 levels remained low and were considerably lower than in the TNF-α–only and AMF + TNF-α groups. The AMF + TNF-α group exhibited higher ICAM-1 expression compared with the control and AMF-only groups, but levels were markedly lower than in the TNF-α–only group. The TNF-α–only group showed the highest ICAM-1 expression relative to all other groups. In the PreTNF-α + PostAMF group, ICAM-1 expression was elevated compared with the control, AMF-only, and AMF + TNF-α groups, but remained lower than in the TNF-α–only group. Finally, in the PreAMF+PostTNF-α group, ICAM-1 levels were notably reduced relative to the TNF-α–only and PreTNF-α + PostAMF groups (Fig. 2).
Fig. 2.
Effect of amentoflavone (AMF) on TNF-α–induced ICAM-1 expression in HUVECs. (A) Relative ICAM-1 mRNA expression levels determined by qRT-PCR, normalized to GAPDH and expressed as fold change relative to control. (B) ICAM-1 protein levels measured by ELISA and expressed as pg/mL. Data are presented as mean ± SD of two independent biological experiments (n = 2)
IL-6 mRNA and protein level comparison between the groups
In the control group, IL-6 mRNA expression and protein levels were notably lower than in the TNF-α–only, AMF + TNF-α, and PreTNF-α + PostAMF groups. In the AMF-only group, IL-6 levels were also markedly reduced compared with all other treatment groups. The TNF-α–only group exhibited the highest IL-6 expression among all groups. The AMF + TNF-α group showed intermediate levels, considerably higher than the AMF-only and control groups, but lower than the TNF-α–only group. In the PreTNF-α + PostAMF group, IL-6 expression was elevated compared with the control and AMF-only groups, but remained lower than in the TNF-α–only group. Finally, in the PreAMF+PostTNF-α group, IL-6 levels were greater than in the AMF-only group, but still lower than both the TNF-α–only and PreTNF-α + PostAMF groups (Fig. 3).
Fig. 3.
Effect of amentoflavone (AMF) on TNF-α–induced IL-6 expression in HUVECs. (A) Relative IL-6 mRNA expression levels determined by qRT-PCR, normalized to GAPDH and expressed as fold change relative to control. (B) IL-6 protein concentrations measured by ELISA and expressed as pg/mL. Data are presented as mean ± SD of two independent biological experiments (n = 2)
IL-8 mRNA and protein level comparison between the groups
In the control group, IL-8 mRNA expression and protein levels were notably lower than in the TNF-α–only group. In the AMF-only group, IL-8 levels were also markedly reduced compared with the TNF-α–only and AMF + TNF-α groups. The AMF + TNF-α group exhibited intermediate IL-8 levels, which were higher than the AMF-only group, but considerably lower than the TNF-α–only group. The TNF-α–only group showed the highest IL-8 expression among all groups. In the PreTNF-α + PostAMF group, IL-8 levels were higher than in the AMF-only group, but remained lower than in the TNF-α–only group. Finally, in the PreAMF+PostTNF-α group, IL-8 expression and protein levels were notably reduced relative to the TNF-α–only group (Fig. 4).
Fig. 4.
Effect of amentoflavone (AMF) on TNF-α–induced IL-8 expression in HUVECs. (A) Relative IL-8 mRNA expression levels determined by qRT-PCR, normalized to GAPDH and expressed as fold change relative to control. (B) IL-8 protein concentrations measured by ELISA and expressed as pg/mL. Data are presented as mean ± SD of two independent biological experiments (n = 2)
NF-κB mRNA and protein level comparison between the groups
In the AMF-only group, total NF-κB p65 expression was notably lower than in the TNF-α–only group. The AMF + TNF-α group displayed intermediate NF-κB levels: in qPCR analysis, no marked difference was observed compared with the control or AMF-only groups, whereas at protein level, NF-κB levels were higher than in the control and AMF-only groups, but consistently lower than in the TNF-α–only group. The TNF-α–only group exhibited the highest NF-κB expression among all groups. In the PreTNF-α + PostAMF group, NF-κB levels were elevated compared with the control, AMF-only, and AMF + TNF-α groups, yet remained lower than in the TNF-α–only group. Finally, in the PreAMF+PostTNF-α group, NF-κB expression was higher than in the control and AMF-only groups, but lower than in the TNF-α–only and PreTNF-α + PostAMF groups (Fig. 5).
Fig. 5.
Effect of amentoflavone (AMF) on TNF-α–induced NF-κB expression in HUVECs. (A) Relative NF-κB-p65 mRNA expression levels determined by qRT-PCR, normalized to GAPDH and expressed as fold change relative to control. (B) NF-κB-p65 total protein concentrations measured by ELISA and expressed as ng/mL. Data are presented as mean ± SD of two independent biological experiments (n = 2)
Discussion
Atherosclerosis is recently recognized not only as a lipid storage disease but also as a chronic inflammatory condition in which endothelial dysfunction, leukocyte adhesion, and cytokine signaling play pivotal roles [29, 33, 42]. Adhesion molecules such as VCAM-1 and ICAM-1 [25, 39], together with proinflammatory cytokines including IL-6 [3, 48], IL-8 [47, 49], and the transcription factor NF-κB [29, 33], form the core network driving vascular inflammation and plaque formation. In this context, natural compounds with anti-inflammatory and antioxidant potential are increasingly investigated as complementary therapeutic strategies [14, 16]. Among these, AMF, a biflavonoid found in various plants, has gained attention for its ability to modulate inflammatory pathways and reduce endothelial activation [27, 51]. This study set out with the aim of assessing the importance of AMF in -an important proinflammatory cytokine which induces vasodilation and thereby facilitates the infiltration of monocytes and lymphocytes TNF-α-induced in vitro model of TNF-α–induced endothelial activation, which represents an early event in atherogenesis of HUVEC in case of adhesion molecules VCAM-1 and ICAM-1, and NF-κB, and proinflammatory cytokines IL-6 and IL-8. This study provides preliminary evidence for a predominantly prophylactic effect of AMF against TNF-α–induced endothelial activation, underscoring the need for further investigation in early atherosclerosis.
Endothelial cells are not only single-cell surfaces covering the internal surface of the veins but also key players on the development and progression of atherosclerosis. In healthy conditions, endothelium cells prevent leukocyte adhesion to the vascular membrane [30], any endothelial dysfunction directly leads to proinflammatory and prothrombotic phenotype so the initiation of atherosclerosis [42]. The endothelial cells with the vascular smooth muscle [34], endothelial adhesion molecules, including VCAM-1 and ICAM-1 [1], and interleukins including IL-6 and IL-8 [4, 48] are main actors in the development of atheroma lesions.
As the presence of the inflammation, the central driver of the formation of atheromas-the building blocks of atherosclerosis, NF-κB controls several genes of molecules such as cytokines, adhesion molecules and chemokines as being the central regulator of the inflammation process [18, 54]. AMF prevents inhibitor of κB (IκB) degradation and thereby inhibits the nuclear translocation of NF-κB p65, leading to the suppression of NF-κB–dependent inflammatory gene expression [54]. Therefore, locking nuclear NF-κB translocation [8, 25]. According to recent reports, the transcription of adhesion molecules such as VCAM-1 and ICAM-1 mainly depends on the induction of TNF-α through the NF-κB activation [32, 40]. In our study, NF-κB involvement was assessed by measuring total p65 mRNA and protein levels. We acknowledge that this approach only demonstrates NF-κB pathway activation or inhibition indirectly, as NF-κB activity is primarily regulated through post-translational mechanisms including Inhibitor kappa B alpha (IκBα) degradation, p65 phosphorylation, and nuclear translocation of the p65/RelA subunit. However, the obtained decrease in total NF-κB p65 expression at both mRNA and protein levels in AMF-treated groups, especially in the pre-treatment condition, is consistent with a suppressive effect on NF-κB signaling. These results are supported by previous studies showing that AMF directly inhibits NF-κB activation through well-characterized mechanisms. Banerjee et al. [8] showed that AMF suppressed IκBα degradation and NF-κB nuclear translocation in TNFα-stimulated A549 cells. Yu et al. [55] reported that AMF downregulated NF-κB p65 protein expression, upregulated IκBα, and attenuated p65 nuclear translocation in vascular endothelial cells [55]. Furthermore, Rong et al. [44] demonstrated that AMF inhibited the TLR4/MyD88/NF-κB pathway in LPS-induced BV2 microglia.
The findings of this study suggest that AMF as an anti-inflammatory compound with potential relevance to early atherogenic processes may inhibit leukocyte adhesion to endothelial cells, probably by preventing the stimulation of cell adhesion molecules such as VCAM and ICAM. We found that the presence of AMF appears to inhibit these adhesion molecules and common inflammatory cytokines such as IL-6 and IL-8 which are necessary for leukocyte infiltration during atheroma plaque formation. In the PreAMF+PostTNF group, the inflammation blockage is more effective than the group Pre TNF+Post AMF. In other words, given the therapeutic potential of this compound, AMF may ameliorate TNF-α–induced endothelial inflammatory responses relevant to early atherogenic processes. The pre-treatment group’s higher inhibitory effect that we observed is in line with the temporal dynamics of NF-κB signaling. IκBα degradation and p65 nuclear translocation occur quickly but momentarily during TNF-α stimulation [31]. AMF can target upstream components such as IκB kinase (IKK) and IκBα before the cascade is initiated when it is delivered prior to the stimulus. This mechanism has been shown for similar flavonoids such luteolin [24] and genistein [17]. On the other hand, co-treatment demonstrated intermediate efficacy consistent with concurrent competition at early signaling events, whereas post-treatment only permits partial attenuation of an already active cascade.
The maintenance of the endothelial cell surface is important for the normal physiological function of the blood vessels which can even be sustained by trace amounts of antioxidants [36, 40]. However, the widespread use of many antioxidants including selenium, vitamin E, and butyl hydroxytoluene has been limited due to their high toxic effect [35, 41]. Thus, it is necessary to study herbal compounds that have less toxicity and side-effects, namely AMF, to prevent related diseases [26]. In this study, a concentration of 20 µM was chosen for AMF treatment, corresponding to the commonly used dose range (10–50 µM) utilized in anti-inflammatory research involving AMF [8, 37]. Our MTT results indicated that 20 µM AMF preserves cell viability at 24 h (92%), with a 24-hour IC50 of 112.0 µM. These results suggest that anti-inflammatory effects are indicative of a particular pharmacological activity itself.
There have been several studies describing the anti-inflammatory effects of AMF [8, 25]) which are especially significant in therapeutic processes. Besides, AMF is shown to inhibit not only the non-enzymatic lipid peroxidation [46] but also nitric oxide synthase in macrophages [5]. There is compelling evidence that the increased dietary intake of flavones is related to decreased low-density lipoprotein levels which are inversely related to atherosclerotic cascade [5].
The present results are significant in at least two major respects. First, AMF might inhibit early endothelial activation processes associated with atherogenesis, primarily through the suppression of adhesion molecule and cytokine expression. Second, the findings suggest that prophylactic exposure to AMF may be more effective than post-inflammatory administration under the present experimental conditions. However, more research on this topic needs to be undertaken before the association between AMF and atherosclerosis inhibition is more clearly understood. The study should also be confirmed by other cell lines and animal models.
Limitations
This study has several limitations. First, all experiments were performed in a single endothelial cell line (HUVECs) under in vitro conditions, which may not fully reflect the complex cellular interactions present in vivo. Direct assessment of NF-κB activation status, such as p65 nuclear translocation, IκBα degradation, or p65 phosphorylation were also not performed due to budgetary constraints. Future studies employing immunofluorescence, nuclear/cytoplasmic fractionation, functional validation of adhesion molecule suppression, such as a monocyte adhesion assay, or reporter gene assays are warranted to confirm the direct involvement of NF-κB signaling in the anti-inflammatory effects of AMF observed in HUVECs. Second, inflammatory activation was induced using a single cytokine stimulus (TNF-α), whereas atherosclerosis is driven by multiple concurrent inflammatory and metabolic factors. Third, the experimental design was limited to short-term exposure and a single effective concentration of AMF. Finally, all experiments were performed as two independent biological replicates (n = 2), each conducted in duplicate wells. Due to the limited sample size, inferential statistical analyses were not applied; data are presented descriptively. The consistent trends observed across both replicates and across multiple endpoints (qRT-PCR, ELISA) support the biological plausibility of the findings; however, validation with increased sample sizes (n ≥ 3) is warranted.
Acknowledgements
Not applicable.
Author contributions
F.C.T.: Conceptualization, Methodology, Project administration. B.O.: Investigation, Data curation, Formal analysis. Z.C.: Writing – original draft, Writing – review & editing. A.G.A.: Validation, Statistical analysis, Visualization. S.Ö.: Supervision, Funding acquisition, Critical revision of the manuscript.
Funding
This study was supported by the Scientific Research Projects Unit of Istanbul University. Project No: TDK-2019-33971.
Data availability
All data used and/or analyzed during the current study may be available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
This study was conducted exclusively using a commercially available, established human endothelial cell line (HUVECs; ATCC, CRL-1730™). No human participants, human-derived biological samples, or animal subjects were involved. According to national regulations and institutional guidelines in Türkiye, ethical approval from a local ethics committee or Institutional Review Board (IRB) is not required for in vitro studies performed solely with purchased cell lines. Therefore, ethics committee approval was not applicable for this study.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Abeywardena MY, Leifert WR, Warnes KE, Varghese JN, Head RJ. Cardiovascular biology of interleukin-6. Curr Pharm Des. 2009;15(15):1809–21. 10.2174/138161209788186290. PMID: 19442192. [DOI] [PubMed] [Google Scholar]
- 2.Aikawa M, Libby P. The vulnerable atherosclerotic plaque: pathogenesis and therapeutic approach. Cardiovasc Pathol. 2004;13:125–38. 10.1016/S1054-88070400004-3. PMID: 15081469. [DOI] [PubMed]
- 3.Alam MA, et al. Effect of citrus flavonoids, naringin and naringenin, on metabolic syndrome and their mechanisms of action. Adv Nutr. 2014;5:404–17. 10.3945/an.113.005603. PMID: 25022990; PMCID: PMC4085189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Antonopoulos AS, Margaritis M, Lee R, Channon K, Antoniades C. Statins as anti-inflammatory agents in atherogenesis: molecular mechanisms and lessons from the recent clinical trials. Curr Pharm Des. 2012;18:1519–30. PMID: 22364136; PMCID: PMC3394171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Arai Y, Watanabe S, Kimira M, Shimoi K, Mochizuki R, Kinae N. Dietary intakes of flavonols, flavones and isoflavones by Japanese women and the inverse correlation between quercetin intake and plasma LDL cholesterol concentration. J Nutr. 2000;130:2243–50. 10.1093/jn/130.9.2243. PMID: 10958819. [DOI] [PubMed]
- 6.Arango Duque G, Descoteaux A. Macrophage cytokines: involvement in immunity and infectious diseases. Front Immunol. 2014;5:491. 10.3389/fimmu.2014.00491. PMID: 25339958; PMCID: PMC4188125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Azebaze AG, Dongmo AB, Meyer M, et al. Antimalarial and vasorelaxant constituents of the leaves of Allanblackia monticola. Ann Trop Med Parasitol. 2007;101(1):23–30. 10.1179/136485907X157022. PMID: 17244407. [DOI] [PubMed]
- 8.Banerjee T, Valacchi G, Ziboh VA. Inhibition of TNF-α-induced cyclooxygenase-2 by amentoflavone through suppression of NF-κB activation in A549 cells. Mol Cell Biochem. 2002;238:105–10. 10.1023/a:1019963222510. PMID: 12349896. [DOI] [PubMed]
- 9.Baradaran A. Lipoprotein(a), type 2 diabetes and nephropathy: the mystery continues. J Nephropathol. 2012;1:126–9. PMID: 24475402; PMCID: PMC3886158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Bickel M. The role of interleukin-8 in inflammation and mechanisms of regulation. J Periodontol. 1993;64(5 Suppl):456–60. PMID: 8315568. [PubMed] [Google Scholar]
- 11.Bucar F, Jachak SM, Noreen Y, Kartnig T, Perera P, Bohlin L, et al. Amentoflavone from Biophytum sensitivum and its effect on COX-1/COX-2 catalysed prostaglandin biosynthesis. Planta Med. 1998;64:373–4. 10.1055/s-2006-957455. PMID: 17253252. [DOI] [PubMed]
- 12.Calvo TR, Demarco D, Santos FV, et al. Phenolic compounds in leaves of Alchornea triplinervia: anatomical localization, mutagenicity, and antibacterial activity. Nat Prod Commun. 2010;5(8):1225–32. PMID: 20839624. [PubMed] [Google Scholar]
- 13.Calvo TR, Lima ZP, Silva JS, et al. Constituents and antiulcer effect of Alchornea glandulosa: activation of cell proliferation in gastric mucosa during the healing process. Biol Pharm Bull. 2007;30(3):451–9. 10.1248/bpb.30.451. PMID: 17329837. [DOI] [PubMed]
- 14.Chanet A, et al. Flavanone metabolites decrease monocyte adhesion to TNF-α-activated endothelial cells by modulating expression of atherosclerosis-related genes. Br J Nutr. 2013;110:587–98. Epub 2013 Jan 21. PMID: 23332102. [DOI] [PubMed] [Google Scholar]
- 15.Chen F, Mo J, Zhang L. Long noncoding RNA BCAR4 promotes osteosarcoma progression through activating GLI2-dependent gene transcription. Tumour Biol. 2016;37(10):13403–12. 10.1007/s13277-016-5256-y. Epub 2016 Jul 27. PMID: 27460090. [DOI] [PubMed] [Google Scholar]
- 16.Choi JS, Choi YJ, Park SH, Kang JS, Kang YH. Flavones mitigate tumor necrosis factor-α-induced adhesion molecule upregulation in cultured human endothelial cells: role of nuclear factor-κB. J Nutr. 2004;134(5):1013–9. 10.1093/jn/134.5.1013. PMID: 15113938. [DOI] [PubMed]
- 17.Davis JN, Kucuk O, Sarkar FH. Genistein inhibits NF-kappa B activation in prostate cancer cells. Nutr Cancer. 1999;35(2):167 – 74. 10.1207/S15327914NC352_11. PMID: 10693171. [DOI] [PubMed]
- 18.de Winther MP, Kanters E, Kraal G, Hofer MH. Nuclear factor kappaB signaling in atherogenesis. Arterioscler Thromb Vasc Biol. 2005;25(5):904–14. 10.1161/01.ATV.0000160340.72641.87. Epub 2005 Feb 24. PMID: 15731497. [DOI] [PubMed] [Google Scholar]
- 19.Deng X, Chu X, Wang P, Ma X, Wei C, Sun C, Yang J, Li Y. MicroRNA-29a-3p Reduces TNFα-Induced Endothelial Dysfunction by Targeting Tumor Necrosis Factor Receptor 1. Mol Ther Nucleic Acids. 2019;18:903–15. 10.1016/j.omtn.2019.10.014. Epub 2019 Oct 22. PMID: 31760375; PMCID: PMC6883339. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Gao ZX, Liu D, Liu LL, Lin LR, Tong ML, Niu JJ, Yang TC. Recombinant Treponema pallidum protein Tp47 promotes the migration and adherence of THP-1 cells to human dermal vascular smooth muscle cells by inducing MCP-1 and ICAM-1 expression. Exp Cell Res. 2019;381(1):150–62. Epub 2019 May 7. PMID: 31075255. [DOI] [PubMed] [Google Scholar]
- 21.GBD2017DALYandHALEC. Global, regional, and national disability-adjusted life-years for 359 diseases and injuries and healthy life expectancy in 195 countries and territories, 1990–2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2018;392:1859–922. 10.1016/S0140-6736(18)32335-3. Erratum in: Lancet. 2019;393(10190):e44. doi: 10.1016/S0140-6736(19)31043-8. PMID: 30415748; PMCID: PMC6252083. [DOI] [PMC free article] [PubMed]
- 22.Hennekens CH, Gaziano JM. Antioxidants and heart disease: epidemiology and clinical evidence. Clin Cardiol. 1993;16(4 Suppl 1):I10-3; discussion I13-5. 10.1002/clc.4960161305. PMID: 8472392. [DOI] [PubMed]
- 23.Jara LJ, Medina G, Vera-Lastra O, Amigo MC. Accelerated atherosclerosis, immune response and autoimmune rheumatic diseases. Autoimmun Rev. 2006;5(3):195–201. 10.1016/j.autrev.2005.06.005. Epub 2005 Jul 26. PMID: 16483919. [DOI] [PubMed]
- 24.Jia Z, Nallasamy P, Liu D, Shah H, Li JZ, Chitrakar R, Si H, McCormick J, Zhu H, Zhen W, Li Y. Luteolin protects against vascular inflammation in mice and TNF-α-induced monocyte adhesion to endothelial cells via suppressing IΚBα/NF-κB signaling pathway. J Nutr Biochem. 2015;26(3):293–302. Epub 2014 Dec 15. PMID: 25577468; PMCID: PMC4334457. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Jung J, Ko SH, Yoo do Y, Lee JY, Kim YJ, Choi SM, Kang KK, Yoon HJ, Kim H, Youn J, Kim JM. 5,7-Dihydroxy-3,4,6-trimethoxyflavone inhibits intercellular adhesion molecule 1 and vascular cell adhesion molecule 1 via the Akt and nuclear factor-κB-dependent pathway, leading to suppression of adhesion of monocytes and eosinophils to bronchial epithelial cells. Immunology. 2012;137(1):98–113. 10.1111/j.1365-2567.2012.03618.x. PMID: 22862554; PMCID: PMC3449251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Kim HK, Son KH, Chang HW, Kang SS, Kim HO. Amentoflavone, a plant bioflavone: a new potential anti-inflammatory agent. Arch Pharm Res. 1998;21:406–10. 10.1007/BF02974634 PMID: 9875467. [DOI] [PubMed]
- 27.Landmesser U, Hornig B, Drexler H. Endothelial function: a critical determinant in atherosclerosis? Circulation. 2004;109(21 Suppl 1):II27-33. 10.1161/01.CIR.0000129501.88485.1f. PMID: 15173060. [DOI] [PubMed]
- 28.Li LZ, Wang MH, Sun JB, Liang JY. Flavonoids and other constituents from Aletris spicata and their chemotaxonomic significance. Nat Prod Res. 2014;28(15):1214–7. 10.1080/14786419.2014.921918 Epub 2014 Jun 4. PMID: 24896299. [DOI] [PubMed]
- 29.Libby P, Ridker PM, Maseri A. Inflammation and atherosclerosis. Circulation. 2002;105(9):1135–43. 10.1161/hc0902.104353. PMID: 11877368. [DOI] [PubMed]
- 30.Libby P. Inflammation in atherosclerosis. Nature. 2002;420:868–74. 10.1038/nature01323. PMID: 12490960. [DOI] [PubMed]
- 31.Liu T, Zhang L, Joo D, Sun SC. NF-κB signaling in inflammation. Signal Transduct Target Ther. 2017;2:17023. 10.1038/sigtrans.2017.23. Epub 2017 Jul 14. PMID: 29158945; PMCID: PMC5661633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Mackesy DZ, Goalstone ML. Insulin augments tumor necrosis factor-alpha stimulated expression of vascular cell adhesion molecule-1 in vascular endothelial cells. J Inflamm (Lond). 2011;8:34. 10.1186/1476-9255-8-34. PMID: 22093181; PMCID: PMC3248376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Martin SS, Blaha MJ, Blankstein R, Agatston A, Rivera JJ, Virani SS, Ouyang P, Jones SR, Blumenthal RS, Budoff MJ, Nasir K. Dyslipidemia, coronary artery calcium, and incident atherosclerotic cardiovascular disease: implications for statin therapy from the multi-ethnic study of atherosclerosis. Circulation. 2014;129(1):77–86. Epub 2013 Oct 20. PMID: 24141324; PMCID: PMC3919521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Nakashima Y, Raines EW, Plump AS, Breslow JL, Ross R. Upregulation of VCAM-1 and ICAM-1 at atherosclerosis-prone sites on the endothelium in the ApoE-deficient mouse. Arterioscler Thromb Vasc Biol. 1998;18(5):842 – 51. 10.1161/01.atv.18.5.842. PMID: 9598845. [DOI] [PubMed]
- 35.Nasri H, Shirzad H. Toxicity and safety of medicinal plants. J Herbmed Pharmacol. 2013;2:21–2. [Google Scholar]
- 36.Nasri H. Renoprotective effects of garlic. J Renal Inj Prev. 2013;2(1):27 – 8. 10.12861/jrip.2013.09. PMID: 25340118; PMCID: PMC4205995. [DOI] [PMC free article] [PubMed]
- 37.Oh J, Rho HS, Yang Y, Yoon JY, Lee J, Hong YD, Kim HC, Choi SS, Kim TW, Shin SS, Cho JY. Extracellular signal-regulated kinase is a direct target of the anti-inflammatory compound amentoflavone derived from Torreya nucifera. Mediators Inflamm. 2013;2013:761506. 10.1155/2013/761506. Epub 2013 Jul 21. PMID: 23970815; PMCID: PMC3736407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Panche AN, Diwan AD, Chandra SR. Flavonoids: an overview. J Nutr Sci. 2016;5:e47. Erratum in: J Nutr Sci. 2025;14:e11. 10.1017/jns.2024.73. PMID: 28620474; PMCID: PMC5465813. [DOI] [PMC free article] [PubMed]
- 39.Pober JS, Gimbrone MA Jr, Lapierre LA, Mendrick DL, Fiers W, Rothlein R, Springer TA. Overlapping patterns of activation of human endothelial cells by interleukin 1, tumor necrosis factor, and immune interferon. J Immunol. 1986;137(6):1893–6. PMID: 3091693. [PubMed] [Google Scholar]
- 40.Rafieian-Kopaei M, Baradaran A, Rafieian M. Plants antioxidants: From laboratory to clinic. J Nephropathol. 2013;2(2):152-3. 10.12860/JNP.2013.26 Epub 2013 Apr 1. PMID: 24475444; PMCID: PMC3891140. [DOI] [PMC free article] [PubMed]
- 41.Rafieian-Kopaei M, Nasri H. Ginger and diabetic nephropathy. J Ren Inj Prev. 2013;2(1):9–10. 10.12861/jrip.2013.05. PMID: 25340114; PMCID: PMC4205991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Ramos CL, Huo Y, Jung U, Ghosh S, Manka DR, Sarembock IJ, et al. Direct demonstration of P-selectin- and VCAM-1-dependent mononuclear cell rolling in early atherosclerotic lesions of apolipoprotein E-deficient mice. Circ Res. 1999;84(11):1237–44. 10.1161/01.res.84.11.1237. PMID: 10364560. [DOI] [PubMed]
- 43.Ren H, Guo X, Wang X, Cui Z. Adenosine A2A receptor deficiency prevents p38MAPK activation and apoptosis of mouse hippocampal cells in the chronic hypoxic-hypercapnia model. Biosci Biotechnol Biochem. 2019;83(10):1837–42. Epub 2019 Jun 9. PMID: 31179865. [DOI] [PubMed] [Google Scholar]
- 44.Rong S, Yang C, Wang F, Wu Y, Sun K, Sun T, Wu Z. Amentoflavone Exerts Anti-Neuroinflammatory Effects by Inhibiting TLR4/MyD88/NF-κB and Activating Nrf2/HO-1 Pathway in Lipopolysaccharide-Induced BV2 Microglia. Mediators Inflamm. 2022;2022:5184721. 10.1155/2022/5184721. PMID: 36523959; PMCID: PMC9747320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Sajjad A, Andrabi SMA, Qureshi M. Flavonoids from Biota semipervirens. Indian J Heterocycl Chem. 2001;11:87. [Google Scholar]
- 46.Sakthivel KM, Guruvayoorappan C. Amentoflavone inhibits iNOS, COX-2 expression and modulates cytokine profile, NF-κB signal transduction pathways in rats with ulcerative colitis. Int Immunopharmacol. 2013;17(3):907–16. Epub 2013 Oct 12. PMID: 24126114. [DOI] [PubMed] [Google Scholar]
- 47.Sampath R, Kukielka GL, Smith CW, Eskin SG, McIntire LV. Shear stress-mediated changes in the expression of leukocyte adhesion receptors on human umbilical vein endothelial cells in vitro. Ann Biomed Eng. 1995;23(3):247–56. [DOI] [PubMed] [Google Scholar]
- 48.Seino Y, Ikeda U, Ikeda M, Yamamoto K, Misawa Y, Hasegawa T, Kano S, Shimada K. Interleukin 6 gene transcripts are expressed in human atherosclerotic lesions. Cytokine. 1994;6(1):87–91. 10.1016/1043-46669490013-2. PMID: 8003639. [DOI] [PubMed]
- 49.Springer TA. Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annu Rev Physiol. 1995;57:827 – 72. 10.1146/annurev.ph.57.030195.004143. PMID: 7778885. [DOI] [PubMed]
- 50.Sun X, Huang X, Zhu X, Liu L, Mo S, Wang H, Wei X, Lu S, Bai F, Wang D, Lin X, Lin J. HBOA ameliorates CCl4-incuded liver fibrosis through inhibiting TGF-β1/Smads, NF-κB and ERK signaling pathways. Biomed Pharmacother. 2019;115:108901. Epub 2019 May 9. PMID: 31079002. [DOI] [PubMed] [Google Scholar]
- 51.Tchinda AT, Teshome A, Dagne E, Arnold N, Wessjohann LA. Squalene and amentoflavone from Antidesma laciniatum. Bull Chem Soc Ethiop. 2006;20:325–8. [Google Scholar]
- 52.Trang DT, Huyen LT, Nhiem NX, Quang TH, Hang DTT, Yen PH, Tai BH, Anha HLT, Binh NQ, Van Minha C, Van Kiem P. Tirucallane Glycoside from the Leaves of Antidesma bunius and Inhibitory NO Production in BV2 Cells and RAW264.7 Macrophages. Nat Prod Commun. 2016;11(7):935–7. PMID: 30452166. [PubMed] [Google Scholar]
- 53.Wang WJ, Lei J, Xiao YC, Xi Z, Yu M, Huang J. The separation and identification of biflavonoids from Androsace umbellata. West China J Pharm Sci. 2011;26:420–3. [Google Scholar]
- 54.Woo ER, Lee JY, Cho IJ, Kim SG, Kang KW. Amentoflavone inhibits the induction of nitric oxide synthase by inhibiting NF-kappaB activation in macrophages. Pharmacol Res. 2005;51(6):539 – 46. PMID: 15829434. World Health Organization. WHO report. Geneva: World Health Organization; 2017. 10.1016/j.phrs.2005.02.002. [DOI] [PubMed]
- 55.Yu S, Yan H, Zhang L, Shan M, Chen P, Ding A, Li SF. A Review on the Phytochemistry, Pharmacology, and Pharmacokinetics of Amentoflavone, a Naturally-Occurring Biflavonoid. Molecules. 2017;22(2):299. 10.3390/molecules22020299. PMID: 28212342; PMCID: PMC6155574. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Zhao W, Cui L, Huang X, Wang S, Li D, Li L, Sun Y, Du M. Activation of Rev-erbα attenuates lipopolysaccharide-induced inflammatory reactions in human endometrial stroma cells via suppressing TLR4-regulated NF-κB activation. Acta Biochim Biophys Sin (Shanghai). 2019;51(9):908–914. 10.1093/abbs/gmz078. PMID: 31411318. [DOI] [PubMed]
- 57.Zhong X, Li X, Liu F, Tan H, Shang D. Omentin inhibits TNF-α-induced expression of adhesion molecules in endothelial cells via ERK/NF-κB pathway. Biochem Biophys Res Commun. 2012;425(2):401–6. 10.1016/j.bbrc.2012.07.110. Epub 2012 Jul 27. PMID: 22842465. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data used and/or analyzed during the current study may be available from the corresponding author on reasonable request.







