Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2026 Jun 22;16:19384. doi: 10.1038/s41598-026-57335-2

Biofilm formation and antimicrobial resistance of Pseudomonas aeruginosa in cheese production systems

Noura K Ahmed 1,✉, Dalia Hamza 2, Shimaa S Awaad 1, Ayah B Abdel-Salam 1,3, Said S Sallam 1
PMCID: PMC13287804  PMID: 42331894

Abstract

The emergence of drug-resistant Pseudomonas aeruginosa is an increasing global concern affecting human and animal health, food production systems, and environmental safety. This study investigated its occurrence, antimicrobial resistance, and biofilm-forming ability using phenotypic assays, and identify the biofilm-associated genetic markers in 120 cheese samples including 30 samples each of (Kariesh, Tallaga, Processed, and Romy) collected from various retail sources in Cairo and Giza, Egypt. Pseudomonas aeruginosa isolates were identified using both biochemical tests and molecular confirmation using 16 S rRNA gene. Antimicrobial susceptibility was evaluated using the disk diffusion method. Biofilm formation was assessed phenotypically through the microtiter plate and tube assays, while the biofilm-associated genes pelA and pslA were detected using PCR. Pseudomonas aeruginosa was detected in 18 samples (15%), and identification was confirmed through biochemical and molecular methods. Antimicrobial susceptibility testing revealed that 55% of isolates were extensively drug-resistant, while 45% exhibited multidrug resistance, with MAR indices ≥ 0.2 and an average MAR index of 0.68, indicating exposure to high-risk environments with frequent antibiotic use. Phenotypic assays showed strong biofilm-forming capabilities among isolates, with 100% positive by microtiter plate and 95% by tube method. Molecular screening further confirmed the prevalence of biofilm-associated genes, detecting pelA in 72% and pslA in 61% of isolates. Overall, Pseudomonas aeruginosa isolated from cheese samples exhibited substantial antimicrobial resistance and robust biofilm-forming ability, posing significant concerns to cheese quality and consumer health. These findings highlight the urgent need for continuous surveillance, improved dairy hygiene, effective sanitation, responsible antimicrobial practices, and alternative control strategies within the dairy sector to reduce potential public health hazards.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-57335-2.

Keywords: Cheese, Pseudomonas aeruginosa, Multidrug resistance, Multiple antibiotic resistance, Biofilm, Food safety, Dairy contamination

Subject terms: Microbiology, Molecular biology

Introduction

Food spoilage represents a major challenge for the dairy industry, particularly in developing countries where inadequate processing, poor hygiene, and limited refrigeration are common. Microbial contamination leads to sensory deterioration, reduced product quality, reputational damage, and substantial economic losses for dairy producers1.

Pseudomonas spp. are major contributors to dairy spoilage due to their psychrotrophic nature and ability to grow at refrigeration temperatures. Although pasteurization effectively eliminates these bacteria, post-pasteurization contamination remains a concern because of environmental sources and inadequate sanitation practices2.

Pseudomonas aeruginosa is of particular concern in the dairy industry due to its metabolic versatility and ability to grow at refrigeration temperatures, facilitating its persistence along the food chain3,4. It is a major spoilage organism because of its production of thermoresistant lipolytic and proteolytic enzymes that degrade κ-, α-, and β-caseins, leading to sensory defects, reduced yield, and shortened shelf life of dairy products. Beyond spoilage, its strong biofilm-forming ability and antimicrobial resistance raise concerns regarding food quality, consumer safety, and public health, particularly because of the potential transmission of resistant strains through the food chain5,6.

Pseudomonas aeruginosa is a highly adaptable opportunistic pathogen and a prominent Gram-negative ESKAPE bacterium that poses a major clinical and public health challenge due to its extensive intrinsic, acquired, and adaptive resistance mechanisms4,5. These mechanisms facilitate persistence, dissemination, therapeutic failure, and rapid acquisition of resistance to multiple antimicrobial classes through antibiotic inactivation, target modification, reduced drug accumulation, chromosomal mutations, horizontal gene transfer, and biofilm formation7–10.

Antimicrobial resistance (AMR) has emerged as a critical global concern affecting human and animal health, food production systems, and environmental safety11. The widespread use of antibiotics in animal production has further accelerated the emergence and dissemination of resistant P. aeruginosa strains, increasing risks to both animal and public health12. High-risk multidrug-resistant (MDR) strains are now globally distributed and continue to pose substantial treatment and infection-control challenges9,10.

Multidrug-resistant P. aeruginosa is associated with significant morbidity, mortality, and healthcare costs worldwide. In the United States, the Centers for Disease Control and Prevention (CDC) reports more than 2.8 million antimicrobial-resistant infections and over 35,000 associated deaths annually13. Over the past decade, the CDC has consistently classified MDR P. aeruginosa as a serious public health threat, estimating approximately 32,600 infections, 2,700 associated deaths, and nearly US$767 million in annual healthcare costs5,14,15. Some MDR strains have acquired resistance to nearly all currently available antibiotics, severely limiting therapeutic options and complicating infection control efforts13.

The remarkable ability of MDR P. aeruginosa to survive under hostile environmental conditions further enhances its outbreak potential, particularly in healthcare settings where treatment failure and increased morbidity are common10. In epidemiological studies, the multiple antibiotic resistance (MAR) index is widely used as a rapid indicator of prior antimicrobial exposure and selective pressure within bacterial populations16.

In addition to antimicrobial resistance, biofilm formation is a key virulence trait of Pseudomonas aeruginosa. Biofilms are structured microbial communities embedded in an extracellular polymeric substance (EPS) matrix that promotes surface attachment and limits antibiotic penetration, thereby enhancing tolerance to antimicrobials and disinfectants14. Reduced metabolic activity within mature biofilms further diminishes antibiotic efficacy, contributing to persistent and recurrent infections17,18.

These biofilms act as persistent contamination reservoirs, promoting dairy spoilage and increasing food safety risks19,20. Clinically, biofilm formation is implicated in approximately 65% of healthcare-associated infections, highlighting its major public health relevance21.

Genetically, P. aeruginosa produces three principal exopolysaccharides—Pel, Psl, and alginate—that contribute to biofilm initiation, structural integrity, and protection against environmental stressors. The pelA gene encodes a cationic polysaccharide critical for biofilm establishment and maintenance, whereas pslA encodes a neutral exopolysaccharide involved in early surface attachment and intercellular aggregation22–24.

Biofilm formation markedly reduces the effectiveness of disinfectants commonly used in dairy farms, as the EPS matrix restricts disinfectant penetration and activity25. Disinfectants such as mercuric chloride, peracetic acid, and formaldehyde, although effective against planktonic cells, often show diminished efficacy against biofilm-embedded bacteria, necessitating higher concentrations and prolonged contact times to achieve comparable microbial inactivation17,26.

These findings highlight the growing challenge posed by multidrug-resistant Pseudomonas aeruginosa and underscore the need for coordinated global efforts, including strengthened surveillance, rational antibiotic use, and development of alternative antimicrobial strategies to limit the spread of resistance and protect public health in the post-antibiotic era13.

Therefore, the present study aims to investigate the prevalence of Pseudomonas aeruginosa in different cheese samples, with particular emphasis on the detection of multidrug-resistant strains and their biofilm-forming capabilities.

Materials and methods

The study was conducted from September 2024 to July 2025 in two distinct geographic regions at Cairo and Giza Governorates in Egypt.

Collection of samples

Initially, thirty dairy shops, supermarkets, and street vendors were selected for the collection of cheese samples located in Cairo and Giza Governorates, Egypt. A total of 120 cheese samples (500 g each) were randomly collected. The samples comprised 30 each of Kariesh, Tallaga, processed, and Romy cheeses. All samples were aseptically placed in sterile polyethylene bags, conveyed to the laboratory under refrigerated conditions (4 °C), and analyzed immediately upon arrival to minimize external contamination and microbial proliferation.

Isolation and identification of Pseudomonas aeruginosa

Isolation and identification of Pseudomonas aeruginosa were performed as previously described27,28. Briefly, 25 g of each cheese sample was homogenized in 225 mL trisodium citrate solution (HiMedia, India), serially diluted, and plated onto Penicillin–Pimaricin Pseudomonas Agar (PP) (HiMedia M1788, India) supplemented with penicillin and pimaricin (100,000 IU/L; HiMedia FD264, India) and pimaricin (0.01 g/L; HiMedia FD265, India). Plates were incubated at 25 ± 1 °C for 48 ± 2 h. Presumptive colonies were identified based on typical pigmentation and grape-like odor. From each positive sample, five colonies were subjected to standard biochemical tests including oxidase and catalase activities, gelatin and polysaccharide hydrolysis, starch hydrolysis, pigment production on tryptic soy agar, carbohydrate fermentation profiles, and the ability to grow at 42 °C described by Al-Daghistani et al.29., and one biochemically confirmed Pseudomonas aeruginosa isolate was selected for further characterization.

Molecular confirmation of Pseudomonas aeruginosa isolates

Genomic DNA extraction

DNA was extracted from the selected biochemically confirmed isolates by inoculating them into Tryptone Soy Broth (TSB; HiMedia M1876, India) and incubating the cultures overnight at 30 °C. A 1.5-ml aliquot of each culture was transferred to Eppendorf tubes and centrifuged for 5 min, after which the supernatant was discarded, and the resulting cell pellet resuspended in 200 µl of TE buffer. The suspension was heated at 95 °C for 10 min to lyse the cells, cooled on ice, and centrifuged again for 5 min. The resulting supernatant served as the DNA template for PCR. DNA concentration and purity were evaluated using a NanoDrop spectrophotometer, and the extracted DNA was stored at − 20 °C until further molecular analysis30,31.

PCR Identification

PCR amplification of the 16 S ribosomal ribonucleic acid gene was performed for molecular confirmation of Pseudomonas species and Pseudomonas aeruginosa using genus- and species-specific primers, following the protocol described by22. Molecular identification was validated using Pseudomonas aeruginosa (ATCC® 27853™) as a positive control. Primer specificity was further confirmed in silico using the National Center for Biotechnology Information Primer-BLAST tool, which demonstrated high sequence similarity to the Pseudomonas species reference genome (accession number OR435040.1) and the Pseudomonas aeruginosa reference genome (accession number NC_002516.2).

The primer sequences used in this study and the expected sizes of their PCR amplicons are presented in Table 1.

Table 1.

Primers sequences, target genes, amplicon sizes.

Bacteria Gene Primers sequences (5ʹ–3ʹ) Amplified
segment
(bp)
Annealing temperature Reference
Pseudomonas spp. 16 S rDNA

GACGGGTGAGTAATGCCTA

CACTGGTGTTCCTTCCTATA

618 bp 54 22,71
Pseudomonas aeruginosa 16 S rDNA

GGGGGATCTTCGGACCTCA

TCCTTAGAGTGCCCACCCG

956 bp 58
Biofilm genes pelA

CATACCTTCAGCCATCCGTTCTTC

CGCATTCGCCGCACTCAG

786 bp 60 22
pslA

TCCCTACCTCAGCAGCAAGC

TGTTGTAGCCGTAGCGTTTCTG

656 bp 60

Oligonucleotide and primer sequences specific for Pseudomonas aeruginosa investigated during the study.

Antimicrobial susceptibility testing of Pseudomonas aeruginosa

Antimicrobial susceptibility of biochemically and molecularly confirmed Pseudomonas aeruginosa isolates was determined using the Kirby–Bauer disk diffusion method in accordance with CLSI guidelines32, and their reported use in human and veterinary practice within the region33–35, with Pseudomonas aeruginosa ATCC® 27,853™ used as a quality control strain. Inhibition zones were measured and interpreted as susceptible (S), intermediate (I), or resistant (R). A total of nine antibiotics representing six antimicrobial classes were tested: aztreonam (30 µg), penicillin (10 µg), cefepime (30 µg), ceftazidime (30 µg), cefotaxime (30 µg), gentamicin (10 µg), ciprofloxacin (5 µg), levofloxacin (5 µg), and meropenem (10 µg).

Isolates that demonstrated resistance to at least one antimicrobial agent in three or more distinct antimicrobial classes were classified as multidrug-resistant (MDR) strains36.

Isolates that were resistant to all tested antibiotics except one or two antimicrobial agents across all evaluated classes (i.e., susceptible to no more than two antimicrobial groups) were classified as XDR (Extensively Drug-Resistant)5.

For each isolate, the MAR index was computed number of antibiotics to which the isolate is resistant / total number of antibiotics tested. MAR index values ≥ 0.2 were considered indicative of isolates originating from environments with frequent or excessive antibiotic use37,38.

Screening of biofilm formation capacity

Phenotypic detection of biofilm formation

Tube method (TM)

Biofilm formation was evaluated qualitatively using the tube method described by39. Briefly, the 18 biochemically and molecularly confirmed Pseudomonas aeruginosa isolates were inoculated into polystyrene tubes containing tryptic soy broth (TSB; HiMedia M1876, India) supplemented with 1% glucose and adjusted to a 0.5 McFarland standard. Tubes were incubated overnight at 37 °C, after which the broth was discarded, and the tubes were washed three times with PBS (pH 7.2). The inner surfaces were then stained with 0.1% crystal violet for 15 min, rinsed again with PBS, and air-dried in an inverted position. Tubes containing only TSB with 1% glucose served as the negative control. Biofilm formation was deemed positive when a visible film adhered to the wall and bottom of the tube, and the intensity of staining was scored as weak (+), moderate (++), or strong (+++). All assays were performed in triplicate and repeated three times.

Microtiter plate assay (MTP)

Biofilm formation was quantified using the microtiter plate method described by40. Overnight Pseudomonas aeruginosa cultures grown in TSB at 37 °C were adjusted to a 0.5 McFarland standard, after which 20 µL of each culture was inoculated into 180 µL of fresh TSB in 96-well polystyrene microplates and incubated statically at 37 °C for 24 h. After incubation, wells were gently washed three times with 250 µL PBS to remove non-adherent cells, fixed with 200 µL methanol for 15 min, air-dried, and stained with 200 µL of 0.1% crystal violet. Following rinsing and drying, the bound dye was solubilized with 200 µL of 30% acetic acid, and absorbance was measured at 570 nm using an enzyme-linked immunosorbent assay (ELISA) microplate reader (BioTek, Model ELx800, Model ELx800, Srl, ItalyWinooski, Vermont, USA). Uninoculated TSB served as the negative control. For each isolate, the mean optical density (ODi) from three replicates was compared with the cut-off OD (ODc), defined as the mean negative control OD. Isolates were classified as non-adherent (ODi ≤ ODc), weakly adherent (ODc < ODi ≤ 2 × ODc), moderately adherent (2 × ODc < ODi ≤ 4 × ODc), or strongly adherent (ODi > 4 × ODc). The positive reference strain for biofilm formation was Pseudomonas aeruginosa ATCC® 27,853™.

Molecular detection of biofilm-associated genes

PCR assays were performed to identify biofilm-associated genes (pelA and pslA) in all biochemical confirmed Pseudomonas aeruginosa isolates using previously extracted genomic DNA, following the protocol described by22. PCR reactions were carried out in a final volume of 25 µL, comprising 3 µL of template DNA, 12.5 µL of EmeraldAmp MAX PCR Master Mix (Takara, Japan), 0.5 µL of each primer (10 pmol/µL; Metabion, Germany), and PCR-grade water.

Thermal cycling was performed under the following conditions: an initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 1 min, annealing at 60 °C for 1 min, and extension at 72 °C for 1 min, with a final extension at 72 °C for 5 min.

Each PCR run included a positive control and a negative control (nuclease-free water). The amplified products were resolved by electrophoresis on 1.5% agarose gels (Vivantis, Malaysia), stained, and visualized using a UV transilluminator. A 100-bp DNA ladder (Jena Bioscience GmbH, Germany) served as a molecular size marker for estimating amplicon lengths.

The primer sequences used in this study and the expected sizes of their PCR amplicons are presented in Table 1.

Statistical analysis

Categorical variables were expressed as percentages with 95% confidence intervals and analyzed using Chi-square and Fisher’s exact tests as appropriate. Non-normally distributed continuous variables were compared using the Kruskal–Wallis test, correlations were assessed using Spearman’s rank coefficient, and agreement between biofilm measures and gene presence was evaluated using Cohen’s kappa. A p-value < 0.05 was considered statistically significant. All statistical analyses were performed using SPSS version 27.0 (IBM Corp., Armonk, NY, USA).

Results

Occurrence of Pseudomonas aeruginosa in examined cheese samples

Out of the 120 examined cheese samples, Pseudomonas spp. were isolated from 90 samples (75%). Biochemical identification of the presumptive isolates revealed that 18 samples (15%) were positive for Pseudomonas aeruginosa, 24 samples (20%) for Pseudomonas fluorescens, and 48 samples (40%) for Pseudomonas putida. The prevalence of Pseudomonas aeruginosa varied among cheese types, with an overall prevalence of 15% (95% CI: 9.6–22.8%). The highest occurrence was detected in Tallaga cheese (7/30; 23.3%), followed by processed cheese (5/30; 16.7%), Kariesh cheese (4/30; 13.3%), and Romy cheese (2/30; 6.7%). Presumptive Pseudomonas aeruginosa colonies exhibiting typical morphology on selective media were further confirmed by PCR targeting the 16 S rRNA gene. Accordingly, all eighteen isolates were definitively identified as Pseudomonas aeruginosa based on 16 S rDNA sequencing.

Antimicrobial resistance patterns of Pseudomonas aeruginosa isolates

Antimicrobial susceptibility testing was conducted through the standard disc diffusion method revealed that all molecularly confirmed Pseudomonas aeruginosa isolates showed resistance to one or more of the tested antimicrobial agents. Notably, 100% of the isolates were resistant to penicillin (P, 10 µg), cefepime (CPM, 30 µg), ceftazidime (CAZ, 30 µg), and cefotaxime (CTX, 30 µg). In contrast, levofloxacin (LEV, 5 µg) demonstrated the highest antimicrobial activity, with 55% of isolates showing susceptibility. Lower susceptibility rates were observed for ciprofloxacin (CIP, 5 µg) and gentamicin (CN, 10 µg), with susceptibility percentages of 17% and 11%, respectively. Detailed susceptibility patterns for the remaining antimicrobials are presented in Fig. 1.

Fig. 1.

Fig. 1

Phenotypic antimicrobial resistance patterns of Pseudomonas aeruginosa (n = 18) isolated from cheese samples. Resistance and sensitivity profiles of Pseudomonas aeruginosa isolates (n = 18) determined by Kirby-Bauer disc diffusion method using antibiotics from different classes to assess percentage of antimicrobial resistance patterns.

A total of 45% of the isolates were classified as MDR strains because they exhibited resistance to at least three classes of antibiotics. Since 55% showed no resistance to at least two classes of antibiotics, they were classified as extensively drug-resistant (XDR).

The distribution of antibiotic resistance profiles is summarized in Table 2. Of the 18 molecularly confirmed Pseudomonas aeruginosa isolates, 8 isolates (45%) were identified as multidrug-resistant (MDR), demonstrating resistance to at least one antimicrobial agent in three or more antimicrobial classes and 10 isolates (55%) were identified as extensively drug resistant (XDR), that resist all tested antimicrobial agents except one or two from all the classes evaluated. Furthermore, all isolates (100%) had a MAR index ≥ 0.2, with values ranging from 0.66 to 0.88 and a mean MAR index of 0.68, suggesting exposure to high-risk environments characterized by intensive or recurrent antibiotic use.

Table 2.

Antibiotic resistance profiles, MAR Index, and MDR of Pseudomonas aeruginosa (n = 18) isolated from cheese samples.

Isolates Cheese type Antimicrobial resistance phenotype® No. of resistant antibiotics MAR Index MDR
1 Processed AT, P, CPM, CAZ, CTX, MRP 6 0.66 +
2 Kariesh AT, P, CPM, CAZ, CTX, MRP 6 0.66 +
3 Kariesh P, CPM, CAZ, CTX, MRP, CN 6 0.66 +
4 Tallaga AT, P, CPM, CAZ, CTX, MRP 6 0.66 +
5 Tallaga AT, P, CPM, CAZ, CTX, MRP 6 0.66 +
6 Tallaga AT, P, CPM, CAZ, CTX, MRP 6 0.66 +
7 Processed AT, P, CPM, CAZ, CTX, CN 6 0.66 +
8 Processed AT, P, CPM, CAZ, CTX, MRP 6 0.66 +
9 Kariesh AT, P, CPM, CAZ, CTX, MRP, CN 7 0.77 +
10 Tallaga AT, P, CPM, CAZ, CTX, MRP, CN 7 0.77 +
11 Tallaga AT, P, CPM, CAZ, CTX, MRP, CN 7 0.77 +
12 Tallaga AT, P, CPM, CAZ, CTX, MRP, CN 7 0.77 +
13 Processed AT, P, CPM, CAZ, CTX, MRP, CN 7 0.77 +
14 Romy AT, P, CPM, CAZ, CTX, MRP, CN 7 0.77 +
15 Romy AT, P, CPM, CAZ, CTX, MRP, CN 7 0.77 +
16 Kariesh AT, P, CPM, CAZ, CTX, MRP, CIP, CN 8 0.88 +
17 Tallaga AT, P, CPM, CAZ, CTX, MRP, CIP, CN 8 0.88 +
18 Processed AT, P, CPM, CAZ, CTX, MRP, CIP, CN 8 0.88 +

*MAR index = No of antibiotics to which the isolate is resistant / total No of antibiotics tested.

MDR= Multidrug resistant.

Phenotypic and genotypic biofilm profiles of Pseudomonas aeruginosa isolates

Biofilm-forming capacity of Pseudomonas aeruginosa isolates was assessed through two phenotypic assays: the microtiter plate (MTP) assay, considered the gold standard, and the tube method (TM).

Using the MTP assay, all 18 isolates (100%) were identified as biofilm producers at varying levels. Specifically, 38.8% of the isolates were classified as weak biofilm producers, 44.4% demonstrated moderate biofilm producers, and 16.6% exhibited strong biofilm producers (Fig. 2).

Fig. 2.

Fig. 2

Phenotypic biofilm formation profiles of Pseudomonas aeruginosa isolates (n = 18). Assessment of biofilm formation by two methods, showing isolates categorized as non-biofilm producers and biofilm producers classified into strong, moderate, and weak degrees.

In contrast, the tube method identified 94% of the isolates as biofilm producers. Among these, 33.3% were categorized as weak biofilm producers, 16.6% as moderate producers, and 44.4% as strong biofilm producers.

PCR analysis targeting the biofilm-associated genes (pelA and pslA) was conducted on isolates that were phenotypically confirmed as biofilm producers. The results revealed that 13 isolates (72%) tested positive for the pelA gene, while the remaining 5 isolates (28%) were negative. Regarding the pslA gene, 11 isolates (61%) tested positive, whereas 7 isolates (39%) were negative.

Statistical analysis

A Chi-square test showed no significant association was observed between cheese type and the occurrence of Pseudomonas aeruginosa (χ² = 3.71, p > 0.05). Although strong biofilm production was more frequent among XDR than MDR isolates, no significant association was found between resistance category and biofilm strength (χ² = 0.257, p = 0.879), a result supported by Fisher’s exact test (p = 0.33). MAR index values did not differ significantly across cheese types (H = 0.97, p = 0.81) using the Kruskal–Wallis test. Spearman analysis showed a strong positive correlation between MAR index and the number of antibiotics resisted (r = 0.91, p < 0.01), and moderate positive correlations between biofilm formation and both MAR index (r = 0.52, p < 0.05) and antibiotic resistance count (r = 0.54, p < 0.05). Cohen’s kappa indicated poor agreement between biofilm assessment methods (κ = −0.23) and between phenotypic biofilm intensity and the presence of pelA (κ = 0.018, p = 0.814) or pslA (κ = 0.085, p = 0.280), suggesting that gene presence alone does not reliably predict biofilm-forming intensity.

Cluster analysis of phenotypic biofilm formation, genotypic biofilm characteristics, and antimicrobial resistance profiles

Hierarchical cluster analysis (Fig. 3) grouped the 18 Pseudomonas aeruginosa isolates into two main groups (G1 and G2) based on biofilm-associated gene presence, phenotypic biofilm profiles, and resistance to nine antimicrobial agents. The upper section of the heatmap (C1–C3) represents the distribution of biofilm genes, biofilm phenotypic patterns, and antimicrobial resistance patterns, respectively.

Fig. 3.

Fig. 3

Heatmap of Pseudomonas aeruginosa strains clustered according to phenotypes of antimicrobial resistance (disc diffusion test) and both biofilm phenotypic methods and biofilm genes. Phenotype is represented as resistant/ strong (dark purple), intermediate/ moderate (pale pink), and sensitive/ weak (grey). Biofilm genotype is indicated as present (dark purple) and absent (grey). Each row represents an isolate, coded as P (Pseudomonas aeruginosa).

Isolates P.2 and P.14 clustered closely, sharing identical biofilm gene profiles (pelA and pslA) and similar resistance patterns, although P.14 was resistant to one additional antibiotic. The MDR isolates P.1 and P.6 showed identical genotypic and phenotypic characteristics, including biofilm gene carriage, biofilm phenotype, and resistance profile. Similarly, the XDR isolates P.12 and P.18 clustered together with identical biofilm gene profiles and extensive resistance patterns, with P.18 exhibiting resistance to one additional antibiotic. Isolate P.17 clustered closely with P.18, sharing the same biofilm gene profile and comparable antimicrobial resistance characteristics (Fig. 3).

Table 3.

Biofilm phenotype and pathotype of Pseudomonas aeruginosa (n = 18) isolated from cheese samples.

Isolates Biofilm phenotype® Biofilm genes
MTP TM pelA pslA
1 ++ +++ + -
2 ++ + - -
3 + +++ - -
4 +++ + - -
5 + +++ + +
6 ++ +++ + -
7 + +++ + +
8 + +++ - -
9 + ++ + +
10 ++ + + +
11 + + + +
12 +++ +++ + +
13 + +++ + +
14 ++ + - -
15 ++ + + +
16 + ++ + +
17 ++ +++ + +
18 +++ ++ + +

TM = Tube method.

MTP = Microtiter plate method.

Discussion

Dairy products, particularly cheese, are highly susceptible to contamination by spoilage microorganisms such as Pseudomonas aeruginosa, which may enter milk and milk-based products as a result of inadequate production practices, processing failures, or unhygienic handling conditions41. The detection of P. aeruginosa in dairy products is widely regarded as a strong indicator of poor hygienic status, as it often reflects ineffective sanitation procedures, substandard water quality, or post-processing contamination within the dairy production environment42.

The present study revealed a notable occurrence of Pseudomonas aeruginosa across the examined cheese samples, likely influenced by storage-related factors such as temperature, duration, and environmental conditions that support bacterial survival and growth43. In addition, its high metabolic versatility, environmental adaptability, and ability to grow at refrigeration temperatures enhance its persistence in dairy environments6,44. Although no significant differences were observed among cheese types, the presence of P. aeruginosa in all varieties suggests that contamination is more closely related to hygiene, handling, or processing practices than to cheese-specific characteristics.

The higher prevalence observed in fresh cheeses such as Tallaga and Kariesh may reflect their higher moisture content, lower salt levels, and lack of prolonged ripening, which favor bacterial survival and growth. In contrast, the lower prevalence in Romy cheese is likely associated with its longer ripening period, reduced water activity, and higher salt content, creating less favorable conditions for microbial persistence45,46. Similar prevalence patterns have been reported by Atia et al. and Aziz et al.6,25. These findings further support the ability of P. aeruginosa to persist in dairy processing environments.

Additionally, the use of raw milk and refrigerated storage prior to heat treatment may enhance survival and dissemination along the dairy production chain. Lower prevalence rates were reported by Deiab et al., who analyzed bulk tank milk and dairy products from Menofia Governorate, Egypt, and by Salem et al., who examined mastitis milk samples from dairy farms in Dakahlia Governorate, Egypt47,48. In contrast, higher contamination levels were observed by Elgharabawy et al. in Kariesh cheese from El Beheira Governorate and by Gamal et al. in various dairy products collected from markets and farms in Dakahlia Governorate, Egypt28,49.

Pseudomonas aeruginosa and other spoilage or pathogenic bacteria may be transmitted to consumers through fresh dairy products, particularly when hygiene during processing and handling is inadequate. The risk is greater for ready-to-eat cheeses, especially those produced from raw milk, where low acidity and salt content favor bacterial survival. Variations in contamination likely reflect differences in hygiene and processing conditions across dairy environments. Molecular analysis based on 16 S rRNA gene detection identified all isolates as P. aeruginosa, consistent with previous reports28,48,50, although the limited discriminatory power of this marker within the Pseudomonas genus should be acknowledged.

All Pseudomonas aeruginosa isolates exhibited resistance to penicillin and cefotaxime, consistent with the organism’s intrinsic resistance and the limited activity of these agents51. The extensive use of β-lactam antibiotics has contributed to the emergence of β-lactam-resistant P. aeruginosa, increasing both clinical risk and economic burden52. Complete resistance to the antipseudomonal cephalosporins ceftazidime and cefepime was observed and is likely associated with AmpC β-lactamase hyperproduction and efflux pump upregulation. While basal AmpC expression is typically insufficient to confer resistance, the pattern detected here suggests inducible AmpC activity, also known as Pseudomonas-derived cephalosporinase (PDC)53,54.

In high-risk epidemic clones, mutation-driven and horizontally acquired β-lactam resistance mechanisms may coexist, leading to difficult-to-treat resistance (DTR) phenotypes54. The resistance profiles observed in this study are consistent with advanced mechanisms, including enhanced β-lactamase activity, efflux overexpression, and biofilm-associated tolerance, commonly linked to multidrug resistance and prolonged β-lactam exposure55. The lack of molecular characterization (e.g., detection of resistance genes or efflux regulators) represents a limitation, as genotype–phenotype integration is essential to elucidate underlying resistance determinants. These findings align with reports by Salem et al. on mastitis milk isolates in Egypt48. In contrast, lower resistance rates to ceftazidime, cefepime, and meropenem were reported by Gamal et al.49, likely reflecting differences in antimicrobial usage and selective pressure across study settings.

All isolates recovered in this study were classified as extensively drug-resistant (XDR) or multidrug-resistant (MDR). This pattern may reflect extensive antibiotic use in dairy farming and horizontal acquisition of resistance determinants, raising concerns about potential transmission to humans through contaminated cheese12,56. Higher MDR rates were reported by Salem et al.48, whereas lower rates were observed by Badawy et al.57, suggesting variability related to antibiotic stewardship and environmental exposure.

All Pseudomonas aeruginosa isolates exhibited MAR index values greater than 0.5, indicating origin from high-risk environments with frequent antibiotic use. Consistent with previous reports48, these findings support the utility of the MAR index as an indicator of antimicrobial pressure and suggest that dairy environments may serve as reservoirs for antibiotic-resistant bacteria58, despite lower MAR values reported in other studies by Gamal et al.49 and Ibrahim et al.12.

Phenotypic assays as shown in Table 3 showed that most Pseudomonas aeruginosa isolates were capable of biofilm formation at varying intensities, supporting their ability to adhere to surfaces and tolerate antimicrobial exposure. Lower proportions of biofilm-forming isolates were reported by Aziz et al. and Deiab et al.25,47, whereas comparable or higher prevalence was observed in other studies48,59. The association between biofilm-forming capacity and multidrug resistance underscores the clinical and environmental relevance of P. aeruginosa, as biofilms promote persistence under antimicrobial pressure.

Within biofilms, close cell-to-cell contact enhances horizontal gene transfer and promotes physiological states that reduce antimicrobial susceptibility60. Biofilm-associated resistance differs from planktonic resistance because the EPS matrix limits antibiotic penetration, while metabolic heterogeneity promotes tolerance through slow-growing and persister cells61,62. Biofilm growth is associated with altered gene expression, including efflux pump upregulation and stress response activation, coordinated by quorum sensing systems in P. aeruginosa. In dairy and food processing environments, biofilms on equipment surfaces act as persistent reservoirs of resistant bacteria, facilitating repeated contamination and linking biofilm formation to antimicrobial resistance and food safety concerns61,63.

Agreement analysis between the microtiter plate (MTP) and tube methods (TM) showed poor concordance, reflecting inherent methodological differences. The MTP assay provides a quantitative and more reproducible assessment of biofilm biomass, whereas the TM relies on subjective visual interpretation and is prone to variability. Similar weak agreement has been reported previously, indicating that these methods should not be used interchangeably for biofilm detection or grading64,65.

The relatively high detection rates of the biofilm-associated genes pelA and pslA highlight their importance in biofilm development in P. aeruginosa as shown in Table 3. The prevalence of pelA in this study was lower than that reported by Lutfi N. et al.66, who detected this gene in all P. aeruginosa isolates recovered from mastitic milk of lactating Dorper sheep in Malaysia and from dairy-associated and clinical sources in Egypt, but higher than that reported by El Shora et al.67, who investigated milk samples collected from different markets in Egypt. Similarly, pslA prevalence was lower than that reported by El Shora et al.67 yet exceeded the rate documented by Elshazely et al.50 in raw milk and dairy products obtained from retail outlets and markets in Egypt. Variations among studies likely reflect differences in sample sources, methodological approaches, and genetic diversity among P. aeruginosa populations.

The presence of phenotypic biofilm formation in isolates lacking pelA and pslA highlights the multifactorial regulation of biofilm development in P. aeruginosa. Biofilm formation is not solely dependent on the pel and psl operons, as alternative determinants such as algD-mediated alginate production and quorum sensing systems (las and rhl) can independently or synergistically drive biofilm initiation and maturation68,69. This functional redundancy explains the weak agreement between phenotypic biofilm intensity and pelA or pslA carriage and indicates that gene presence alone is an unreliable predictor of biofilm-forming capacity, which is shaped by regulatory complexity, gene expression dynamics, and environmental factors61,70.

Conclusion

This study demonstrates the presence of Pseudomonas aeruginosa in different cheese types, which may reflect potential deficiencies in hygienic practices during milk handling, processing, and storage. The isolates exhibited notable antimicrobial resistance, including multidrug-resistant and extensively drug-resistant profiles, alongside strong biofilm-forming capacity, which could contribute to their persistence in dairy environments. These findings highlight dairy products may act as potential reservoirs of resistant P. aeruginosa and emphasize the importance of improved hygiene measures, prudent antimicrobial use, and continuous surveillance to ensure food safety within a One Health context.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 (1.2MB, docx)

Acknowledgements

The authors thank Dr. Hanan S. Khalefa, Dr. Meral Hakam and Dr. Toka A. Allam for helping with analysis.

Author contributions

**Noura Khalil Ahmed: ** Comprehensive analysis, Investigation, Visualization, and Writing and preparing the original draft.**Said S. Sallam: ** Conceptualization, Supervision and Writing – review & editing.**Ayah Badawi Abdel-Salam: ** Supervision, and Writing – review & editing.**Shimaa Salah Awaad: ** Supervision, and Manuscript review and editing.**Dalia Hamza: ** Formal analysis, Visualization, Editing and revising the draft.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Data availability

Datasets are available from the corresponding author upon reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Ethical approval

This study follows the ethics guidelines of the Faculty of Veterinary Medicine, Cairo University, Egypt (ethics approval number; Vet CU081020251260).

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Carminati, D. et al. Investigation on the presence of blue pigment-producing Pseudomonas strains along a production line of fresh mozzarella cheese. Food Control. 100, 321–328. 10.1016/j.foodcont.2019.02.009 (2019). [Google Scholar]
  • 2.Yuan, L., Sadiq, F. A., Burmølle, M., Wang, N. & He, G. Insights into psychrotrophic bacteria in raw milk: a review. J. Food Prot.82, 1148–1159. 10.4315/0362-028X.JFP-19-032 (2019). [DOI] [PubMed] [Google Scholar]
  • 3.Quintieri, L., Caputo, L., Brasca, M. & Fanelli, F. Recent advances in the mechanisms and regulation of QS in dairy spoilage by Pseudomonas spp. Foods10, 3088. 10.3390/foods10123088 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Meng, L. et al. Antibiotic resistance patterns of Pseudomonas spp. isolated from raw milk revealed by whole genome sequencing. Front. Microbiol.11, 518536. 10.3389/fmicb.2020.01005 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.De Moura Aguiar, B., De Longhi, R., Poli-Frederico, R. C. & Fagnani, R. Santana E.H.W. High spoilage potential and multidrug resistance of Pseudomonas aeruginosa strains isolated from sheep milk. Int. Dairy. J.167, 106280. 10.1017/S0022029919000645 (2025). De. [Google Scholar]
  • 6.Atia, R. M., Mohamed, H. A., AboELRoos, N. A. & Awad, D. A. B. Growth patterns of Pseudomonas aeruginosa in milk fortified with chitosan and selenium nanoparticles during refrigerated storage. World J. Microbiol. Biotechnol.39, 312. 10.1007/s11274-023-03757-3 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.El-Kady, R. A., Karoma, S. M. & Al Atrouni, A. L. Multidrug-resistant Gram-negative ESKAPE pathogens from a tertiary-care hospital: prevalence and risk factors. Egypt. J. Med. Microbiol.31, 135–142. 10.21608/EJMM.2022.256008 (2022). [Google Scholar]
  • 8.Venkateswaran, P. et al. Revisiting ESKAPE pathogens: virulence, resistance, and combating strategies focusing on quorum sensing. Front. Cell. Infect. Microbiol.13, 1159798. 10.3389/fcimb.2023.1159798 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Daruka, L. et al. ESKAPE pathogens rapidly develop resistance against antibiotics in development in vitro. Nat. Microbiol.10, 313–331. 10.1038/s41564-024-01891-8 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Saha, P., Kabir, R. B., Ahsan, C. R. & Yasmin, M. Multidrug resistance of Pseudomonas aeruginosa: do virulence properties impact resistance patterns? Front. Microbiol.16, 1508941. 10.3389/fmicb.2025.1508941 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Briega, I. et al. Evaluation of biofilm production and antibiotic resistance/susceptibility profiles of Pseudomonas spp. isolated from milk and dairy products. Foods14, 1105. 10.3390/foods14071105 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ibrahim, M. M. E., Elsaied, E. I., El Aal, S. F. A. A. & Bayoumi, M. A. Prevalence of Pseudomonas aeruginosa in milk and some dairy products with reduction trials by natural preservatives. J. Adv. Vet. Res.12, 434–438 (2022). https://www.advetresearch.com/index.php/AVR/article/view/1045 [Google Scholar]
  • 13.Yan, B. et al. Multidrug-resistant Pseudomonas aeruginosa infections: current status, challenges, and prospects of phage therapy. Front. Microbiol.16, 1723885. 10.3389/fmicb.2025.1723885 (2026). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Schwartz, B., Klamer, K., Zimmerman, J., Kale-Pradhan, P. B. & Bhargava, A. Multidrug-resistant Pseudomonas aeruginosa in clinical settings: a review of resistance mechanisms and treatment strategies. Pathogens13, 975. 10.3390/pathogens13110975 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kunz Coyne, A. J., El Ghali, A., Holger, D., Rebold, N. & Rybak, M. J. Therapeutic strategies for emerging multidrug-resistant Pseudomonas aeruginosa. Infect. Dis. Ther.11, 661–689. 10.1007/s40121-022-00591-2 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Mir, R., Salari, S., Najimi, M. & Rashki, A. Determination of frequency, multiple antibiotic resistance index and resistotype of Salmonella spp. in chicken meat collected from southeast of Iran. Vet. Med. Sci.8, 229. 10.1002/vms3.647 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Samandoulgou, I., Vimont, A., Fernandez, B., Fliss, I. & Jean, J. Murine norovirus interaction with Pseudomonas aeruginosa biofilm in a dynamic bioreactor. Food Environ. Virol.13, 485–492. 10.1007/s12560-021-09490-0 (2021). [DOI] [PubMed] [Google Scholar]
  • 18.Lianou, D. T. et al. Isolation of biofilm-forming staphylococci from bulk-tank milk of small ruminant farms in Greece. Foods12, 2836. 10.3390/foods12152836 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Desmousseaux, C. et al. Biofilm formation in dairy: a food safety concern—insights into the prevalence of Pseudomonadota and yeasts on milking system surface biofilms. J. Dairy. Sci.108, 8141–8156. 10.3168/jds.2024-25352 (2025). [DOI] [PubMed] [Google Scholar]
  • 20.Bezek, K., Avberšek, J., Zorman Rojs, O. & Barlič-Maganja, D. Antimicrobial and antibiofilm effect of commonly used disinfectants on Salmonella Infantis. Microorganisms11, 301. 10.3390/microorganisms11020301 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.AL-Kadmy, I. M. S. et al. Secrets of environmental Pseudomonas aeruginosa in slaughterhouses: antibiogram profile, virulence and antibiotic resistance genes. Folia Microbiol.69, 805–822. 10.1007/s12223-023-01116-1 (2023). [DOI] [PubMed] [Google Scholar]
  • 22.Elshafiee, E. A. et al. Biofilms and efflux pump regulatory gene (mexR) in multidrug-resistant Pseudomonas aeruginosa isolated from migratory birds. Vet. World. 15, 2425–2431. 10.14202/vetworld.2022.2425-2431 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Farhan, R. E., Solyman, S. M., Hanora, A. M. & Azab, M. M. Molecular detection of virulence factor genes among biofilm-forming clinical isolates of Pseudomonas aeruginosa. Cell. Mol. Biol.69, 32–39. 10.14715/cmb/2023.69.5.6 (2023). [DOI] [PubMed] [Google Scholar]
  • 24.Yaultsa, N., Wardhani, P. & Aryati, A. Relationship between gene pela and biofilm density in clinical isolates of Pseudomonas aeruginosa. Salud Cienc. Tecnol. 5, 1333. 10.56294/saludcyt20251333 (2025). [Google Scholar]
  • 25.Aziz, S. A. A. A., Mahmoud, R. & Mohamed M.B.E.D. Control of biofilm-producing Pseudomonas aeruginosa isolated from dairy farms using Virokill silver nano-based disinfectant. Sci. Rep.12, 9452. 10.1038/s41598-022-13619-x (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Okuno, N., Freire, I., Silva, C. & Marin, V. Pseudomonas aeruginosa and Pseudomonas spp. isolated from fresh Minas cheeses in Rio de Janeiro. Rev. Cienc. Vet. Saúde Pública. 8, 12–27. 10.4025/revcivet.v8i1.51027 (2021). [Google Scholar]
  • 27.ISO. 11059: Milk and milk products—enumeration of Pseudomonas spp. International Organization for Standardization. (2009).
  • 28.Elgharabawy, M., Nour, M., Soliman, S. & Abdella, S. Identification of Pseudomonas aeruginosa isolated from karish cheese by PCR technique. Al-Azhar J. Agric. Res.0, 1–8. 10.21608/ajar.2024.217109.1171 (2024). [Google Scholar]
  • 29.Al-Daghistani, H. I., Abu-Niaaj, L. F. & Zein, S. Accurate diagnosis of Pseudomonas aeruginosa is critical to mitigating development of antibiotic resistance. Antibiotics14, 509. 10.3390/antibiotics14050509 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ndi, O. L. & Barton, M. D. Resistance determinants of Pseudomonas species from aquaculture in Australia. J. Aquac Res. Dev.3, 1–6. 10.4172/2155-9546.1000119 (2012). [Google Scholar]
  • 31.Dimitrakopoulou, M. E., Stavrou, V., Kotsalou, C. & Vantarakis, A. Boiling extraction method vs commercial kits for bacterial DNA isolation from food samples. J. Food Sci. Nutr. Res.3, 1–10. 10.26502/jfsnr.2642-11000057 (2020). [Google Scholar]
  • 32.CLSI. Performance standards for antimicrobial susceptibility testing, M100. Clinical and Laboratory Standards Institute. (2024).
  • 33.El-Demerdash, A. S., Bakry, N. R., El-Demerdash, A. S. & Bakry, N. R. Evaluation of the synergistic effect of amikacin with cefotaxime against Pseudomonas aeruginosa and its Biofilm genes expression. Gene Expression Phenotypic Traits. 10.5772/INTECHOPEN.91146 (2020). doi:10.5772/INTECHOPEN.91146. [Google Scholar]
  • 34.Abid, E. & Alhasnawi, F. Isolation of Pseudomonas aeruginosa with cefotaxime resistant from nosocomial infected wounds. Eur. J. Med. Health Res.2, 245–252. 10.59324/ejmhr.2024.2(2).31 (2024). [Google Scholar]
  • 35.Bonyadi, P., Saleh, N. T., Dehghani, M., Yamini, M. & Amini, K. Prevalence of antibiotic resistance of Pseudomonas aeruginosa in cystic fibrosis infection: A systematic review and meta-analysis. Microb. Pathog. 165, 105461. 10.1016/j.micpath.2022.105461 (2022). [DOI] [PubMed] [Google Scholar]
  • 36.Magiorakos, A. P. et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect.18, 268–281. 10.1111/j.1469-0691.2011.03570.x (2012). [DOI] [PubMed] [Google Scholar]
  • 37.Afunwa, R. A. et al. Multiple antibiotic resistance index of Gram-negative bacteria from bird droppings in poultry farms. Open. J. Med. Microbiol.10, 171–181. 10.4236/ojmm.2020.104015 (2020). [Google Scholar]
  • 38.Mohammed, R. et al. Public health concern of antimicrobial resistance and virulence determinants in E. coli from oysters in Egypt. Sci. Rep.14, 26977. 10.1038/s41598-024-77519-y (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Harika, K., Shenoy, V., Narasimhaswamy, N. & Chawla, K. Detection of biofilm production and its impact on antibiotic resistance profile of bacterial isolates from chronic wound infections. J. Glob Infect. Dis.12, 129–134. 10.4103/jgid.jgid_150_19 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Stepanović, S. et al. Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS115, 891–899. 10.1111/j.1600-0463.2007.apm_630.x (2007). [DOI] [PubMed] [Google Scholar]
  • 41.Arslan, S., Eyi, A. & Özdemir, F. Spoilage potentials and antimicrobial resistance of Pseudomonas spp. isolated from cheeses. J. Dairy. Sci.94, 5851–5856. 10.3168/jds.2011-4676 (2011). [DOI] [PubMed] [Google Scholar]
  • 42.Hamza, D. & Zaher, H. M. Carriage of rifampicin- and multidrug-resistant Pseudomonas aeruginosa in apparently healthy camels: a view through a zoonosis lens. Microbiol. Res.16, 107. 10.3390/microbiolres16060107 (2025). [Google Scholar]
  • 43.Yagoub, S. O., Bellow, F. A. & El Zubeir, I. E. M. Effect of temperature and storage period on the constituents of milk inoculated with Pseudomonas aeruginosa. Res. J. Microbiol.3, 30–34. 10.3923/jm.2008.30.34 (2008). [Google Scholar]
  • 44.Li, X., Gu, N., Huang, T. Y., Zhong, F. & Peng, G. Pseudomonas aeruginosa: a typical biofilm forming pathogen and an emerging but underestimated pathogen in food processing. Front. Microbiol.13, 1114199. 10.3389/fmicb.2022.1114199 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Awad, S., Elsaadany, K. & Ibrahim, A. Chemical and microbial safety criteria for Egyptian Ras cheeses. Res. Square. 10.21203/rs.3.rs-4150198/v1 (2024). [Google Scholar]
  • 46.Awad, S. M. et al. Electrolyzed water as a microbial control measure for white soft cheese. Int. Dairy. J.167, 106260. 10.1016/j.idairyj.2025.106260 (2025). [Google Scholar]
  • 47.Deiab, R., El-Roos, A., Awad, A. & N. & Biofilm production by Pseudomonas species isolated from bulk tank milk and some milk products. Benha Vet. Med. J.45, 222–226. 10.21608/bvmj.2023.227369.1697 (2023). [Google Scholar]
  • 48.Salem, M., Awad, A. & Younis, G. Antibiotic susceptibility and molecular detection of virulent Pseudomonas aeruginosa isolated from bovine mastitis milk in Egypt. J. Adv. Vet. Res.13, 664–671 (2023). [Google Scholar]
  • 49.Gamal, H. et al. Virulence genes of multidrug resistant Pseudomonas species isolated from milk and some dairy products. J. Adv. Vet. Res.12, 415–421 (2022). [Google Scholar]
  • 50.Elshazely, R. M. Y., Amer, I. H., Abd-El Aal, S. F. A. & Tahoun, A. B. M. B. Antibacterial effect of Moringa oleifera on Staphylococcus aureus and Pseudomonas aeruginosa isolated from raw milk and dairy products with special reference to biofilm gene expression. Open. Vet. J.14, 164–175. 10.5455/ovj.2024.v14.i1.15 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Quintieri, L., Fanelli, F. & Caputo, L. Antibiotic resistant Pseudomonas spp. spoilers in fresh dairy products: an underestimated risk and control strategies. Foods8, 372. 10.3390/foods8090372 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Aubert, D. et al. Oxacillinase-mediated resistance to cefepime and susceptibility to ceftazidime in Pseudomonas aeruginosa. Antimicrob. Agents Chemother.45, 1615–1620. 10.1128/aac.45.6.1615-1620.2001 (2001). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Zhao, D. W. & Lohans, C. T. Combatting Pseudomonas aeruginosa with β-lactam antibiotics: a revived weapon? Antibiotics 14, 526 10.3390/antibiotics14050526 (2025). [DOI] [PMC free article] [PubMed]
  • 54.Oliver, A., Arca-Suárez, J., Gomis-Font, M. A., González-Pinto, L. & López-Causapé, C. Emerging resistance mechanisms to newer β-lactams in Pseudomonas aeruginosa. Clin. Microbiol. Infect.31, 1790–1796. 10.1016/j.cmi.2025.03.013 (2025). [DOI] [PubMed] [Google Scholar]
  • 55.Endimiani, A., Perez, F. & Bonomo, R. A. Cefepime: a reappraisal in an era of increasing antimicrobial resistance. Expert Rev. Anti Infect. Ther.6, 805–824. 10.1586/14787210.6.6.805 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Ombarak, R. A., Hinenoya, A., Elbagory, A. R. M. & Yamasaki, S. Prevalence and molecular characterization of antimicrobial resistance in Escherichia coli isolated from raw milk and raw milk cheese in Egypt. J. Food Prot.81, 226–232. 10.4315/0362-028x.jfp-17-277 (2018). [DOI] [PubMed] [Google Scholar]
  • 57.Badawy, B. et al. Prevalence of multidrug-resistant Pseudomonas aeruginosa isolated from dairy cattle, milk, environment, and workers’ hands. Microorganisms11, 2775. 10.3390/microorganisms11112775 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Isaiah, D. O., Otokunefor, K. & Agbagwa, O. E. Multiple antibiotic resistance indexing and molecular identification of Escherichia coli isolated from clinical and nonclinical sources in Port Harcourt Metropolis, Nigeria. Pan Afr. Med. J.51, 11. 10.11604/pamj.2025.51.11.38524 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Piazza, L. et al. Identification of biofilm-formation bacterial strains isolated from raw milk in Bentre Province, Vietnam. Chem. Eng. Trans.87, 607–612. 10.3303/cet2187102 (2021). [Google Scholar]
  • 60.El-Zamkan, M. A. & Mohamed, H. M. A. Antimicrobial resistance, virulence genes and biofilm formation in Enterococcus species isolated from milk of sheep and goat with subclinical mastitis. PloS1 (11), e0259584. 10.1371/journal.pone.0259584 (2021). 16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Fernández-Billón, M., Llambías-Cabot, A. E., Jordana-Lluch, E., Oliver, A. & Macià, M. D. Mechanisms of antibiotic resistance in Pseudomonas aeruginosa biofilms. Biofilm5, 100129. 10.1016/j.bioflm.2023.100129 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Patel, H., Buchad, H. & Gajjar, D. Pseudomonas aeruginosa persister cell formation upon antibiotic exposure in planktonic and biofilm state. Sci. Rep.12, 16151. 10.1038/s41598-022-20323-3 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Johnston, E. L. et al. Planktonic and biofilm-derived Pseudomonas aeruginosa outer membrane vesicles facilitate horizontal gene transfer of plasmid DNA. Microbiol. Spectr.11 (2), e0517922. 10.1128/spectrum.05179-22 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Saxena, S., Banerjee, G., Garg, R. & Singh, M. Comparative study of biofilm formation in Pseudomonas aeruginosa Isolates from patients of lower respiratory tract infection. J. Clin. Diagn. research: JCDR. 8 (5), DC09–DC11. 10.7860/JCDR/2014/7808.4330 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Allkja, J. et al. Interlaboratory study for the evaluation of three microtiter plate-based biofilm quantification methods. Sci. Rep.11, 13779. 10.1038/s41598-021-93115-w (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Lutfi, N. et al. Assessment of biofilm development and identification of biofilm-related genes in Pseudomonas aeruginosa strains isolated from mastitis-infected Dorper milk. Biosci. Res.17, 55–63 (2020). [Google Scholar]
  • 67.El-Shora, H. E. et al. Antibacterial and sensory impact of β-carotene and riboflavin on Pseudomonas biofilm in raw milk. World Vet. J.15, 811–823. 10.54203/scil.2025.wvj83 (2025). [Google Scholar]
  • 68.Gheorghita, A. A., Wozniak, D. J., Parsek, M. R. & Howell, P. L. Pseudomonas aeruginosa biofilm exopolysaccharides: assembly, function, and degradation. FEMS Microbiol. Rev.47 (6), fuad060. 10.1093/FEMSRE/FUAD060 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Elbehiry, A. et al. Understanding Pseudomonas aeruginosa biofilms: Quorum sensing, c-di-GMP signaling, and emerging antibiofilm approaches. Microorganisms14 (1), 109. 10.3390/microorganisms14010109 (2026). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Rather, M. A., Gupta, K. & Mandal, M. Microbial biofilm: formation, architecture, antibiotic resistance, and control strategies. Brazilian J. microbiology: [publication Brazilian Soc. Microbiology]. 52 (4), 1701–1718. 10.1007/s42770-021-00624-x (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Spilker, T., Coenye, T., Vandamme, P. & LiPuma, J. J. PCR-based assay for differentiation of Pseudomonas aeruginosa from other Pseudomonas species recovered from cystic fibrosis patients. J. Clin. Microbiol.42 (5), 2074–2079. 10.1128/JCM.42.5.2074-2079.2004 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (1.2MB, docx)

Data Availability Statement

Datasets are available from the corresponding author upon reasonable request.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES