Skip to main content
NCBI home page
MycoKeys logoLink to MycoKeys
. 2026 Jun 15;134:75–95. doi: 10.3897/mycokeys.134.196557

Three novel species of Asterina (Asterinales, Dothideomycetes) from Hainan Province, China

Yuzhe Feng 1,2,3, Chada Norphanphoun 1, Xiang-Yu Zeng 1,2,3,✉
PMCID: PMC13288034  PMID: 42344136

Abstract

Asterina comprises obligate biotrophic fungal pathogens that form black colonies on the surface of living leaves and derive nutrients by penetrating host epidermal cells, often resulting in tissue damage. In this study, three new species of Asterina from Hainan Province, China, are described based on morphological characteristics and multi-gene phylogenetic analyses (nrITS, nrLSU, and nrSSU), with phylogenetic relationships inferred by maximum likelihood (ML) and Bayesian inference (BI) to resolve their taxonomic placement. The new species Asterina breyniicola, A. heyneicola, and A. olaciphila were collected from living leaves of Breynia fruticosa, Heynea trijuga, and Olax scandens. Detailed morphological descriptions, illustrations, and a phylogenetic tree illustrating their positions are provided. These findings expand the known diversity of Asterina and provide integrated morphological and molecular evidence to improve species delimitation and classification within Asterinaceae.

Key words: Ascomycetes , black mildews, epifoliar fungi, phylogeny, taxonomy

Introduction

Asterina represents the type genus of the family Asterinaceae (Asterinales, Dothideomycetes). The genus was established by Léveillé (1845), with A. melastomatis (Theissen 1912) designated as the type species. It is the largest genus within Asterinaceae, comprising over 700 species (Hofmann 2010), and is mainly distributed in tropical and subtropical regions worldwide. Initially, Saccardo (1882) placed Asterina in Perisporiaceae (Perisporiales). However, the genus was broadly circumscribed due to morphological heterogeneity, including species with dimidiate and globose thyriothecia, and has long required taxonomic revision. The genus was first comprehensively monographed using type material of 343 described species, of which 261 were excluded as synonyms or reassigned to other genera (Theissen 1913). The remaining 82 species, together with additional newly described taxa, resulted in a revised circumscription of 108 species (Theissen 1913). Subsequently, Doidge (1919) provided detailed descriptions of spore germination, mycelium, thyriothecium, and conidial characteristics, placed Asterina in Microthyriaceae, and noted that previous uncertainties in host plant identification had led to confusion in species delimitation. Asterinaceae was established, and Asterina was transferred into this family, placing it in Hemisphaeriales (Hansford 1946).

Species of Asterina are obligately biotrophic epifoliar fungi occurring predominantly on the surface of living leaves and only rarely on living stems or other plant organs (Barr and Huhndorf 2001; Kirk et al. 2001; Taylor et al. 2005; Hofmann et al. 2010; Hyde et al. 2013). The term “obligate biotrophs” refers to a high dependency on host plants while causing minimal damage, requiring living plant cells for growth, and generally being unculturable on artificial media (Latijnhouwers et al. 2003; De Silva et al. 2016). These epifoliar fungi are comparatively understudied symbionts inhabiting the surfaces of living plants (Marasinghe et al. 2022b). They are commonly referred to as “black mildews,” forming web-like black colonies on leaf surfaces, and may cause economic damage to their hosts (Hongsanan et al. 2016; Marasinghe et al. 2022b; Marasinghe et al. 2023). Hosagoudar et al. (1997) reported that infection by A. congesta on sandalwood increased the production of cyclic compounds such as proline, indicating elevated stress levels in the host. They exhibit diverse infection strategies, including the formation of haustoria, hypostromata, inter- or intracellular hyphae, and appressoria. They can parasitize plants from more than 120 plant families, including herbs, trees, weeds, and economically important plants (Hofmann 2010; Hongsanan et al. 2014; Vishnu et al. 2017). Appressoria represent key structures for host penetration and nutrient acquisition in Asterina (Hofmann 2010; Chethana et al. 2021). Members of Asterina are characterized by dark brown, circular thyriothecia with stellate dehiscence; branched, dark brown, superficial mycelium with lateral appressoria; globose to subglobose, 8-spored, bitunicate asci; and dark brown ascospores with one septum and strongly constricted at the septum (Hongsanan et al. 2014). The asexual morph is referred to as Asterostomella, which is characterized by superficial, dark brown to brown, orbicular, pyriform pycnothyria and appressoriate superficial hyphae with brown, ovoid, aseptate conidia (Marasinghe et al. 2023). Most species in this genus are considered host-specific, at least at the host-family level (Hofmann and Piepenbring 2008), but this has not been confirmed with molecular data. In addition, they cannot be cultured on artificial media, and molecular data for these species are still scarce.

Species of Asterina have traditionally been described mainly based on their host association (Song et al. 2003a, 2003b; Song et al. 2004; Hofmann and Piepenbring 2008; Hosagoudar 2012). Morphological similarity among species remains high, and it is still unclear whether taxa are host species-, genus-, or family-specific. These patterns require confirmation using molecular data. At present, phylogenetic studies of Asterina remain limited. Hofmann et al. (2010) used sequence data from five species to provide the first phylogenetic analysis of Asterinaceae, supporting the family as a distinct lineage within Dothideomycetes and leading to its placement in Asterinales (Hofmann et al. 2010; Hyde et al. 2013; Boonmee et al. 2014; Wijayawardene et al. 2014). According to Index Fungorum (2026), there are 1130 taxa listed under Asterina, yet molecular data are available for only 16 species in NCBI. The high species number largely reflects historical reliance on host specificity for species delimitation. This assumption has not been rigorously tested using molecular data or inoculation experiments. Substantial work is therefore required to resolve species boundaries and phylogenetic relationships within the genus.

In this study, three new species isolated from living leaves of Breynia fruticosa, Heynea trijuga, and Olax scandens in Hainan Province, China, are introduced. Detailed descriptions of the morphological features of these species, along with their molecular characterization, are provided. These findings expand the host ranges, enrich the molecular data of Asterina, and increase the understanding of their diversity.

Materials and methods

Sample collection and morphological observation

Infected leaf specimens with black mildews were collected from Hainan Province, China, brought to the laboratory in paper envelopes, and stored in a dry environment. Specimens were examined using a stereomicroscope (Keyence VHX-7000 digital microscope, Japan) to photograph macroscopic features, including colony structure, color, and distribution of ascomata. Microscopic observations and photomicrographs were taken from materials mounted in 60% lactic acid using a compound light microscope (Zeiss Axioscope 5, Germany) equipped with an AxioCam 208 color camera and interference contrast optics. Images were captured to document the morphology, color, size, and other characteristics of microstructures such as hyphae, appressoria, thyriothecia, and spores. Measurements were taken using ZEN2 (blue edition) software, and all images used in figures were processed with Adobe Photoshop (version 2022). The specimens were deposited in the Herbarium of IFRD (International Fungal Research & Development Centre; Institute of Highland Forest Science, Chinese Academy of Forestry, Kunming, China) and the Herbarium of the Department of Plant Pathology, Agricultural College, Guizhou University (HGUP). Index Fungorum numbers were obtained by submitting the species information via the official online registration platform (Index Fungorum 2026).

DNA extraction, PCR amplification, and sequencing

Genomic DNA of fungi was directly extracted from ascomata following the protocol described by Zeng et al. (2018). The 5.8S ribosomal RNA, along with the internal transcribed spacer (ITS), was amplified with the primer pair ITS5 and ITS4 (White et al. 1990). The partial large subunit ribosomal RNA (LSU) was amplified with the primer pair LR0R and LR5 (Vilgalys and Hester 1990; Rehner and Samuels 1994). The partial small subunit ribosomal RNA (SSU) rDNA was amplified with the primer pair NS1 and NS4 (White et al. 1990). Genomic DNA of the host plant was extracted using a Plant gDNA maxi kit (Biomiga, San Diego, California, USA) in accordance with the manufacturer’s instructions. The partial rbcL gene was amplified using the primer pair rbcLr and rbcLf, which were developed by Kress et al. (2009). The 5.8S rDNA, along with the ITS, was amplified with the primer pair ITS1 and ITS4 (White et al. 1990). Polymerase chain reactions (PCRs) were performed in a 20 µL reaction mixture containing 17 µL of GoldenStar T6 Super PCR Mix (1.1×), 1 µL of DNA template, and 1 µL of forward and reverse primers (10 µM/µL). Amplifications were programmed for an initial denaturation step at 95 °C, followed by 35 cycles of 30 s at 95 °C, 30 s at 54 °C (ITS), 50 s at 50 °C (LSU), 51 °C (SSU), and 50 °C (rbcL), and 90 s at 72 °C, with a final elongation step of 10 min at 72 °C. PCR amplification products were assayed via electrophoresis in 1% agarose. The PCR products were sent to Tsingke Biotechnology Co., Ltd., Beijing, China. The list of primers and PCR conditions for each primer pair is provided in Table 1.

Table 1.

PCR conditions and the primers used in this study.

Locus Primers Sequence (5’–3’) PCR cycles References
ITS ITS1 TCCGTAGGTGAACCTGCGG (95 °C: 30 s, 54 °C:30 s, 72 °C:60 s) × 35 cycles White et al. 1990
ITS4 TCCTCCGCTTATTGATATGC
ITS5 GGAAGTAAAAGTCGTAACAAGG
LSU LR0R ACCCGCTGAACTTAAGC (94 °C: 30 s, 51 °C: 50 s, 72 °C:60 s) × 35 cycles Rehner and Samuels 1994
LR5 TCCTGAGGGAAACTTCG Vilgalys and Hester 1990
SSU NS1 GTAGTCATATGCTTGTCTC (95 °C: 30 s, 51 °C: 50 s, 72 °C: 60 s) × 35 cycles White et al. 1990
NS4 CTTCCGTCAATTCCTTTAAG
rbcL-a rbcLf ATGTCACCACAAACAGAGACTAAAGC (95 °C: 30 s, 50 °C: 50 s, 72 °C: 60 s) × 35 cycles Kress et al. 2009
rbcLr GTAAAATCAAGTCCACCRCG
Open in a new tab

Phylogenetic analyses

The forward and reverse sequence results of each gene were assembled using BioEdit v.7.2.5 (Hall 1999) to obtain consensus sequences. BLASTn searches were used to identify the closest matches in GenBank. The accession numbers of taxa used in the analyses are shown in Table 2. Phylogenetic analysis was conducted based on datasets including reference DNA sequences and newly generated DNA sequences using the One-click Fungal Phylogenetic Tool (OFPT), a streamlined pipeline that automates fungal phylogeny reconstruction by integrating MAFFT, TrimAl, IQ-TREE, and MrBayes (Zeng et al. 2023). The protocol was as follows: datasets of each gene region were first independently aligned with the “FFT-NS-i” strategy (based on data size) by MAFFT (Katoh and Standley 2013) and trimmed manually. The best-fit nucleotide substitution models for each dataset were then selected based on the Bayesian information criterion (BIC) from 22 common DNA substitution models with rate heterogeneity by ModelFinder (Kalyaanamoorthy et al. 2017). Afterwards, all datasets were concatenated with partition information for the subsequent phylogenetic analyses. ML with 1000 replicates was performed using ultrafast bootstrap approximation (Hoang et al. 2018) with the SH-like approximate likelihood ratio test (SH-aLRT) (Guindon et al. 2010) by IQ-TREE (Nguyen et al. 2015). The consensus tree was summarized based on the extended majority rule. BI was performed with two parallel Metropolis-coupled (one “cold” chain and three heated chains) Markov chain Monte Carlo runs by MrBayes (Ronquist et al. 2012).

Table 2.

GenBank accession numbers of DNA sequences used in this study.

Species Specimen voucher GenBank accession number References
LSU ITS SSU
Asterina cestricola TH 591 GU586215 – GU586209 Hofmann et al. (2010)
Asterina cynometrae MFLU 13-0373 NG_057120 – – Hongsanan et al. (2016)
Asterina fuchsiae TH 590 GU586216 – GU586210 Hofmann et al. (2010)
Asterina magnoliae MFLU 16-0071 MN629745 – – Hyde et al. (2018)
Asterina magnoliae MFLU 16-0072 MG844186 – – Hyde et al. (2018)
Asterina neomangiferae MFLU 21-0038 MZ225596 MZ225576 – Marasinghe et al. (2022a)
Asterina phenacis TH 589 GU586217 – GU586211 Hofmann et al. (2010)
Asterina siphocampyli ppMP 1324 HQ701140 – – Hofmann and Piepenbring (2011)
Asterina weinmanniae TH 592 GU586218 – GU586212 Hofmann et al. (2010)
Asterina zanthoxyli TH 561 GU586219 – GU586213 Hofmann et al. (2010)
Asterostomella grewiae MFLU 13-0629 MN364645 – MN364416 Hyde et al. (2020)
Asterotexis cucurbitacearum PMA M-0141224 HQ610510 – – Guatimosim et al. (2015)
Asterotexis cucurbitacearum VIC 42814 NG_057054 – – Guatimosim et al. (2015)
Cirsosia mangiferae MFLU 21-0039 NG_148995 NR_182545 – Marasinghe et al. (2022a)
Cylindrohyalospora fici MFLUCC 19-0076 MW063243 – – Tennakoon et al. (2021)
Cylindrohyalospora fici NCYUCC 19-0330 MW063244 – – Tennakoon et al. (2021)
Inocyclus angularis VIC 39748 KP143732 KP273234 – Guatimosim et al. (2015)
Inocyclus angularis VIC 39749 KP143733 KP273235 – Guatimosim et al. (2015)
Inocyclus angularis VIC 39747 KP143731 KP273233 – Guatimosim et al. (2015)
Lembosia albersii MFLU 13-0377 KM386982 – – Hongsanan et al. (2014)
Lembosia mimusopis MFLU19-1225 MN563123 – – Marasinghe et al. (2021)
Lembosia mimusopis MFLU 19-0724 MN565982 – – Marasinghe et al. (2021)
Lembosia xyliae MFLU 14-0004 NG_059589 – – Ariyawansa et al. (2015)
Morenoina calamicola MFLUCC 14-1162 NG_059779 NR_154210 NG_065667 Tibpromma et al. (2017)
Morenoina palmicola MFLUCC 15-0284 MK120272 – MK120299 Hyde et al. (2019)
Morenoina rattanica MFLU 24-0157 NG_245574 NR_200694 – Zhang et al. (2024)
Asterina heyneicola IFRD99055 PZ282960 PZ282969 PZ282978 This study
Asterina heyneicola IFRD900-25 PZ282961 PZ282970 PZ282979 This study
Asterina heyneicola HGUP 26-0002 PZ282962 PZ282971 PZ282980 This study
Asterina breyniicola IFRD99056 PZ282963 PZ282972 PZ282981 This study
Asterina breyniicola IFRD900-26 PZ282964 PZ282973 PZ282982 This study
Asterina breyniicola HGUP 26-0003 PZ282965 PZ282974 PZ282983 This study
Asterina olaciphila IFRD99057 PZ282966 PZ282975 PZ282984 This study
Asterina olaciphila IFRD900-27 PZ282967 PZ282976 PZ282985 This study
Asterina olaciphila HGUP 26-0004 PZ282968 PZ282977 PZ282986 This study
Open in a new tab

Notes: Sequences derived from holotype and epitype specimens are shown in bold.

Results

Molecular phylogeny

Phylogenetic analysis for Asterinales was performed using ITS, LSU, and SSU loci. The concatenated dataset consisted of 65 strains with Cylindrohyalospora fici as the outgroup. The final alignment comprised 2,287 concatenated characters spanning positions 1–512 (ITS), 513–1,316 (LSU), and 1,317–2,287 (SSU). The combined dataset yielded a best-scoring tree with a final ML optimization likelihood value of −9340.022123. The phylogenetic information used for ML and BI, including model selection and sequence characteristics, is detailed in Table 3. The topology of the tree from the BI analysis was similar to that obtained from the ML analysis. Given the similarity between the ML and BI topologies, only the ML tree is shown (Fig. 1).

Table 3.

Summary of phylogenetic parameters used in ML and BI analyses, including the best-fit substitution models, number of nucleotide positions, conserved and variable sites, and other relevant characteristics for each gene region.

Information Gene
ITS LSU SSU
Best fit substitution mode TN+F+G4 TN+F+R3 K2P+I
Number of sequences 16 35 17
Number of characters 512 804 971
Number of constant sites 261 (representing 50.98% of all sites 507 (representing 63.06% of all sites) 849 (representing 87.44% of all sites)
Number of parsimony informative sites 195 232 70
Number of distinct site patterns 239 339 132
Estimated base frequencies A = 0.1873 A = 0.2272 equal frequencies
C = 0.3583 C = 0.2688
G = 0.2975 G = 0.3311
T = 0.1568 T = 0.1729
Estimated substitution rates A-C = 1.0000 A-C = 1.0000 A-C = 1.0000
A-G = 2.1715 A-G = 3.0675 A-G = 4.2096
A-T = 1.0000 A-T = 1.0000 A-T = 1.0000
C-G = 1.0000 C-G = 1.0000 C-G = 1.0000
C-T = 3.7672 C-T = 8.7627 C-T = 4.2096
G-T = 1.0000 G-T = 1.0000 G-T = 1.0000
Open in a new tab

Figure 1.

Figure 1.

Open in a new tab

Best-scoring ML tree based on combined LSU, SSU, and ITS sequence data rooted by Cylindrohyalospora fici (NCYUCC 19-0076, NCYUCC 19-0030). The SH-aLRT values greater than 80%, BS values greater than 70%, and PP values greater than 0.9 are shown above the branches. Sequences obtained from holotypes and epitypes are bold. New sequences obtained in this study are in red.

Taxonomy

Asterina breyniicola

Y.Z. Feng & X.Y. Zeng sp. nov.

7207984A-CB20-5539-843D-725094ACC286

Index Fungorum: IF905324

Fig. 2

Figure 2.

Figure 2.

Open in a new tab

Asterina breyniicola (IFRD99056) a. Fungal colonies on fresh leaf of Breynia fruticosa; b, c. Blackened web-like colonies on leaf surface; d, e. Thyriothecia and appressoria; f–h. Appressoria; i–m. Squash mount of thyriothecia; n. Immature asci; o–r. Mature asci; s–v. Immature to mature ascospores. Scale bars: 1000 μm (b); 250 μm (c); 100 μm (d–g); 50 μm (h–m); 10 μm (n–v).

Etymology.

In reference to the host species name.

Description.

Parasitic on the upper surface of living leaves, forming blackened circular to irregular and minute areas, 1–5 mm diam. Superficial hyphae abundant, brown-black, loosely reticulate, spreading over the host surface, straight to substraight, branching opposed to irregular at acute angles, smooth, septate, hyphal cells cylindrical, 22.9–34.5 × 2.4–4.6 (x̄ = 27.5 × 3.6 µm, n = 20). Appressoria numerous, 1-septate, digitate, multilobate with 3 or more large lobes and various smaller lobes, straight or hooked, not sessile, at base narrow, with a stalk cell (sparsely without), stalk cell short cylindrical, alternate or unilateral, 9.2–13.8 × 8.7–11.9 µm (x̄ = 11.7 × 9.9 µm, n = 60), brown. Sexual state: Thyriothecia 130.3–210.8 µm diam. (x̄ = 169.2 µm, n = 40), superficial, developing beneath the superficial mycelium, scattered to confluent on host surface, circular, flattened, dark brown, easily removed from host surface, with star-like opening, fissure at the center, sometimes opening widely to expose mature and immature asci. Upper wall comprising rows of neatly arranged, parallel, radiating cells, which may be branched at the outer rim, from which hyphae strands develop. Hamathecium lacking pseudoparaphyses. Asci 35.9–45.4 × 32.9–41.3 µm (x̄ = 39.7 × 37.2 µm, n = 10), octosporous, bitunicate, globose to subglobose, lacking a pedicel. Ascospores 21.7–25.8 × 10.6–12.6 µm (x̄ = 24.5 × 11.4 µm, n = 10), overlapping 2–3-seriate, conglobate, hyaline, 1-septate, strongly constricted at the septum, upper cell slightly larger than lower cell, hyaline when immature, dark brown at maturity, smooth-walled. Asexual state: Unknown.

Material examined.

China • Hainan Province, Ledong Li Autonomous County, Jianfengling National Forest Park; 18°39'59"N, 108°44'17"E; on living leaves of Breynia fruticosa (Phyllanthaceae); 6 November 2025; Yu-Zhe Feng; IFRD99056 (holotype) • ibid IFRD900-26 (isotype) • ibid; HGUP 26-0005.

Notes.

This collection represents the first Asterina species from Breynia for which DNA sequence data are available. There are two Asterina species previously reported on Breynia, namely A. breyniae (Sydow and Sydow 1917) and A. breyniaecola (Saccardo et al. 1926), but the original description of A. breyniaecola by Trotter (Saccardo et al. 1926) is not accessible. Furthermore, A. breyniae has smaller thyriothecia (150–250 vs. 130.3–210.8 µm) and longer asci (45–55 × 35.9–45.4 vs. 35.9–45.4 × 32.9–41.3 µm) than the present collection (Sydow and Sydow 1917). Phylogenetically, the new collection clusters with A. phenacis with high bootstrap support but differs by 2% (13/561 nucleotides, 2 gaps) and 2% (8/461 nucleotides, 2 gaps) in the LSU and SSU regions, respectively. ITS comparisons were omitted due to the absence of reference sequences for A. phenacis in public databases. Morphologically, A. phenacis has larger appressoria (11–16 × 8–9 vs. 9.2–13.8 × 8.7–11.9 µm), smaller thyriothecia (60–125 vs. 130.3–210.8 µm), smaller asci (35–40 × 25–30 vs. 35.9–45.4 × 32.9–41.3 µm), and smaller ascospores (15–18 × 7.5–10 vs. 21.7–25.8 × 10.6–12.6 µm) (Hofmann and Piepenbring 2008) (Table 4).

Table 4.

Morphological comparison of the newly described Asterina species and related taxa.

Species Hyphal cell (μm) Appressoria (μm) Thyriothecia (μm) Asci (μm) Ascospores (μm) Pycnothyriospores (μm) Reference
Asterina heyneicola 13.3–20.6 × 3.3–6.1 8.1–10.2 × 4.4–7.1 149.2–266.4 41.7–61.6 × 39.9–55.1 24.8–31.6 × 11.2–16.5 – This study
Asterina zanthoxyli 17–27 × 4–5 10–13 × 5–6 194–235 36–51 29–33 × 14–16 – Hofmann et al. 2010
Asterina aglaiae 16–23 × 4–6 8–13 × 5–15 up to 120 up to 30 20–28 × 11–13 – Thimmaiah et al. 2013
Asterina chukrasiae 19–23 × 3–5 4–6 × 6–7 up to 100 up to 30 14–20 × 11–13 – Thimmaiah et al. 2013
Asterina cipadessae 20–27 × 2.5–3.5 8–12 × 3–5 up to 250 28 20–24 × 9–13 – Thimmaiah et al. 2013
Asterina trichiliae 16–23 × 4.5–6 8–12 × 5–7 up to 200 up to15 21–28 × 12–15 – Thimmaiah et al. 2013
Asterina phenacis 17–31 × 4–5 11–16 × 8–9 60–125 35–40 × 25–30 15–18 × 7.5–10 – Hofmann and Piepenbring 2008
Asterina breyniicola 22.9–34.5 × 2.4–4.6 9.2–13.8 × 8.7–11.9 130.3–210.8 35.9–45.4 × 32.9–41.3 21.7–25.8 × 10.6–12.6 – This study
Asterina breyniae 5–7 (wide) 15–18 × 10–12 150–250 45–55 × 30–38 21–25 × 10–11 – Sydow and Sydow 1917
Asterina olaciphila 22.1–31.1 × 6.2–8.9 10.3–15.1 × 6.5–11.0 120.2–225.2 51.9–72.8 × 49.9–73.9 33.8 × 39.8–16.9 × 21.6 20.2–29.6 × 16.7–23.8 This study
Asterina olacicola 19–23 × 8–10 11–13 × 6–7 up to 160 up to 40 27–36 × 14–19 19–23 × 15–17 Hosagoudar 2012
Asterina weinmanniae 23–35 × 5–6 10–14 × 5–8 175–227 33–43 28–33 × 14–16 (upper) / 12–14 (lower) – Hofmann et al. 2010
Asterina olacis 18–28 × 5.5–7.5 6–17 × 5–8 up to170 – 31–37 × 16–18 20–27 × 16–18 Song et al. 2003b
Open in a new tab

Notes: Comparison taxa were selected based on their close phylogenetic relationships and host associations with the newly described species.

Asterina heyneicola

Y.Z. Feng & X.Y. Zeng sp. nov.

8778EC93-EB36-55CB-A200-5EEC6ACFC69A

Index Fungorum: IF905323

Fig. 3

Figure 3.

Figure 3.

Open in a new tab

Asterina heyneicola (IFRD99055) a. Fungal colonies on fresh leaf of Heynea trijuga; b, c. Web-like colonies on leaf surfaces; d. Appearance of colony with thyriothecia on the surface of leaves; e, f. Squash mount of thyriothecia; g. Squash mount of thyriothecial upper wall; h, i. Appressoria; j–l. Immature asci; m–p. Mature asci; q–v. Immature to mature ascospores. Scale bars: 500 μm (b); 200 μm (c, d); 50 μm (e–g); 20 μm (h, i); 10 μm (j–v).

Etymology.

In reference to the host species name.

Description.

Parasitic on living leaves. Colonies circular to irregular, epiphyllous, single to confluent, black, 1–3 mm diam. Superficial hyphae abundant, brown-black, loosely reticulate, spreading over the host surface, straight to substraight, branching opposed to irregular at acute angles to wide angles, smooth, septate, hyphal cells cylindrical, 13.3–20.6 × 3.3–6.1 (x̄ = 15.9 × 5.0 µm, n = 40). Appressoria lateral, mostly opposite, rarely alternate, 1-celled, gourd-shaped, subantrorse to subparallel, light brown, 8.1–10.2 × 4.4–7.1 µm (x̄ = 9.0 × 5.7 µm, n = 60). Sexual state: Thyriothecia 149.2–266.4 µm diam. (x̄ = 191.9 µm, n = 40), flattened, developing beneath the superficial mycelium, gregarious, single to confluent, light brown to dark brown, with hyphae of different lengths at the margin, borne on a thin, hyaline basal stroma, stellately dehiscing with a slightly opened center when mature, sometimes opening widely to expose mature and immature asci, and easily detached from the host surface. Upper wall linear, with compressed hyphae arranged radially from the center toward the margin, and fringed at margins. Hamathecium lacking pseudoparaphyses. Asci 41.7–61.6 × 39.9–55.1 µm (x̄ = 46.7 × 51.4 µm, n = 10), 8-spored, globose to subglobose, bitunicate, lacking a pedicel. Ascospores 24.8–31.6 × 11.2–16.5 µm (x̄ = 28.9 × 14.4 µm, n = 60), overlapping, with 2-layered wall, one pseudoseptate, strongly constricted at the septum, wall smooth, hyaline when immature, becoming brown to black when mature, upper cell subglobose, lower cell slightly longer and narrower, oval to obovoid. Asexual state: Unknown.

Material examined.

China • Hainan Province, Qiongzhong Li and Miao Autonomous County, Baihualing Ridge; 19°0'21"N, 109°49'29"E; onliving leaves of Heynea trijuga (Meliaceae); 8 November 2025; Yu-Zhe Feng leg.; IFRD99055 (holotype) • ibid IFRD900-25 (isotype) • ibid; HGUP 26-0003.

Notes.

This represents the first record of Asterina on Heynea (Meliaceae). Morphological comparisons were conducted with Asterina species previously reported from other genera in Meliaceae, namely A. aglaiae, A. chukrasiae, A. cipadessae, and A. trichiliae (Hosagoudar 2012). The new collection resembles A. aglaiae and A. trichiliae, but A. heyneicola differs in having larger thyriothecia (up to 266.4 µm) and asci (up to 55.1 µm). Phylogenetically, the new collection is sister to A. zanthoxyli, but with 2% (13/537 nucleotides, no gaps) and 1% (6/458 nucleotides, no gaps) differences in the LSU and SSU regions, respectively. ITS sequences are unavailable for A. zanthoxyli, precluding their inclusion in the phylogenetic analysis. Morphologically, A. zanthoxyli differs in having amphigenous colonies, predominantly alternate appressoria, and longer hyphal cells (17–27 vs. 13.3–20.6 µm) (Hofmann et al. 2010) (Table 4).

Asterina olaciphila

Y.Z. Feng & X.Y. Zeng sp. nov.

B84E57B1-8890-5C37-A3AA-F7BC198A6A55

Index Fungorum: IF905325

Fig. 4

Figure 4.

Figure 4.

Open in a new tab

Asterina olaciphila (IFRD99057) a. Fresh leaf of Olax scandens; b. Blackened colonies on leaf surface; c, d. Web-like appearance of colonies on the leaf surface; e, f. Squash mount of thyriothecia; g, h. Appressoria on hyphae; i, j. Immature asci; k, l. Asci at maturity; m–r. Immature to mature ascospores; s. Germinated ascospore; t. Pycnothyria; u–x. Pycnothyriospores. Scale bars: 2000 μm (b); 100 μm (c, d, g); 50 μm (e, f, h, t); 10 μm (i–s, u–x); 10 μm (j–v).

Etymology.

In reference to the host species name.

Description.

Parasitic on living leaves, forming blackened, dense, web-like areas, colonies amphigenous, circular or irregular, single to confluent, dense, 2–8 mm diam. Superficial hyphae numerous, brown-black, closely reticulate, spreading over the host surface, straight to curved, branching opposed to irregular at acute angles, smooth, septate, hyphal cells cylindrical, 22.1–31.1 × 6.2–8.9 (x̄ = 26.5 × 7.2 µm, n = 30). Appressoria numerous, lateral, unicellular, ampulliform or slightly conical, with the top relatively shield-like, opposite or irregular, subantrorse to subretrorse, brown, 10.3–15.1 × 6.5–11.0 µm (x̄ = 12.6 × 7.9 µm, n = 100). Sexual state: Thyriothecia 120.2–225.2 µm diam. (x̄ = 154.4 µm, n = 20), superficial, flattened or subglobose, densely gregarious, single to confluent, stellately dehisced and widely opened at the center. Asci 51.9–72.8 × 49.9–73.9 µm (x̄ = 65.2 × 64.5 µm, n = 20), octosporous, bitunicate, globose, lacking a pedicel. Ascospores 33.8–39.8 × 16.9–21.6 µm (x̄ = 36.9 × 19.2 µm, n = 60), 2–3-seriate in the ascus, ovalellipsoid, 1-septate, constricted at the septum, hyaline when immature, becoming brown to dark brown at maturity, smooth-walled. Asexual state: Pycnothyria many, similar to thyriothecia, smaller; orbicular, 75.6–154.3 µm (x̄ = 104.9 µm, n = 20) in diameter. Pycnothyriospores many, pyriform, brown, 20.2–29.6 × 16.7–23.8 (x̄ = 25.9 × 19.6 µm, n = 50) µm, wall smooth.

Material examined.

China • Hainan Province, Ledong Li Autonomous County, Jianfengling National Forest Park; 18°39'59"N, 108°44'17"E; on surface of leaves of Olax scandens (Olacaceae); 6 November 2025; Yu-Zhe Feng leg.; IFRD99057 (holotype) • ibid IFRD900-27 (isotype) • ibid; HGUP 26-0007.

Notes.

This collection represents the first Asterina species on Olax for which DNA sequence data are available. Two species of Asterina have previously been reported on Olax species, namely A. olacicola (Hosagoudar 2012) and A. olacis (Song et al. 2003b), but the present taxon differs from A. olacis in possessing larger thyriothecia (170 vs. 225.2 µm) and smooth ascospores (Song et al. 2003b). It differs further from A. olacicola by having opposite appressoria, larger asci (73.9 vs. 40 µm), and pycnothyriospores (20.2–29.6 × 16.7–23.8 vs. 19–23 × 15–17 µm) (Hosagoudar 2012). Phylogenetically, the present taxon is closely related to A. weinmanniae and A. zanthoxyli (Hofmann et al. 2010). It shows a 7% difference (38/564 nucleotides, 3 gaps) in the LSU region and a 2% difference (8/418 nucleotides, no gaps) in the SSU region from A. weinmanniae. In comparison with A. zanthoxyli, it differs by 5% (28/561 nucleotides, 4 gaps) in the LSU region and 2% (11/456 nucleotides, 3 gaps) in the SSU region. The ITS region was not included in the comparison because the related taxa lack ITS sequence data available for alignment. Morphologically, A. olaciphila is distinguished by having larger asci and ascospores and opposite appressoria, as detailed in Table 4.

Discussion

Asterina represents a poorly studied genus of epifoliar fungi, with molecular data unavailable for most of its species (Marasinghe et al. 2022a). Based on an integrative taxonomic approach combining morphology, phylogeny, and host association, A. breyniicola, A. heyneicola, and A. olaciphila are introduced as new species. All new species form independent lineages in the phylogenetic trees and show consistent differences from closely related taxa, supporting their recognition as distinct taxa. These findings expand the known diversity of Asterina and provide essential molecular data for future systematic studies of Asterinaceae. Phylogenetic analyses based on combined ITS, LSU, and SSU sequence data placed the three new species in Asterina with well-supported clades. This topology is broadly consistent with recent molecular studies of Asterinales, although previous studies have primarily relied on single-gene (LSU) (Hongsanan et al. 2020; Marasinghe et al. 2021; Tennakoon et al. 2021; Jayawardena et al. 2022) or two-gene datasets (ITS-LSU and LSU-SSU) (Hyde et al. 2019; Marasinghe et al. 2022a; Marasinghe et al. 2023). Previous phylogenetic analyses have shown that several species currently assigned to Asterina, such as A. melastomatis and A. chrysophylli, do not group within the main Asterina clade (Marasinghe et al. 2021; Tennakoon et al. 2021; Jayawardena et al. 2022). The ordinal and familial placement of these taxa remains controversial: they have been variously treated as Asterinales sensu stricto (Jayawardena et al. 2022), Asterinales incertae sedis (Thyrinulaceae) (Tennakoon et al. 2021), and Asterinaceae sensu lato (Marasinghe et al. 2021) by different authors. Due to this taxonomic uncertainty and their considerable phylogenetic distance from the Asterina clade, some researchers have excluded these taxa from ingroup analyses (Hongsanan et al. 2020; Marasinghe et al. 2022a; Marasinghe et al. 2023). In the present study, several taxa (A. mandaquiensis VIC 42824, A. brigadeirensis VIC 44217, A. lopi VIC 44219, A. melastomatis VIC 42822, and A. chrysophylli VIC 42823) formed two distinct clades separate from the main Asterina clade and were therefore excluded from the ingroup. This topology may reflect DNA contamination or inhibitory effects associated with direct extraction from thyriothecia. Alternatively, these results may indicate that the current circumscription of Asterina is not monophyletic and requires substantial taxonomic revision. Similar phylogenetic inconsistencies suggest that traditional morphology-based classifications may obscure natural evolutionary relationships within Asterinales. Consequently, further molecular evidence is essential to refine the classification of this genus.

Species of Asterina are obligate biotrophs that cannot be cultured (Firmino and Pereira 2021). Molecular data for these species must therefore be obtained through direct DNA extraction from fresh fruiting structures. Furthermore, direct DNA extraction remains technically challenging due to their tiny fruiting structures, which are often intermixed with other fungi on leaf surfaces (Renard et al. 2020). DNA extraction from old herbarium specimens is generally unsuccessful, although it has been achieved in a few cases (O’Gorman et al. 2008; Telle and Thines 2008; Hawksworth 2013; Guatimosim et al. 2015). Therefore, most previous studies have relied solely on morphology, and many taxa remain without molecular data (Firmino et al. 2016). One major limitation in current studies of Asterinales is the insufficient authenticated sequence data in public databases, particularly for type or reference species. In addition, phylogenetic analyses are often based on a limited number of loci because obtaining high-quality DNA from obligate biotrophic fungi remains difficult, and ITS sequences are unavailable for many taxa. Consequently, ITS-based comparisons were not possible for some closely related taxa because corresponding ITS reference sequences are still unavailable in public databases. Future studies incorporating multilocus datasets will therefore be essential for resolving evolutionary relationships within Asterinales.

The traditional taxonomic framework proposed by Hansford (1946), primarily based on host specificity and morphological characteristics, continues to be widely applied in recent studies (Hofmann and Piepenbring 2008; Hongsanan et al. 2014; Bhise et al. 2023). Given the current paucity of molecular data, species delineation remains largely dependent on morphological analysis, particularly comparative studies with previously described congeners associated with identical or phylogenetically proximate host plants (Ouyang et al. 1995; Song et al. 2003c; Hosagoudar 2012). Since most species in Asterina are known only from their sexual morphs, species delimitation relies heavily on traits such as the arrangement, shape, and dimensions of appressoria; the size of thyriothecia; and the size of ascospores. For example, A. horsfieldiicola and A. pycnanthis can be distinguished based on differences in the arrangement of appressoria and the size of ascospores (Sydow 1938; Song et al. 2003a), while A. flacourtiaceicola and A. delicata differ notably in that the former has smaller ascospores (Doidge 1919; Song et al. 2003a). Additionally, A. lauracearum and A. cinnamomi are differentiated by the latter having globose and lobed appressoria (Sydow 1923; Ouyang et al. 1995; Song et al. 2003c). Morphological comparisons among related Asterina species are provided in Table 4. The results indicate that some morphological features, particularly the arrangement and shape of appressoria and ascospore dimensions, remain useful for distinguishing closely related taxa. However, morphologically similar taxa are not necessarily phylogenetically related, suggesting that certain morphological traits may exhibit convergent evolution or possess limited phylogenetic signal. Therefore, morphology alone may be insufficient for reliable species delimitation in Asterina, although it remains taxonomically informative when combined with molecular phylogenetic evidence.

Host association has historically played a central role in the taxonomy of Asterina, and many species were described primarily on the basis of host identity and morphology. Previous studies suggested that many species of Asterina may be host-specific, at least at the host-family level (Hofmann and Piepenbring 2008). However, most historical classifications were established without molecular evidence, and Vishnu et al. (2017) questioned whether host specificity in Asterinales has been adequately demonstrated. Because the three newly described species were collected from different host taxa, the present study cannot directly assess host specificity. Nevertheless, the molecular data generated here provide an important framework for future studies evaluating the taxonomic significance of host association in Asterina. Additional sampling across hosts and geographic regions will be necessary to determine the extent to which host association reflects species boundaries and evolutionary relationships within the genus.

Species delimitation in obligate biotrophic fungi remains particularly challenging because these fungi are unculturable and often yield only limited molecular data. In Asterinales, commonly used ribosomal markers such as LSU and SSU are relatively conserved, and no universal nucleotide divergence threshold has been established for species delimitation. For example, the accepted species A. phenacis and A. siphocampyli differ by only approximately 2% (13/562 nucleotides, 1 gap) in LSU sequence data, despite being recognized as distinct taxa (Hofmann et al. 2010; Hofmann and Piepenbring 2011). The absence of ITS sequences for both species and SSU data for A. siphocampyli further reflects the limited molecular resources currently available for many taxa in the genus. These observations indicate that species boundaries in Asterina cannot be evaluated solely on sequence divergence but should instead be assessed using multiple lines of evidence. In the present study, species recognition is supported by independent phylogenetic placement together with morphological differences and host associations. Therefore, an integrative taxonomic approach remains essential for robust species delimitation in Asterina.

Supplementary Material

XML Treatment for Asterina breyniicola
XML Treatment for Asterina heyneicola
XML Treatment for Asterina olaciphila

Citation

Feng Y, Norphanphoun C, Zeng X-Y (2026) Three novel species of Asterina (Asterinales, Dothideomycetes) from Hainan Province, China. MycoKeys 134: 75–95. https://doi.org/10.3897/mycokeys.134.196557

Funding Statement

This study was funded by the National Natural Science Foundation of China (no. 32400013); Guizhou Provincial Basic Research Program (Natural Science) ZK[2023] general 087.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Artificial Intelligence (AI) use

The authors accept full responsibility for the content of the manuscript, including the disclosure of any use of AI.

No AI tools were used in the preparation of this manuscript.

Funding

This study was funded by the National Natural Science Foundation of China (no. 32400013) and the Guizhou Provincial Basic Research Program (Natural Science) ZK[2023] general 087.

Author contributions

Conceptualization: X.Y. Zeng and Y.Z. Feng; methodology: X.Y. Zeng and Y.Z. Feng; investigation: Y.Z. Feng; formal analysis: Y.Z. Feng and C. Norphanphoun; funding acquisition: X.Y. Zeng; writing—original draft: Y.Z. Feng; writing—review and editing: Y.Z. Feng, C. Norphanphoun, and X.Y. Zeng.

Author ORCIDs

Y. Feng https://orcid.org/0009-0000-8832-7355

C. Norphanphoun https://orcid.org/0000-0002-5756-7206

X.-Y. Zeng https://orcid.org/0000-0003-1341-1004

Data availability

All of the data that support the findings of this study are available in the main text.

References

  1. Ariyawansa HA, Hyde KD, Jayasiri SC, Buyck B, Chethana KWT, Dai DQ, Dai YC, Daranagama DA, Jayawardena RS, Lücking R, Ghobad-Nejhad M, Niskanen T, Thambugala KM, Voigt K, Zhao RL, Li G-J, Doilom M, Boonmee S, Yang ZL, Cai Q, Cui YY, Bahkali AH, Chen J, Cui BK, Chen JJ, Dayarathne MC, Dissanayake AJ, Ekanayaka AH, Hashimoto A, Hongsanan S, Jones EBG, Larsson E, Li WJ, Li Q-R, Liu JK, Luo ZL, Maharachchikumbura SSN, Mapook A, McKenzie EHC, Norphanphoun C, Konta S, Pang KL, Perera RH, Phookamsak R, Phukhamsakda C, Pinruan U, Randrianjohany E, Singtripop C, Tanaka K, Tian CM, Tibpromma S, Abdel-Wahab MA, Wanasinghe DN, Wijayawardene NN, Zhang JF, Zhang H, Abdel-Aziz FA, Wedin M, Westberg M, Ammirati JF, Bulgakov TS, Lima DX, Callaghan TM, Callac P, Chang CH, Coca LF, Dal-Forno M, Dollhofer V, Fliegerová K, Greiner K, Griffith GW, Ho H-M, Hofstetter V, Jeewon R, Kang JC, Wen TC, Kirk PM, Kytövuori I, Lawrey JD, Xing J, Li H, Liu ZY, Liu XZ, Liimatainen K, Lumbsch HT, Matsumura M, Moncada B, Nuankaew S, Parnmen S, de Azevedo Santiago ALCM, Sommai S, Song Y, de Souza CAF, de Souza-Motta CM, Su HY, Suetrong S, Wang Y, Wei SF, Wen TC, Yuan HS, Zhou LW, Réblová M, Fournier J, Camporesi E, Luangsa-ard JJ, Tasanathai K, Khonsanit A, Thanakitpipattana D, Somrithipol S, Diederich P, Millanes AM, Common RS, Stadler M, Yan JY, Li X, Lee HW, Nguyen TTT, Lee HB, Battistin E, Marsico O, Vizzini A, Vila J, Ercole E, Eberhardt U, Simonini G, Wen HA, Chen XH, Miettinen O, Spirin V, Hernawati (2015) Fungal diversity notes 111–252—taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 75: 27–274. 10.1007/s13225-015-0346-5 [DOI]
  2. Barr ME, Huhndorf SM (2001) Loculoascomycetes. In: McLaughlin DJ, McLaughlin EG, Lemke PA (eds) The Mycota, Systematics and Evolution, part A, Vol. VII. Springer, Berlin, Heidelberg, 283–305. 10.1007/978-3-662-10376-0_13 [DOI]
  3. Bhise MR, Patil CR, Salunkhe CB, Kambhar SV (2023) Asterina macrosolenae sp. nov. (Asterinales, Asterinaceae) from northern Western Ghats, India. Journal of Mycopathological Research 61: 125–127. 10.57023/JMycR.61.1.2023.125 [DOI]
  4. Boonmee S, Rossman AY, Liu JK, Li WJ, Dai DQ, Bhat JD, Jones EG, McKenzie EH, Xu JC, Hyde KD (2014) Tubeufiales, ord. nov., integrating sexual and asexual generic names. Fungal Diversity 68: 239–298. 10.1007/s13225-014-0304-7 [DOI]
  5. Chethana KT, Jayawardena RS, Chen YJ, Konta S, Tibpromma S, Abeywickrama PD, Gomdola D, Balasuriya A, Xu J, Lumyong S, Hyde KD (2021) Diversity and function of appressoria. Pathogens 10: 746. 10.3390/pathogens10060746 [DOI] [PMC free article] [PubMed]
  6. De Silva NI, Lumyong S, Hyde KD, Bulgakov T, Phillips AJL, Yan JY (2016) Mycosphere essays 9: defining biotrophs and hemibiotrophs. Mycosphere 7: 545–559. 10.5943/mycosphere/7/5/2 [DOI]
  7. Doidge EM (1919) South African Microthyriaceae. Transactions of the Royal Society of South Africa 8: 235–282. 10.1080/00359191909520002 [DOI]
  8. Firmino AL, Pereira OL (2021) A simple method for the cultivation of the “unculturable” asterinaceous fungi (Asterinales/Dothideomycetes). Journal of Microbiological Methods 187: 106272. 10.1016/j.mimet.2021.106272 [DOI] [PubMed]
  9. Firmino AL, Inácio CA, Pereira OL, Dianese JC (2016) Additions to the genera Asterolibertia and Cirsosia (Asterinaceae, Asterinales), with particular reference to species from the Brazilian Cerrado. IMA Fungus 7: 9–28. 10.5598/imafungus.2016.07.01.02 [DOI] [PMC free article] [PubMed]
  10. Guatimosim E, Firmino AL, Bezerra JL, Pereira OL, Barreto RW, Crous PW (2015) Towards a phylogenetic reappraisal of Parmulariaceae and Asterinaceae (Dothideomycetes). Persoonia 35: 230–241. 10.3767/003158515X688046 [DOI] [PMC free article] [PubMed]
  11. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology 59: 307–321. 10.1093/sysbio/syq010 [DOI] [PubMed]
  12. Hall TA (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  13. Hansford CG (1946) The foliicolous Ascomycetes, their parasites and associated fungi. Mycological Papers 15: 1–240.
  14. Hawksworth DL (2013) The oldest sequenced fungal specimen. The Lichenologist 45: 131–132. 10.1017/S0024282912000710 [DOI]
  15. Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35: 518–522. 10.1093/molbev/msx281 [DOI] [PMC free article] [PubMed]
  16. Hofmann TA (2010) Plant parasitc Asterinaceae and Microthyriaceae from the Neotropics (Panama). PhD thesis, The faculty of biological sciences at the J.W.Goethe-University Frankfurt am Main, Germany.
  17. Hofmann T, Piepenbring M (2008) New species and records of Asterina from Panama. Mycological Progress 7: 87–98. 10.1007/s11557-008-0555-3 [DOI]
  18. Hofmann TA, Piepenbring M (2011) Biodiversity of Asterina species on Neotropical host plants: new species and records from Panama. Mycologia 103: 1284–1301. 10.3852/10-279 [DOI] [PubMed]
  19. Hofmann TA, Kirschner R, Piepenbring M (2010) Phylogenetic relationships and new records of Asterinaceae (Dothideomycetes) from Panama. Fungal Diversity 43: 39–53. 10.1007/s13225-010-0042-4 [DOI]
  20. Hongsanan S, Li YM, Liu JK, Hofmann T, Piepenbring M, Bhat JD, Boonmee S, Doilom M, Singtripop C, Tian Q, Mapook A, Zeng XY, Bahkali AH, Xu JC, Mortimer PE, Wu XH, Yang JB, Hyde KD (2014) Revision of genera in Asterinales. Fungal Diversity 68: 1–68. 10.1007/s13225-014-0307-4 [DOI]
  21. Hongsanan S, Sánchez-Ramírez S, Crous PW, Ariyawansa HA, Zhao RL, Hyde KD (2016) The evolution of fungal epiphytes. Mycosphere 7: 1690–1712. 10.5943/mycosphere/7/11/6 [DOI]
  22. Hongsanan S, Hyde KD, Phookamsak R, Wanasinghe DN, McKenzie EHC, Sarma VV, Lücking R, Boonmee S, Bhat JD, Liu NG, Tennakoon DS, Pem D, Karunarathna A, Jiang S-H, Jones GEB, Phillips AJL, Manawasinghe IS, Tibpromma S, Jayasiri SC, Sandamali D, Jayawardena RS, Wijayawardene NN, Ekanayaka AH, Jeewon R, Lu YZ, Phukhamsakda C, Dissanayake AJ, Zeng XY, Luo ZL, Tian Q, Thambugala KM, Dai D, Samarakoon MC, Chethana KWT, Ertz D, Doilom M, Liu JK, Pérez-Ortega S, Suija A, Senwanna C, Wijesinghe SN, Niranjan M, Zhang S-N, Ariyawansa HA, Jiang H-B, Zhang J-F, Norphanphoun C, de Silva NI, Thiyagaraja V, Zhang H, Bezerra JDP, Miranda-González R, Aptroot A, Kashiwadani H, Harishchandra D, Sérusiaux E, Abeywickrama PD, Bao DF, Devadatha B, Wu HX, Moon KH, Gueidan C, Schumm F, Bundhun D, Mapook A, Monkai J, Bhunjun CS, Chomnunti P, Suetrong S, Chaiwan N, Dayarathne MC, Yang J, Rathnayaka AR, Xu JC, Zheng J, Liu G, Feng Y, Xie N (2020) Refined families of Dothideomycetes: orders and families incertae sedis in Dothideomycetes. Fungal Diversity 105: 17–318. 10.1007/s13225-020-00462-6 [DOI]
  23. Hosagoudar VB (2012) Asterinales of India. Mycosphere 2: 617–852. 10.5943/mycosphere/3/5/9 [DOI]
  24. Hosagoudar VB, Abraham TK, Pushpangadan P (1997) The ‘Meliolineae’: a supplement. Tropical Botanic Garden and Research Institute, Palode, 201 pp.
  25. Hyde KD, Jones EBG, Liu JK, Ariyawansa H, Boehm E, Boonmee S, Braun U, Chomnunti P, Crous PW, Dai DQ, Diederich P, Dissanayake A, Doilom M, Doveri F, Hongsanan S, Jayawardena R, Lawrey JD, Li YM, Liu YX, Lücking R, Monkai J, Muggia L, Nelsen MP, Pang KL, Phookamsak R, Senanayake IC, Shearer CA, Suetrong S, Tanaka K, Thambugala KM, Wijayawardene NN, Wikee S, Wu HX, Zhang Y, Aguirre-Hudson B, Alias SA, Aptroot A, Bahkali AH, Bezerra JL, Bhat DJ, Camporesi E, Chukeatirote E, Gueidan C, Hawksworth DL, Hirayama K, De Hoog S, Kang JC, Knudsen K, Li WJ, Li XH, Liu ZY, Mapook A, McKenzie EHC, Miller AN, Mortimer PE, Phillips AJL, Raja HA, Scheuer C, Schumm F, Taylor JE, Tian Q, Tibpromma S, Wanasinghe DN, Wang Y, Xu JC, Yacharoen S, Yan JY, Zhang M (2013) Families of Dothideomycetes. Fungal Diversity 63: 1–313. 10.1007/s13225-013-0263-4 [DOI]
  26. Hyde KD, Chaiwan N, Norphanphoun C, Boonmee S, Camporesi E, Chethana K, Dayarathne M, De Silva N, Dissanayake A, Ekanayaka AJM (2018) Mycosphere notes 169–224. Mycosphere 9(2): 271–430. 10.5943/mycosphere/9/2/8 [DOI]
  27. Hyde KD, Tennakoon DS, Jeewon R, Bhat DJ, Maharachchikumbura SSN, Rossi W, Leonardi M, Lee HB, Mun HY, Houbraken J, Nguyen TTT, Jeon SJ, Frisvad JC, Wanasinghe DN, Lücking R, Aptroot A, Cáceres MES, Karunarathna SC, Hongsanan S, Phookamsak R, de Silva NI, Thambugala KM, Jayawardena RS, Senanayake IC, Boonmee S, Chen J, Luo ZL, Phukhamsakda C, Pereira OL, Abreu VP, Rosado AWC, Bart B, Randrianjohany E, Hofstetter V, Gibertoni TB, Soares AMdS, Plautz HL, Sotão HMP, Xavier WKS, Bezerra JDP, de Oliveira TGL, de Souza-Motta CM, Magalhães OMC, Bundhun D, Harishchandra D, Manawasinghe IS, Dong W, Zhang SN, Bao DF, Samarakoon MC, Pem D, Karunarathna A, Lin CG, Yang J, Perera RH, Kumar V, Huang SK, Dayarathne MC, Ekanayaka AH, Jayasiri SC, Xiao Y, Konta S, Niskanen T, Liimatainen K, Dai YC, Ji XH, Tian XM, Mešić A, Singh SK, Phutthacharoen K, Cai L, Sorvongxay T, Thiyagaraja V, Norphanphoun C, Chaiwan N, Lu YZ, Jiang HB, Zhang JF, Abeywickrama PD, Aluthmuhandiram JVS, Brahmanage RS, Zeng M, Chethana T, Wei D, Réblová M, Fournier J, Nekvindová J, do Nascimento Barbosa R, dos Santos JEF, de Oliveira NT, Li GJ, Ertz D, Shang QJ, Phillips AJL, Kuo CH, Camporesi E, Bulgakov TS, Lumyong S, Jones EBG, Chomnunti P, Gentekaki E, Bungartz F, Zeng XY, Fryar S, Tkalčec Z, Liang J, Li G, Wen TC, Singh PN, Gafforov Y, Promputtha I, Yasanthika E, Goonasekara ID, Zhao RL, Zhao Q, Kirk PM, Liu JK, Yan J, Mortimer PE, Xu J, Doilom M (2019) Fungal diversity notes 1036–1150: taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Diversity 96: 1–242. 10.1007/s13225-019-00429-2 [DOI]
  28. Hyde KD, Jeewon R, Chen Y-J, Bhunjun CS, Calabon MS, Jiang HB, Lin CG, Norphanphoun C, Sysouphanthong P, Pem D, Tibpromma S, Zhang Q, Doilom M, Jayawardena RS, Liu JK, Maharachchikumbura SSN, Phukhamsakda C, Phookamsak R, Al-Sadi AM, Thongklang N, Wang Y, Gafforov Y, Jones EBG, Lumyong S (2020) The numbers of fungi: is the descriptive curve flattening? Fungal Diversity 103: 219–271. 10.1007/s13225-020-00458-2 [DOI]
  29. Index Fungorum (2026) The Royal Botanic Gardens, Kew. http://www.indexfungorum.org [accessed14 April 2026]
  30. Jayawardena RS, Hyde KD, Wang S, Sun YR, Suwannarach N, Sysouphanthong P, Abdel-Wahab MA, Abdel-Aziz FA, Abeywickrama PD, Abreu VP, Armand A, Aptroot A, Bao DF, Begerow D, Bellanger JM, Bezerra JDP, Bundhun D, Calabon MS, Cao T, Cantillo T, Carvalho JLVR, Chaiwan N, Chen CC, Courtecuisse R, Cui BK, Damm U, Denchev CM, Denchev TT, Deng CY, Devadatha B, de Silva NI, dos Santos LA, Dubey NK, Dumez S, Ferdinandez HS, Firmino AL, Gafforov Y, Gajanayake AJ, Gomdola D, Gunaseelan S, Shucheng H, Htet ZH, Kaliyaperumal M, Kemler M, Kezo K, Kularathnage ND, Leonardi M, Li JP, Liao C, Liu S, Loizides M, Luangharn T, Ma J, Madrid H, Mahadevakumar S, Maharachchikumbura SSN, Manamgoda DS, Martín MP, Mekala N, Moreau PA, Mu YH, Pahoua P, Pem D, Pereira OL, Phonrob W, Phukhamsakda C, Raza M, Ren GC, Rinaldi AC, Rossi W, Samarakoon BC, Samarakoon MC, Sarma VV, Senanayake IC, Singh A, Souza MF, Souza-Motta CM, Spielmann AA, Su W, Tang X, Tian X, Thambugala KM, Thongklang N, Tennakoon DS, Wannathes N, Wei D, Welti S, Wijesinghe SN, Yang H, Yang Y, Yuan HS, Zhang H, Zhang J, Balasuriya A, Bhunjun CS, Bulgakov TS, Cai L, Camporesi E, Chomnunti P, Deepika YS, Doilom M, Duan WJ, Han SL, Huanraluek N, Jones EBG, Lakshmidevi N, Li Y, Lumyong S, Luo ZL, Khuna S, Kumla J, Manawasinghe IS, Mapook A, Punyaboon W, Tibpromma S, Lu YZ, Yan J, Wang Y (2022) Fungal diversity notes 1512–1610: taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Diversity 117: 1–272. 10.1007/s13225-022-00513-0 [DOI] [PMC free article] [PubMed]
  31. Kalyaanamoorthy S, Minh BQ, Wong TK, Von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. 10.1038/nmeth.4285 [DOI] [PMC free article] [PubMed]
  32. Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed]
  33. Kirk PM, Cannon PF, David JC, Stalpers JA (2001) Ainsworth & Bisby’s Dictionary of the Fungi, 9th Edn. CABI, Wallingford.
  34. Kress WJ, Erickson DL, Jones FA, Swenson NG, Perez R, Sanjur O, Bermingham E (2009) Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proceedings of the National Academy of Sciences of the United States of America 106: 18621–18626. 10.1073/pnas.0909820106 [DOI] [PMC free article] [PubMed]
  35. Latijnhouwers M, de Wit PJGM, Govers F (2003) Oomycetes and fungi: similar weaponry to attack plants. Trends in Microbiology 11: 462–469. 10.1016/j.tim.2003.08.002 [DOI] [PubMed]
  36. Léveillé JH (1845) Champignons exotiques. Annales des Sciences Naturelles Botanique 3: 38–71.
  37. Marasinghe DS, Dayarathne MC, Maharachchikumbura SS, Elgorban AM, Hongsanan S, Hyde KDJM (2021) Lembosia mimusopis sp. nov. from Thailand. Mycotaxon 136: 635–644. 10.5248/136.635 [DOI]
  38. Marasinghe DS, Hongsanan S, Wanasinghe DN, Boonmee S, Lumyong S, Hyde KD, Ning X (2022a) Morpho-molecular characterization of Brunneofissuraceae fam. nov., Cirsosia mangiferae sp. nov., and Asterina neomangiferae nom. nov. Mycological Progress 21: 279–295. 10.1007/s11557-021-01767-9 [DOI]
  39. Marasinghe DS, Hongsanan S, Zeng XY, Jones EBG, Boonmee S, Hyde KD (2022b) Taxonomy and ecology of epifoliar fungi. Mycosphere 13: 602–611. 10.5943/mycosphere/13/1/3 [DOI]
  40. Marasinghe DS, Hongsanan S, Zeng XY, Jones EBG, Chomnunti P, Boonmee S, Hyde KD (2023) Taxonomic monograph of epifoliar fungi. Fungal Diversity 121: 139–334. 10.1007/s13225-023-00522-7 [DOI]
  41. Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ (2015) IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. 10.1093/molbev/msu300 [DOI] [PMC free article] [PubMed]
  42. O’Gorman DT, Sholberg PL, Stokes SC, Ginns J (2008) DNA sequence analysis of herbarium specimens facilitates the revival of Botrytis mali, a postharvest pathogen of apple. Mycologia 100: 227–235. 10.3852/mycologia.100.2.227 [DOI] [PubMed]
  43. Ouyang YS, Song B, Hu Y (1995) Studies on the taxonomy of Asterina in China I. Acta Mycologica Sinica 14: 241–247.
  44. Rehner SA, Samuels GJ (1994) Taxonomy and phylogeny of Gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycological Research 98: 625–634. 10.1016/S0953-7562(09)80409-7 [DOI]
  45. Renard L, Firmino AC, Pereira OL, Stockey RA, Berbee ML (2020) Character evolution of modern fly‐speck fungi and implications for interpreting thyriothecial fossils. American Journal of Botany 107: 1021–1040. 10.1002/ajb2.1511 [DOI]
  46. Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed]
  47. Saccardo PA (1882) SyIloge Fungorum I: 39–47. 10.1038/scientificamerican07151882-39 [DOI]
  48. Saccardo PA, Traverso GB, Trotter A (1926) Sylloge fungorum omnium hucusque cognitorum. sumptibus auctoris, Patavii.
  49. Song B, Li TH, Hosagoudar VB (2003a) Four new Asterina species from Yunnan, China. Fungal Diversity 14: 157–164.
  50. Song B, Li TH, Shen YH (2003b) Two new Asterina species from Hainan, China. Mycotaxon 87: 417–419. 10.5962/p.418431 [DOI]
  51. Song B, Li TH, Shen YH (2003c) Two new Asterina species on Lauraceae from China. Mycosystema 22: 348–350.
  52. Song B, Li TH, Xing FW (2004) Some interesting species of Asterina from Guangdong, China. Fungal Diversity 16: 157–166.
  53. Sydow H (1923) Ein neuer Beitrag zur Kenntnis der Pilzflora der Philippinen-Inseln Annales Mycologici 21: 93–106.
  54. Sydow H (1938) Novae Fungorum Species-XXVI. Annales Mycologici 36: 156–197.
  55. Sydow H, Sydow P (1917) Beitrag zur Kenntnis der Pilzflora der Philippinen-Inseln. Annales Mycologici 15: 165–268.
  56. Taylor A, Hardy ST, Wood GE, Burgess T (2005) Identification and pathogenicity of Botryosphaeria species associated with grapevine decline in Western Australia. Australasian Plant Pathology 34: 187–195. 10.1071/AP05018 [DOI]
  57. Telle S, Thines M (2008) Amplification of cox2 (~ 620 bp) from 2 mg of up to 129 years old herbarium specimens, comparing 19 extraction methods and 15 polymerases. PLOS One 3: e3584. 10.1371/journal.pone.0003584 [DOI] [PMC free article] [PubMed]
  58. Tennakoon DS, Kuo CH, Maharachchikumbura SS, Thambugala KM, Gentekaki E, Phillips AJ, Bhat DJ, Wanasinghe DN, de Silva NI, Promputtha IJFd (2021) Taxonomic and phylogenetic contributions to Celtis formosana, Ficus ampelas, F. septica, Macaranga tanarius and Morus australis leaf litter inhabiting microfungi. Fungal Diversity 108: 1–215. 10.1007/s13225-021-00474-w [DOI]
  59. Theissen F (1912) Fragmenta Brasilica. IV nebst Bemerkungen über einige andere Asterina-Arten. Annales Mycologici 10: 1–32.
  60. Theissen F (1913) Die Gattung Asterina. Abhandlungen der Zoologisch-Botanischen Gesellschaft in Wien 7: 1–130.
  61. Thimmaiah CJ, Hosagoudar V, Jayashankar M (2013) CEPF Western Ghats Special Series: Black mildews of Kodagu, Karnataka, India. Journal of Threatened Taxa 5: 5021–5180. 10.11609/JoTT.o3657.5021-180 [DOI]
  62. Tibpromma S, Hyde KD, Jeewon R, Maharachchikumbura SS, Liu JK, Bhat DJ, Jones EG, McKenzie EH, Camporesi E, Bulgakov TS, Doilom M, Santiago AL, Das K, Manimohan P, Gibertoni TB, Lim YW, Ekanayaka AH, Thongbai B, Lee HB, Yang JB, Kirk PM, Sysouphanthong P, Singh SK, Boonmee S, Dong W, Raj KN, Latha KP, Phookamsak R, Phukhamsakda C, Konta S, Jayasiri SC, Norphanphoun C, Tennakoon DS, Li JF, Dayarathne MC, Perera RH, Xiao YP, Wanasinghe DN, Senanayake IC, Goonasekara ID, de Silva NI, Mapook A, Jayawardena RS, Dissanayake AJ, Manawasinghe IS, Chethana KW, Luo ZL, Hapuarachchi KK, Baghela A, Soares AM, Vizzini A, Meiras-Ottoni A, Mešić A, Dutta AM, de Souza CA, Richter C, Lin CG, Chakrabarty D, Daranagama DA, Lima DX, Chakraborty D, Ercole E, Wu F, Simonini G, Vasquez G, da Silva GA, Plautz Jr HL, Ariyawansa HA, Lee H, Kušan I, Song J, Sun JZ, Karmakar J, Hu KF, Semwal KC, Thambugala KM, Voigt K, Acharya K, Rajeshkumar KC, Ryvarden L, Jadan M, Hosen MI, Mikšík M, Samarakoon MC, Wijayawardene NN, Kim NK, Matočec N, Singh PN, Tian Q, Bhatt RP, de Oliveira RJ, Tulloss RE, Aamir S, Kaewchai S, Marathe SD, Khan S, Hongsanan S, Adhikari S, Mehmood T, Bandyopadhyay TK, Svetasheva TY, Nguyen TTT, Antonín V, Li JW, Wang Y, Indoliya Y, Tkalčec Z, Elgorban AM, Bahkali AH, Tang AMC, Su HY, Zhang H, Promputtha I, Luangsa-ard J, Xu JC, Yan J, Kang JC, Stadler M, Mortimer PE, Chomnunti P, Zhao Q, Phillips AJL, Nontachaiyapoom S, Wen TC, Karunarathna SC (2017) Fungal diversity notes 491–602: taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 83: 1–261. 10.1007/s13225-017-0378-0 [DOI]
  63. Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. 10.1128/jb.172.8.4238-4246.1990 [DOI] [PMC free article] [PubMed]
  64. Vishnu A, Khan MA, Bera M, Dilcher DL, Bera S (2017) Fossil Asterinaceae in the phyllosphere of the eastern Himalayan Neogene Siwalik forest and their palaeoecological significance. Botanical Journal of the Linnean Society 185: 147–167. 10.1093/botlinnean/box050 [DOI]
  65. White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a Guide to Methods and Applications 18: 315–322. 10.1016/B978-0-12-372180-8.50042-1 [DOI]
  66. Wijayawardene NN, Crous PW, Kirk PM, Hawksworth DL, Boonmee S, Braun U, Dai DQ, D’souza MJ, Diederich P, Dissanayake A (2014) Naming and outline of Dothideomycetes–2014 including proposals for the protection or suppression of generic names. Fungal Diversity 69: 1–55. 10.1007/s13225-014-0309-2 [DOI] [PMC free article] [PubMed]
  67. Zeng XY, Jeewon R, Wen TC, Hongsanan S, Boonmee S, Hyde KD (2018) Simplified and efficient DNA extraction protocol for Meliolaceae specimens. Mycological Progress 17: 403–415. 10.1007/s11557-017-1361-6 [DOI]
  68. Zeng XY, Tan TJ, Tian FH, Wang Y, Wen TC (2023) OFPT: a one-stop software for fungal phylogeny. Mycosphere 14: 1730–1741. 10.5943/mycosphere/14/1/20 [DOI]
  69. Zhang SN, Hyde KD, Jones EBG, Yu XD, Cheewangkoon R, Liu JK (2024) Current insights into palm fungi with emphasis on taxonomy and phylogeny. Fungal Diversity 127: 55–301. 10.1007/s13225-024-00536-9 [DOI]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Asterina breyniicola
mycokeys.134.196557-treatment1.xml (25.1KB, xml)
XML Treatment for Asterina heyneicola
mycokeys.134.196557-treatment2.xml (25.3KB, xml)
XML Treatment for Asterina olaciphila
mycokeys.134.196557-treatment3.xml (25.7KB, xml)

Data Availability Statement

All of the data that support the findings of this study are available in the main text.

Articles from MycoKeys are provided here courtesy of Pensoft Publishers

RESOURCES