A de novo start-loss variant in the NIPBL gene causing mild type 1 Cornelia de Lange syndrome in an Iranian family: A Case Report

Abstract

Background

Cornelia de Lange syndrome is a rare congenital disorder marked by considerable clinical variability, including intellectual disability, growth retardation, distinctive facial features, limb abnormalities, and multisystem involvement. The condition is primarily linked to mutations in genes encoding components of the cohesin complex that are essential for chromosomal stability and gene regulation. We report a case of a mild type of Cornelia de Lange syndrome caused by a de novo mutation in an Iranian family.

Case presentation

We investigated a 19-year-old Iranian male individual presenting with developmental delay, borderline intellectual disability, dysmorphic facial features, and multisystem involvement. Whole-exome sequencing was performed to identify causative variants. A de novo heterozygous variant affecting the start codon of NIPBL (NM_133433.4:c.2T>A; NP_597677.2:p.Met1Lys) was identified. This variant was absent from population databases and predicted to disrupt normal translation initiation. Sanger sequencing and co-segregation analysis confirmed the genetic findings. In silico tools and population databases were utilized to assess variant pathogenicity. Clinically, the patient exhibited classical Cornelia de Lange syndrome features with relatively mild intellectual impairment compared with typical loss-of-function cases, consistent with the hypothesis of potential use of alternative start sites.

Conclusion

This case shows a known NIPBL start-loss variant’s correlation with a relatively mild clinical presentation and offers more genotype–phenotype evidence for it. This finding suggests a possible role for downstream translation initiation as a modifier of disease severity, although further functional validation is required. Comprehensive genetic analysis remains essential for accurate diagnosis, prognosis, and counseling in patients with Cornelia de Lange syndrome.

Background

Cornelia de Lange syndrome (CdLS; Mendelian Inheritance in Man [MIM] no. 122470) is a congenital developmental disorder that represents considerable clinical variability, including psychomotor delays, intellectual disabilities, upper limb abnormalities, and hirsutism [1, 2].

CdLS represents a genetically heterogeneous condition caused by mutations in various genes, including structural maintenance of chromosomes 3 (SMC3), structural maintenance of chromosomes 1A (SMC1A), nipped-B-like (NIPBL), histone deacetylase 8 (HDAC8), and RAD21 cohesin complex component (RAD21), which encode structural or regulatory components of the cohesin complex. This complex is pivotal for chromosome segregation, DNA repair mechanisms, regulation of gene expression, and the remodeling of chromatin [3]. The inheritance pattern can be autosomal dominant (AD) or X-linked dominant (XLD), particularly for mutations in SMC1A and HDAC8 [4].

Among these genes, NIPBL, located on chromosome 5p13, accounts for approximately 60% of CdLS cases. This gene encompasses 47 exons and produces two isoforms of NIPBL protein [3, 5, 6]. The NIPBL protein contains several functional domains that enable it to interact with MAU2 and mediate cohesion complex loading on chromatin [5, 7, 8]. Once loaded, cohesin can move along chromatin or be released through mechanisms mediated by PDS5 and WAPL, thereby regulating gene expression and maintaining chromosomal stability [9, 10].

NIPBL dosage plays a major role in determining the severity of CdLS [11], and mechanisms that regulate residual protein production are especially important for understanding phenotypic variability. In some genes, variants that interfere with the original initiation codon may allow re-initiation at downstream methionines, resulting in N-terminally shortened but partially functional proteins [12]. The intrinsic flexibility of translation initiation mechanisms is further demonstrated by genome-wide analyses that show that single-nucleotide substitutions may produce or reveal alternative start codons [13]. These mechanisms offer a biologically plausible framework for explaining phenotypic variability, but their applicability to NIPBL is still unknown.

In this study, we report an Iranian patient with Cornelia de Lange syndrome type 1 (CdLS1) harboring a heterozygous start codon variant in the NIPBL gene (NM_133433.4:c.2T>A; NP_597677.2:p.Met1Lys), which is hypothesized to partially preserve gene function and contribute to a milder clinical phenotype.

Case presentation

Clinical assessment

An Iranian family with a male proband exhibiting neurodevelopmental abnormalities participated in this study. The proband (III-3) is a 19-year-old Iranian male individual born to healthy, nonconsanguineous parents with no known family history of Cornelia de Lange syndrome (CdLS) (Fig. 1A). He was delivered at term with a normal birth weight and a head circumference of 37 cm. His early postnatal period was marked by bilateral cryptorchidism, identified at birth, and global developmental delay, with significant delays in achieving developmental milestones. Speech delay was prominent, particularly affecting expressive language, and learning difficulties were observed throughout his educational years, despite relatively good memory function. His estimated intellectual quotient (IQ) falls within the borderline range (~70–80).

Fig. 1.

Genetic and familial characterization of the proband with a start-loss variant in the NIPBL gene. A Pedigree of the family showing the proband (III-3) affected with Cornelia de Lange syndrome type 1 (CdLS1) carrying a de novo heterozygous NIPBL start-loss variant. Other reported medical conditions in extended family members include failure to thrive, cancer, and thalassemia. These are shown in the pedigree for clinical context, but are not considered Mendelian traits and are likely multifactorial or unrelated. Symbols: the red square indicates intellectual disability (ID), blue indicates failure to thrive, green indicates cancer, and yellow indicates thalassemia carrier status. The proband is marked with an arrow. B Sanger sequencing chromatograms showing the c.2T>A (p.Met1Lys) variant in exon 2 of the NIPBL gene. The proband is heterozygous for the variant (black arrowhead), while both parents show wild-type sequence, confirming the variant is de novo

On physical examination, the proband exhibited distinctive dysmorphic facial features commonly associated with CdLS, including bilateral ptosis, microcephaly (head circumference at 6 months: 40 cm), low-set ears, and hirsutism, which was noted from birth. Additionally, he displayed hallux varus, a finding occasionally reported in mild phenotypic variants of CdLS. From the age of 8, he experienced progressive visual impairment, significantly affecting daily functioning.

Brain magnetic resonance imaging (MRI) revealed no structural abnormalities of the central nervous system. The only incidental findings included a mucosal retention cyst in the right maxillary sinus and adenoid hypertrophy, which may explain minor symptoms such as nasal congestion, snoring, or recurrent upper airway symptoms, though these findings were considered noncontributory to the neurodevelopmental phenotype.

There was no history of prenatal exposure to teratogenic agents. The family history was negative for CdLS but notable for various unrelated conditions, including neurodevelopmental disorders, failure to thrive, malignancies, and thalassemia. The proband’s mother was identified as a carrier of thalassemia, but she and the proband’s father and siblings were otherwise healthy and asymptomatic.

The clinical findings and stepwise diagnostic investigations of the proband are summarized in Table 1.

Table 1.

Timeline of clinical and diagnostic events

Age (years)/time point	Clinical findings	Diagnostic evaluations
Birth (T0)	Term birth; bilateral cryptorchidism; hirsutism	Neonatal clinical examination
Infancy	Global developmental delay; microcephaly	Pediatric follow-up
Childhood	Persistent speech delay; learning difficulties	Developmental assessments
~8 years	Progressive visual impairment	Ophthalmologic evaluation
Adolescence	Borderline intellectual functioning; facial dysmorphism; hallux varus	Clinical genetic assessment
19 years	Stable neurological status	Brain MRI (normal central nervous system [CNS] findings)
19 years	Nonspecific syndromic phenotype	Conventional karyotyping (normal)
19 years	Suspicion of genetic etiology	Whole-exome sequencing
19 years	NIPBL start-codon variant identified	American College of Medical Genetics and Genomics (ACMG)-based variant interpretation
19 years	De novo status confirmed	Sanger sequencing and segregation analysis

Diagnostic evaluations

Comprehensive clinical evaluation and genetic counseling were conducted, and a three-generation pedigree was constructed using Progeny software (Progeny Software, LLC) (Fig. 1A). Written informed consent was obtained from the proband’s legal guardian prior to sample collection. The study was approved by the Ethics Committee of Isfahan University of Medical Sciences, Isfahan, Iran (ethics code: IR.MUI.MED.REC.1400.042).

In this case, the diagnostic process was challenging owing to the absence of pathognomonic features that would immediately indicate a specific syndrome. The proband presented with nonspecific neurodevelopmental delays, borderline intellectual functioning, and facial dysmorphism, without hallmark features that would strongly suggest a single diagnosis.

To begin the evaluation, conventional karyotyping was performed to assess for chromosomal abnormalities, such as aneuploidies or structural rearrangements, which may underlie syndromic developmental disorders. The karyotype analysis returned normal results, effectively ruling out common chromosomal syndromes.

Given the complex phenotype and absence of a definitive diagnosis through routine cytogenetics, we proceeded with whole-exome sequencing (WES).

Whole-exome sequencing (WES) and variant prioritization were performed by 3billion, Inc. (Seoul, South Korea). Exome capture was carried out using the xGen Exome Research Panel version 2 (Integrated DNA Technologies, Coralville, IA, USA). Sequencing was performed on the NovaSeq 6000 platform (Illumina, San Diego, CA, USA), and sequence reads were aligned to the GRCh37/hg19 reference genome and the revised Cambridge Reference Sequence (rCRS) for mitochondrial DNA.

Variant filtering and analysis was conducted using the EVIDENCE software platform [14], and variant interpretation followed the guidelines of the American College of Medical Genetics and Genomics (ACMG) and the Association for Molecular Pathology (AMP) [15]. Only clinically relevant variants consistent with the patient’s phenotype were retained for further investigation.

Analysis identified a heterozygous variant in the NIPBL gene (NM_133433.4:c.2T>A; NP_597677.2:p.Met1Lys). This variant affects the highly conserved initiation codon, which is critical for the correct translation of the NIPBL protein, an essential regulator of the cohesin complex. This variant was absent from large population databases, including gnomAD (v2.1.1) and Iranome (http://www.iranome.ir/), underscoring its rarity. Its de novo status was confirmed by Sanger sequencing and co-segregation analysis, as neither parent carried the variant (Fig. 1B). Variant-specific primers were designed using Primer3 (version 4.1.0) and verified via Primer-BLAST [16], MFEprimer3.1 [17], and SNPCheck version 3 (Gene Tools). Primer sequences are listed in Table 2. Computational predictive tools such as VARITY (http://varity.varianteffect.org/) consistently indicated a pathogenic effect, with the loss of the canonical start codon.

Table 2.

Primer sequences for Sanger sequencing

Sanger sequencing primers	NIPBL_ex2_F	CAGTGTTTGGGAAATGGGAAG
	NIPBL_ex2_R	ATACCTCCAACAAGCTCCAAC

Final classification of the variant was performed in accordance with ACMG criteria using the Varsome and Franklin platform Table 3.

Table 3.

Genomic and in silico result of identified variant

Gene	Genomic position	Variant type	HGVS	Protein change	Zygosity	ACMG	Varity
NIPBL	5-36953800-T-A (GRCh37)	Start loss	NM_133433.4:c.2T>A	NP_597677.2: p. (Met1Lys)	Heterozygous	Pathogenic (criteria: PP4, PM2, PS2, PP3)	Pathogenic

Discussion

Cornelia de Lange syndrome (CdLS; MIM no. 122470) is a rare multisystem developmental disorder primarily caused by mutations in genes encoding cohesin complex components, with NIPBL being the most frequently affected gene [18–20]. The present study reports a de novo heterozygous variant in the initiation codon of NIPBL (c.2T > A; p.Met1Lys) identified in a 19-year-old Iranian male individual with clinical features consistent with CdLS. Variants affecting the translation initiation codon are uncommon and may result in variable phenotypic severity. This variant has been previously reported by Krantz et al. [21] and supports the known pathogenicity of NIPBL start-loss variants.

So far, more than 500 pathogenic or likely pathogenic variants in NIPBL gene have been registered in ClinVar [22]. In this report, we reported start-loss codon variant in this gene, which occurred in a de novo state in an Iranian patient. Although mutations affecting the canonical start codon are relatively rare, they have been reported to result in variable phenotypic severity. The start-loss variant identified in the patient (NIPBL: c.2T>A; p.Met1Lys) abolishes the canonical translation initiation codon, raising concerns about disrupted protein expression. However, alternative mechanisms such as re-initiation at downstream in-frame ATG codons may allow for partial translation recovery, depending on their Kozak context and positional relevance [23, 24]. Using ATGpr online tool [25], we identified four in-frame alternative ATG codons located downstream of the canonical start codon at the NIPBL transcript (NM_133433.4). These four ATG codons, including the 16th, 50th, 36th, and 185th codon from the 5′ end, with the 50th, 36th, and 185th related to very truncated proteins, are inconsistent with a mild effect on protein function; however, the 16th ATG codon is most likely suspected as an alternative start codon, with a reliability score of 0.28 and a Kozak sequence of tXXATGc (Table 4). Although this has a moderate-strength Kozak context, studies suggest that even suboptimal Kozak sequences can initiate translation, especially in transcripts with disrupted primary start sites [24, 26]. Initiation at this 16th ATG, located in exon 6 of 47, would produce a truncated NIPBL protein of 2618 amino acids, missing approximately the first 186 amino acids from the N-terminal (first five exons and nearly half of exon 6 are missed). This N-terminal region is functionally important, encompassing interaction motifs such as the MAU2-binding domain, which is essential for loading the cohesin complex onto chromatin [26, 27]. The loss of this domain is expected to partially impair NIPBL’s function in sister chromatid cohesion and transcriptional regulation. However, the preservation of the C-terminal HEAT-repeat domain, necessary for DNA binding and chromatin regulation, suggests that a partially functional protein may still be expressed. This could explain the mild Cornelia de Lange syndrome phenotype observed in the patient. Similar mechanisms have been reported in other genetic disorders, where translation from alternative downstream ATGs results in expression of truncated but hypomorphic proteins that retain partial function [12]. Taken together, while the 16th ATG is not ideally positioned or strongly favored, its in-frame nature, moderately permissive Kozak context, and ability to produce a nearly full-length protein provide a plausible explanation for residual NIPBL activity. This supports the hypothesis that leaky scanning or re-initiation may mitigate the impact of this start-loss mutation and contribute to a milder clinical phenotype.

Table 4.

ATGpr tool analysis results for in-frame start codon in NIPBL gene

No. of ATG codon from 5′ end	Reliability	Frame	Actual nucleotide sequences flanking each ATG	Start (base pairs [bp])	Finish (bp)	Open reading frame (ORF) length (amino acids [aa])	Stop codon found?
1	0.33	1	tXXATGa	1	8412	2804	Yes
16	0.28	1	tXXATGc	559	8412	2618	Yes
50	0.28	2	AXXATGa	2021	2377	119	Yes
36	0.23	2	tXXATGc	1244	1438	65	Yes
185	0.23	1	GXXATGa	7567	8412	282	Yes

Consistent with this, in the study by Krantz et al. [21], a family was reported in which three siblings carrying a start codon mutation in NIPBL exhibited moderate developmental delay, typical facial dysmorphism, hirsutism, and small hands without limb reduction defects. These features are notably similar to those observed in the current study’s proband, who also showed global developmental delay, hirsutism, bilateral ptosis, and characteristic facial features but lacked major limb or organ malformations. Importantly, the Krantz study supports the concept that start codon mutations may not uniformly result in severe CdLS phenotypes [21]. This phenotypic variability may be explained by alternative translation initiation mechanisms, potentially allowing for partial NIPBL protein function. In silico findings in the current study, which identified a downstream in-frame ATG codon, support this hypothesis and provide a plausible mechanistic link between the start codon loss and the milder clinical presentation in the case. Such genotype–phenotype correlations emphasize the complexity of NIPBL-related disorders and suggest that mutations affecting the start codon may contribute to a spectrum of clinical outcomes, warranting further functional studies to elucidate the precise effects on protein expression and cohesin complex integrity.

This case also emphasizes the utility of whole-exome sequencing combined with confirmatory Sanger sequencing and co-segregation analysis in identifying causative mutations in genetically heterogeneous disorders such as CdLS. In silico tools provided additional evidence supporting the deleterious impact of the variant, illustrating the importance of integrated bioinformatics approaches in variant interpretation.

Clinically, early molecular diagnosis facilitates precise genetic counseling and informs management strategies. Patients with CdLS require multidisciplinary care to monitor and address developmental, endocrine, ophthalmologic, and behavioral complications. Identification of pathogenic variants also opens avenues for future research into targeted therapies aimed at ameliorating the effects of cohesin dysfunction.

Despite these advances, limitations remain, including incomplete understanding of genotype–phenotype correlations and the potential influence of modifier genes and environmental factors. Further functional studies of start codon variants and broader analyses will be valuable to delineate the full spectrum of NIPBL-related phenotypes.

A key limitation of this study is that the proposed use of an alternative downstream ATG codon as a mechanism for residual NIPBL function is based solely on computational predictions using ATGpr. No in vitro or in vivo functional validation (for example, protein expression analysis, western blotting, or reporter assays) was performed to confirm the translation from this alternative site. Therefore, while the presence of an in-frame ATG codon with a moderately favorable Kozak consensus sequence provides a plausible explanation for the mild phenotype, this remains a speculative but biologically reasonable hypothesis that warrants future experimental investigation.

Conclusion

We report a de novo heterozygous start codon variant in NIPBL associated with classical Cornelia de Lange syndrome in an Iranian patient. This finding broadens the mutational spectrum of NIPBL and reinforces the critical role of this gene in neurodevelopment and cohesin function. The observed phenotype suggests that start codon mutations may result in milder clinical manifestations compared with other loss-of-function variants, underscoring the importance of detailed genotype–phenotype correlation. The study highlights the effectiveness of whole-exome sequencing for definitive diagnosis in complex neurodevelopmental disorders and underscores the necessity of comprehensive genetic and clinical evaluation for optimal patient care. Early genetic diagnosis is pivotal for tailored counseling and management, ultimately improving outcomes for individuals affected by CdLS.

Abbreviations

CdLS

Cornelia de Lange syndrome

SMC3

Structural maintenance of chromosomes 3

SMC1A

Structural maintenance of chromosomes 1A

NIPBL

Nipped-B-like

HDAC8

Histone deacetylase 8

RAD21

RAD21 cohesin complex component

AD

Autosomal dominant

XLD

X-linked dominant

WES

Whole-exome sequencing

ACMG

American College of Medical Genetics and Genomics

AMP

Association for Molecular Pathology

Author contributions

AM: recruitment of patients and family members, exome data analysis, mutation screening, performance of molecular experiments and segregation analysis in families using Sanger sequencing, and review and editing of the first draft of the manuscript; ZA: writing of the first draft of the manuscript and performance of molecular experiments; YS and HL: performance of WES and data analysis; AKh: patient identification and provision of clinical data; MJ, SH, and ShKh: performance of molecular experiments; M-AT: design and supervision of the research.

Funding

This study was funded by the Medical University of Isfahan, Isfahan, Iran (grant no. 3991102), and conducted in research collaboration with 3billion Inc., Seoul, South Korea.

Data availability

All data generated or analyzed during this study are included in this published article, and the raw data that support the findings of this study are available from the corresponding author upon reasonable request. In addition, the datasets generated and/or analyzed during the current study are available in the ClinVar repository with submission accession no. SCV002573183.

Declarations

Ethics approval and consent to participate

The research was approved by the Ethics Committee of the Medical University of Isfahan (ethics code: IR.MUI.MED.REC.1400.042).

Consent for publication

Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.

Competing interests

The authors declare that they have no conflicts of interest.