Skip to main content
NCBI home page
ACS AuthorChoice logoLink to ACS AuthorChoice
. 2026 Jun 9;21(6):1525–1532. doi: 10.1021/acschembio.6c00288

Generation of Infectious Prions Amenable to Site-Specific Click Chemistry

Ryan G Campbell †, Jolene N Iseler †, Abigail M Schwind †, Surachai Supattapone †,‡,*
PMCID: PMC13288451  PMID: 42265055

Abstract

Prion diseases are a group of fatal neurodegenerative diseases that proceed through the templated conversion of the normal PrPC protein to a self-propagating and infectious form termed PrPSc. This conversion process is central to the disease progression. However, because of difficulties in producing functional PrPSc molecules that can be selectively modified with chemical probes, many aspects of PrPSc biology cannot be directly studied. To overcome this limitation, we substituted p-azido-l-phenylalanine (AzF), a small click chemistry-reactive amino acid, for tryptophan residue 99 of PrPC. The W99AzF PrPC substrate can efficiently and faithfully propagate either infectious or noninfectious PrPSc conformers in vitro. Critically, W99AzF PrPSc remains amenable to click chemistry by various ligands after the prion conversion process. Through the combination of site-specific substitution, the modularity of click chemistry, and the functional diversity of click labels, a multitude of modified prions can now be produced to ask targeted questions about the biochemical and biological bases of prion infectivity.

graphic file with name cb6c00288_0009.jpg

graphic file with name cb6c00288_0007.jpg

Introduction

The prion protein (PrP) is a glycophosphatidylinositol (GPI)-anchored membrane glycoprotein enriched in neurons. It has the unorthodox ability to change from a properly folded cellular conformation termed PrPC to various misfolded, protease-resistant, and infectious conformers collectively termed PrPSc. The presence of PrPSc can autocatalytically induce further PrPC misfolding in the brain, leading to a buildup of PrPSc resulting in fatal diseases such as Creutzfeldt-Jakob disease (CJD), bovine spongiform encephalopathy (BSE), and scrapie. The initial misfolding of PrPC can be triggered by exposure to exogenous PrPSc, genetic mutations in the PrP gene (PRNP), or spontaneous conversion. − Cryo-electron microscopy (cryo-EM) studies reveal that PrPSc assembles into parallel in-register β-sheet (PIRBS) amyloid fibrils. − Many other functional and pathological amyloid proteins with prion-like self-propagation ability exist in species as diverse as yeast and humans. , Notably, the propagation of α-synuclein and tau amyloid fibrils may play important roles in the pathogenesis of Parkinson disease and Alzheimer disease. ,

To facilitate investigations into the structure, function, and cellular fate of PrPSc and other amyloid proteins, it would be useful to attach various reporters and ligands to specific sites of the amyloid protein of interest. However, amyloid formation is easily disrupted by perturbations in the precursor protein, − making it challenging to introduce site-specific modifications into precursor proteins while maintaining the ability to form amyloid fibrils. We refer to this sensitivity as a conversion bottleneck.

In the absence of a general method to specifically modify amyloid proteins, various bespoke and traditional labeling techniques have been used. In the case of α-synuclein, a nonperturbing tetracysteine motif has been inserted into the protein to study fibril formation. While this method works well for α-synuclein, it is not optimal for proteins that contain endogenous cysteines and disulfide bonds, such as PrP. Similarly, various sequences including His-, Myc-, FLAG-, and GFP-tags ,− have been used to tag PrP. However, these large tags can only be accommodated in select locations and typically prevent the ability of PrPC to convert into infectious PrPSc. For example, MYC tags placed in the central region of PrPC do not support prion propagation. Furthermore, N-terminal FLAG-tagged PrPC has been shown to support prion propogation; however, the tag is susceptible to cleavage by endogenous proteases making it unsuitable for tracking. An alternative approach has been to covalently attach fluorophores to WT PrPSc using chemically reactive groups such as NHS esters. However, this approach is not site-specific since reactive compounds such as NHS esters covalently attach to multiple residues, thereby causing nonspecific impacts on PrPSc structure and infectivity. These studies and others highlight the difficulties in specifically labeling PrPSc and other amyloid proteins without disrupting their structure and function.

Many questions in prion biology remain unanswered due in part to our inability to produce specifically modified PrPSc molecules. For example, it is difficult to identify the specific structural motifs within the PrPSc replication interface that regulate infectious amyloid replication. Additionally, the PrPC interactome has been determined, − but the cellular interactome of PrPSc has not been determined. Finally, while several studies have identified critical elements of the prion neuroinvasion pathway, − our inability to produce labeled PrPSc inoculum makes it challenging to longitudinally track the route infectious prions take to invade the central nervous system from peripheral tissues in vivo. To answer these and other questions, it would be valuable to be able to specifically introduce a single conservative, chemically reactive group into PrPC that does not perturb the conformationally sensitive conversion process, which could then be subsequently modified in the PrPSc state.

Genetic code expansion enables selective substitution of noncanonical amino acids (ncAAs) into the primary amino acid sequence of a protein. ncAAs can either be inserted as an already-functionalized reporter, such as a fluorescent ncAA, or as a small, nonfunctionalized reactive handle that allows for post-translational labeling. Substitution of fluorescent ncAAs has been previously used successfully to study α-synuclein but, in some cases, altered aggregation kinetics. , We thought that using a smaller, more versatile handle would be more appropriate for labeling PrPSc, so that the modified substrate could pass through the PrPC-to-PrPSc conversion bottleneck and then be used to specifically modify PrPSc postconversion. We chose the click chemistry-amenable ncAA p-azido-l-phenylalanine (AzF), which can react bio-orthogonally with a chemically diverse library of commercially available alkyne- or dibenzocyclooctyne (DBCO)-containing reporters.

Our lab has developed an in vitro prion formation system in which recombinant PrPC substrate is efficiently converted into PrPSc with high specific infectivity. This system lends itself to metabolic incorporation of noncanonical amino acids (like AzF) into PrPC during bacterial expression, followed by conversion of the ncAA-containing substrate into PrPSc. We can produce both infectious and noninfectious recombinant PrPSc, both with comparable PK resistance and ability to self-propagate, yet differing in their ability to cause disease in animals. − We can modulate the infectivity of PrPSc molecules by either including or excluding phosphatidylethanolamine cofactor during the in vitro conversion reaction, producing infectious cofactor PrPSc or the noninfectious protein-only PrPSc conformers, respectively. , This in vitro prion conversion system is both an ideal tool for producing selectively modified AzF prions and a tractable model to study the biochemical basis of prion infectivity. Therefore, we set out to test whether PrPC containing a specific AzF substitution could pass through the conversion bottleneck in our in vitro conversion system to produce infectious prions that are amenable to click chemistry.

Results and Discussion

AzF-Substituted PrPC Can Convert into Self-Propagating PrPSc

To make a clickable PrP substrate that could potentially be converted into PrPSc, we made the conservative substitution of AzF for PrP residue W99 using amber-codon reassignment in recoded B-95.ΔAΔfabR E. coli , , and purified the resultant recombinant W99AzF PrP as described previously − (herein referred to as AzF PrP). We chose position W99 for our initial substitution because it is within the PK-resistant core of PrPSc44, allowing us to assay for incorporation into PrPSc. Furthermore, residue W99 is solvent-facing in other prion structures, , suggesting potential accessibility to click reagents. To assess how the incorporation of AzF at position W99 of PrPC affects in vitro prion conversion, we tested the ability of AzF PrPC substrate to serially propagate cofactor PrPSc or protein-only PrPSc in continuous shaking reactions. As determined by Western blot, AzF PrPC substrate successfully propagated both conformers without loss of conversion efficiency (Figure , upper panel, lanes 9–11 and 12–14). Furthermore, the proteinase K (PK)-resistant core of each conformer maintained its characteristic molecular weight over three rounds of propagation, demonstrating that AzF PrPSc faithfully templates prion conversion (Figure , upper panel, compare lanes 9–11 with lanes 2–4 for protein-only PrPSc, compare 12–14 with lanes 5–7 for cofactor PrPSc). Collectively, these results show that AzF PrPC substrate can efficiently and faithfully propagate two different PrPSc conformations.

1.

1

Open in a new tab

Effect of AzF incorporation on Prion Strain Stability in vitro Western blot (upper panel) and fluorescent gel (lower panel) showing three serial propagation rounds of WT protein-only PrPSc, WT cofactor PrPSc, AzF protein-only PrPSc, and AzF cofactor PrPSc, as indicated. All reactions were treated with PK except where otherwise indicated (−PK).

AzF-Substituted PrPSc Can Be Clicked after Conversion

We next tested whether we could covalently attach a click reagent to newly formed AzF PrPSc molecules. To do this, we incubated all of the samples in Figure with the large click ligand fluorophore AlexaFluor647-DBCO (AF647-DBCO) and used fluorescent gel imaging to detect AF647-labeled PrP. The results revealed that labeling was specific for AzF-containing PrPSc, with no labeling observed for wild-type (WT) PrPSc (Figure , lower panel, compare lanes 1–7 versus lanes 8–14). Furthermore, clicking AF647-DBCO to AzF PrPSc does not change its PK resistance (Figure , lower panel lanes 8–14). We compared the click efficiency of AF647-DBCO to AzF cofactor PrPSc and AzF protein-only PrPSc to the click efficiency of AzF PrPC (which we used as an 100% reaction standard control). This analysis showed that the labeling efficiency of AF647-DBCO to AzF cofactor PrPSc was ∼50% and that of AzF protein-only PrPSc was ∼100% (Figure S1b). Overall, these data show that both AzF PrPSc conformers can be quickly and specifically reacted with a large click ligand.

AF647-AzF PrPSc Can Seed PrPSc Formation

Given that we can covalently attach the bulky AF647-DBCO group to AzF PrPSc, we next tested whether AF647-AzF PrPSc could act as a seed. To do this, we performed single-round PrPSc conversion reactions using either AF647-AzF protein-only PrPSc or control WT protein-only PrPSc as seeds and either AzF PrPC or WT PrPC as substrates. Attempts to make the AF647-AzF PrPC substrate were unsuccessful, as labeling led to protein precipitation (Figure S2). Western blot analysis of the reaction products shows the presence of PK-resistant PrPSc molecules in reactions seeded with AF647-AzF PrPSc seed (Figure , top panel, lanes 2 and 4). To confirm the formation of new PrPSc molecules from the AzF PrPC substrate, we treated reaction products with BODIPY-DBCO and then used fluorescent gel imaging to discriminate between AF647-AzF PrPSc seed (Figure , middle panel, lanes 1–4) and BODIPY-AzF PrPSc product. The results confirmed that AF647-AzF PrPSc can efficiently seed the conversion of the AzF PrPC substrate into new AzF PrPSc molecules, as evidenced by a robust PK-resistant PrPSc band with a strong BODIPY signal (Figure , bottom panel, lane 2). Moreover, AF647-AzF PrPSc appeared to seed the formation of new PrPSc molecules as efficiently as WT PrPSc. A quantification of BODIPY-AzF PrPSc band intensity in lanes 2 and 6 revealed that the ratio of AzF PrPSc produced by seeding with AF647-AzF PrPSc versus wild-type PrPSc was 1.05, which is consistent with comparable seeding activity between the two conformers (Figure , bottom panel, compare lanes 2 versus lane 6). Control reactions using the WT PrPC substrate showed no BODIPY fluorescence (Figure , bottom panel, lanes 3 and 4 and 7 and 8). Taken together, these results show that AF647-AzF protein-only PrPSc maintains the ability to seed PrPSc conversion reactions despite the presence of a bulky fluorophore at position 99.

2.

2

Open in a new tab

Seeding ability of AF647-AzF PrPSc Western blot (top panel) and fluorescent imaging (middle panel = AF647; bottom panel = BODIPY) of single-round conversion reactions. AzF PrPC or WT PrPC substrates were seeded with either AF647-AzF protein-only PrPSc or WT protein-only PrPSc as indicated, and all products were subsequently labeled with BODIPY-DBCO. Samples were treated with PK where indicated.

AzF Cofactor PrPSc and AF647-AzF Cofactor PrPSc Are Infectious

To assess the infectivity of AzF PrPSc and AF647-AzF PrPSc molecules, we serially propagated AzF cofactor PrPSc, AF647-AzF cofactor PrPSc, and AzF protein-only PrPSc for 26 rounds to dilute out the original round 1 seeds beyond Avogadro’s limit. We then inoculated M109 bank vole PrP knock-in (kiBVM) mice with the products from serial propagation round 26. Mice inoculated with either AzF cofactor PrPSc or AF647-AzF cofactor PrPSc developed clinical signs scrapie with 100% attack rate and incubation times of 197 days (s.d. = 5, n = 8) and 185 days (s.d. = 14, n = 8), respectively (Figure , yellow squares and red inverted triangles), similar to positive control mice inoculated with WT PrPSc (Figure , blue triangles). In contrast, mice inoculated with AzF protein-only PrPSc did not develop scrapie, as shown by the ongoing (>450 days) survival of these mice (Figure , brown squares), similar to negative control mice inoculated with unconverted reaction cocktail (Figure , black crosses).

3.

3

Open in a new tab

Bioassay of AzF PrPSc and AF647-AzF PrPSc infectivity survival curves of kiBVM mice inoculated with various serially propagated PrPSc products, as indicated (n = 7–8 in each group). Mice were monitored daily and sacrificed upon developing clinical signs of scrapie.

Post-mortem, we also examined neuropathology and biochemical properties of the resultant brain-derived PrPSc. Microscopic examination revealed extensive vacuolation in the brains of mice inoculated with AzF cofactor PrPSc and AF647-AzF cofactor PrPSc, consistent with scrapie infection (Figure , see bottom two panels). Furthermore, the degree of vacuolation was similar between these two conformers and WT cofactor PrPSc across various brain regions examined (Figure S3, compare red circle and yellow triangles with blue diamonds). Taken together, these data show that the AzF cofactor PrPSc and AF647-AzF cofactor PrPSc are infectious and display similar patterns of neurotropism.

4.

4

Open in a new tab

Neuropathology of inoculated mice representative hematoxylin and eosin (H&E) stained microscopic images of the cerebral cortex in mice inoculated with AzF protein-only PrPSc, AzF cofactor PrPSc, or AF647-AzF cofactor PrPSc, as indicated.

To directly measure the accumulation of PrPSc in the brains of mice that succumbed to scrapie, we performed Western blots of brain homogenates. The results showed extensive PK-resistant PrPSc formation in the brains of mice inoculated with AzF cofactor PrPSc and AF647-AzF cofactor PrPSc (Figure , lanes 8 and 10), with glycoform profiles similar to that of mice inoculated with WT cofactor PrPSc (Figure , compare lanes 8 and 10 to lane 12). In contrast, no PrPSc was detected in mice inoculated with AzF protein-only PrPSc, negative control mice inoculated with an unconverted AzF PrP substrate, or age-matched uninoculated kiBVM mice (Figure , lanes 2, 4, and 6). Taken together, these data suggest that AzF-substituted prions are infectious, self-propagate in vivo, and retain infectivity when conjugated to a model click ligand.

5.

5

Open in a new tab

In vivo accumulation of PrPScin brains of inoculated mice Western blot of brain homogenates from kiBVM mice inoculated with various serially propagated PrPSc products, as indicated. 2-fold more volume was loaded for +PK samples versus −PK samples. Samples were treated with PK where indicated. See supplemental methods for additional details on sample preparation.

Visualization of Near-Infrared-Labeled PrPSc in Intact Mouse Brain

In order to explore the possible uses of click-conjugated PrPSc, we clicked the near-infrared (NIR) dye Cy7.5-DBCO to AzF protein-only PrPSc (Figure a) and tested its application as a tool for real-time in situ visualization of prions inoculated into animals. We injected Cy7.5-conjugated PrPSc intracerebrally into a mouse at two independent injection sites ∼5 mm apart and employed NIR imaging to determine whether the two inoculation sites could be visualized and resolved. NIR imaging of the intact mouse brain revealed two well-resolved puncta of fluorescent PrPSc, corresponding to each site of Cy7.5-PrPSc injection (Figure b, see arrows). These data show that NIR conjugated PrPSc can be used to visualize and track inoculum in intact tissue.

6.

6

Open in a new tab

Imaging NIR-labeled PrPSc in an intact mouse brain. (A) Fluorescent gel and Western blot of AzF PrPSc clicked with the NIR dye Cy7.5-DBCO. Samples were treated with PK where indicated. (B) Fluorescent image of mouse injected twice intracerebrally with Cy7.5-PrPSc resuspended in 1× PBS (15 μL total, 8.9 μM). Red arrows indicate independent injection sites.

Potential Applications

The AzF cofactor PrPSc can be immediately used to study various properties of infectious prions by clicking to various ligands. For instance, NIR-labeled PrPSc molecules can be used to glean information about how peripherally administered scrapie invades the central nervous system and where scrapie localizes during the initial infection. Additionally, by monitoring for NIR signal disappearance from an animal, AzF prions can be used to measure the lifespan of and initial inoculum in vivo. In trying to understand prion trafficking in vivo, previous studies have had to sacrifice a different animal for each time point during a prion infection. , Significantly, NIR-labeled PrPSc could be used to track the fate of prions injected into a single animal in situ longitudinally.

The AzF cofactor PrPSc could also be used to study the behavior of prions in cells. For instance, the AzF handle could be used to covalently immobilize AzF prions cross-linked to potential interactors from cell lysates to determine the cellular interactome of exogenously applied PrPSc.

The AzF handle also provides a unique tool for the precise manipulation of prions to study the relationship between prion structure and properties such as seeding and infectivity. Utilizing a library of prions with AzF moved throughout the structure, the contribution of each position to key biochemical properties can be isolated.

The breadth of click ligands presents an opportunity for more applications than the few described here. Some additional ligands include antibodies, membrane-targeting lipids, E3 ligases, small-molecule drugs, and FRET-compatible fluorophores.

Limitations

Although the generation of infectious prions amenable to click chemistry represents an important technical advance, there are several limitations to our study. One limitation is that we tested only one residue for AzF substitution. On the basis of the general similarity of their side chain structures, we expect that substitution of many other aromatic residues within the PrP sequence by AzF would also overcome the conversion bottleneck, but it is possible that AzF substitution of some residues would not be tolerated. In any case, the W99AzF cofactor PrPSc itself can be clicked to many different ligands and used for multiple types of studies, such as tracking inoculum in an animal, selective pulldown of infectious AzF inoculum, and fibril replication studies.

Another limitation is that our in vitro propagation system with recombinant PrP substrates cannot, at this time, be used for propagating natural prion strains. , Replication of natural prion strains requires propagation with native PrPC molecules in animals, cells, or brain homogenate protein misfolding cyclic amplification (PMCA) reactions in order to retain strain properties. , However, site-specific ncAA incorporation in mammalian cells is possible, , providing an opportunity to make native AzF prions with natural strain properties. Although our system is only suitable for recombinant prions, it produces PrPSc with high conversion efficiency and with a high level of specific infectivity comparable to natural prion strains. ,

Finally, we observed ∼50% reaction of W99AzF cofactor PrPSc with AF647-DBCO. This incomplete reaction limits our ability to measure the infectivity of AF647-AzF cofactor PrPSc independent of unreacted W99AzF cofactor PrPSc. Due to this limitation, we did not attempt to determine the specific infectivity of AF647-AzF cofactor PrPSc by end-point titration. Given that click chemistry typically results in quantitative labeling and that we obtained ∼100% reaction of W99AzF protein-only PrPSc with AF647-DBCO, we speculate that incomplete labeling of AzF cofactor PrPSc fibrils is not likely due to a technical issue, but rather a consequence of the specific conformation around residue 99 of W99AzF cofactor PrPSc. The repeating nature of prion fibrils could cause neighboring AF647-DBCO groups to sterically and electrostatically clash, which provides a mechanism for varying levels of reaction efficiency between protein-only and AzF cofactor PrPSc. In the case of W99AzF cofactor PrPSc, it is likely that only one bulky AF647-DBCO group can be accommodated in the space between two rungs of the amyloid ladder. Indeed, click reaction efficiency could potentially be used to probe the intermolecular structure of PrPSc fibrils. While complete click reaction is necessary for certain experimental designs, it is not required for experiments such as tracking, selective pulldown, and imaging.

Conclusion

In this paper, we report the first successful production of click chemistry-reactive infectious prions. Substitution of PrP residue W99 with AzF effectively smuggles click potential through the conformationally sensitive conversion process, which has historically stood as a roadblock to converting various modified PrPC substrates into PrPSc. In bypassing the conversion bottleneck, large or otherwise disruptive groups can subsequently be directly attached by click chemistry to infectious AzF PrPsc, making regions that previously were not susceptible to modification available for study.

In addition to being used for studying PrPSc, AzF incorporation could be used to answer longstanding questions about other functional or disease-relevant amyloids. For example, both tau and α-synuclein can be converted from recombinant precursor proteins into a variety of different conformers in vitro. − AzF incorporation is an attractive strategy for investigating how specific structural determinants of tau and α-synuclein amyloid fibrils contribute to strain properties. More generally, our results suggest that AzF incorporation provides a uniquely powerful approach to studying the biology of infectious prions and other amyloid proteins.

Materials and Methods

Ethics Statement

All animals were housed and cared for according to standards set by the Guide for the Care and Use of Laboratory Animals of the National Research Council. All mouse experiments were conducted in accordance with protocol supa.su.1, as reviewed and approved by Dartmouth College’s Institutional Animal Care and Use Committee, operating under the regulations/guidelines of the NIH Office of Laboratory Animal Welfare (assurance number A3259-01).

Cloning of AzF PrP

Recombinant bank vole M109 W99AzF PrP, hereafter termed AzF PrP, was generated through Gibson assembly. An expression construct was made using pET-22b­(+) (Sigma-Aldrich, St. Louis, MO) cut with NdeI/HindIII (New England Biolabs, Ipswich, MA), gel-purified, and used for Gibson Assembly (New England Biolabs, Ipswich, MA) with the bank vole amber-codon-substituted (bolded in sequence below) PrP oligo (IDT, Newark, NJ), codon-optimized for expression in bacteria:

5′-TTGTTTAACTTTAAGAAGGAGATATACATATGAAAAAGCGTCCAAAGCCAGGTGGCTGGAATACGGGGGGTAGTCGTTATCCTGGTCAGGGCTCCCCGGGCGGTAATCGCTATCCGCCGCAAGGCGGGGGTACATGGGGCCAACCACACGGTGGCGGTTGGGGCCAACCTCACGGGGGCGGTTGGGGGCAACCTCATGGCGGTGGGTGGGGTCAACCGCATGGGGGTGGCTGGGGTCAAGGTGGCGGGACTCACAATCAG TAG AACAAGCCTTCTAAACCGAAAACGAATATGAAGCACGTTGCGGGTGCAGCCGCTGCGGGTGCTGTTGTAGGTGGCTTAGGTGGCTACATGCTGGGTTCTGCCATGAGTCGCCCGATGATTCACTTCGGTAATGATTGGGAAGATCGTTATTATCGCGAGAATATGAATCGTTACCCAAATCAGGTCTACTATCGTCCGGTAGACCAGTACAACAATCAGAATAATTTTGTACATGATTGCGTTAATATCACGATTAAACAACATACGGTTACTACTACCACGAAGGGCGAGAATTTTACCGAGACCGACGTCAAGATGATGGAACGCGTAGTCGAGCAAATGTGTGTAACACAGTATCAAAAGGAGAGTCAAGCCTACTATGAGGGTCGCTCATCCTAATAAAAGCTTGCGGCCGCACTCGAGCACCACCACC-3′

The resultant plasmid was transformed into DH5α cells (Invitrogen, Waltham, MA), mini-prepped (Qiagen, Hilden, Germany), and confirmed by sequencing.

Expression of Recombinant AzF PrP

To express AzF PrP, B-95.ΔAΔfabR E. coli, provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. RDB13712), were cotransformed with the AzF PrP plasmid and the pEvol-pAzFRS.2.t1 expression plasmid (Addgene, Watertown, MA), which codes for the tRNA synthetase/tRNA pair necessary for p-azido-l-phenylalanine (AzF) incorporation. , Double transformants were selected on LB agar plates and grown overnight in 2× Yeast Tryptone (2× YT) (Sigma-Aldrich, St. Louis, MO) media at 37 °C. Overnight culture was centrifuged (4200g, 10 min) and resuspended in 3 mL of fresh 2× YT media without antibiotics and used to inoculate 500 mL of 2× YT media. Once the OD600 nm reached 1–3, arabinose was added to a final concentration of 0.2% w/v, AzF was added to a final concentration of 1 mM, and bacteria were incubated for 1 h at 37 °C to induce expression of the tRNA/pAzFRS synthetase pair. After 1 h, protein expression was induced by adding IPTG to a final concentration of 1 mM and bacteria were grown for 8–16 h at 30 °C. Bacteria were pelleted at 16,000g for 10 min.

All steps were done in the presence of 34 μg/mL chloramphenicol and 50 μg/mL ampicillin, unless otherwise noted. All incubation steps were carried out at 230 rpm in a VWR 1585R shaking incubator (VWR, Radnor, PA).

Purification of AzF PrP

AzF PrP was purified using the PrP purification protocol previously described by Makarava and Baskakov, 200847. In brief, bacteria expressing W99AzF PrP were harvested by centrifugation. Cell pellets were resuspended in Bugbuster (MilliporeSigma, Burlington, MA) containing Lysonase (MilliporeSigma, Burlington, MA) and EDTA-free protease inhibitor (Roche, Indianapolis, IN) and intermittently sonicated for 30 s every 5 min for 30 min total using a hand-held sonicator at setting 8.5 (Sonopuls Amtrex, St-Laurent, QC). Inclusion bodies containing PrP were isolated by centrifuging cell lysate at 16,000g for 20 min and resuspending with BugBuster a total of three times. PrP inclusion bodies were solubilized in a buffer containing urea and PrP was purified through nickel-affinity chromatography, followed by size-exclusion chromatography. Reverse-phase (C4) HPLC (Sepax Technologies, Inc., Newark, DE) was performed to yield pure AzF PrP. PrP eluate from the C4 column was lyophilized and frozen at −20 °C for long-term storage. Importantly, no glutathione was used in the purification process due to its capacity to reduce the azide group.

In Vitro Conversion of AzF PrPC into PrPSc

Prior to use, lyophilized AzF PrPC was resuspended in water to a concentration of 0.12 mg mL–1 and was used to make substrate cocktail for PrPSc conversion as described by Walsh et al. In brief, the substrate cocktails contain PrP (6ug/mL) and reaction buffer composed of NaCl (135 mM), EDTA (5 mM), Triton X-100 (0.15%), Tris buffer (20 mM, pH 7.5), and lipid cofactor (optional, 10–20%). In vitro conversion reactions were initiated by adding 100 μL of 6 μg/mL PrPSc (in reaction buffer) to 400 μL of substrate shaking cocktail and shaken for 72 h. For serial propagations, 100 μL of the newly converted PrPSc was used to seed a new 400 μL shaking cocktail to start the next round of serial propagation. AzF cofactor PrPSc was produced through seeding the cofactor-containing AzF PrPC substrate cocktail with WT cofactor PrPSc followed by 26 rounds of serial propagation. AzF protein-only PrPSc was produced in parallel by seeding the AzF PrPC substrate with WT protein-only PrPSc and propagating in the absence cofactor. All propagation reactions were performed while continuously shaking for 72 h at 37 °C at 2000 rpm in a 3 mm orbit Ohaus shaker (Parsippany, NJ).

Click Reactions with AzF PrP

After PrPSc propagation, the in vitro prion conversion reaction was centrifuged and the supernatant was aspirated to remove soluble PrPC. The PrPSc pellet was sonicated for 30 s, 160 W, at RT in a QSonica sonicator to break up the pellet (Misonix Model 3000, Farmingdale, NY). DBCO-dyes were resuspended according to manufacturer recommendations (AF647-DBCO, JenaBioscience, Thuringia, Germany; BODIPY-FL-PEG4-DBCO, JenaBioscience, Thuringia, Germany; Cy7.5-DBCO, RuixiBio, Xi’an City, China). Click reactions were performed with an AzF PrPSc concentration of 30 μg/mL and a 20-fold molar excess of DBCO-dye in a total volume of 100 μL. The click reaction was allowed to proceed for 1 h at 25 °C while shaking at 750 rpm (Ohaus, Parsippany, NJ). To remove excess DBCO-dye, the reaction was diluted 10-fold with 1× PBS + 0.1% Triton X-100, sonicated, centrifuged, and aspirated. This washing process was repeated a total of three times to yield a washed protein pellet.

All centrifugation steps were done at 18,000g for 30 min at 25 °C.

Supplementary Material

cb6c00288_si_001.pdf (169.4KB, pdf)

Acknowledgments

We would like to thank Dr. Daniel Walsh for helpful advice on protein purification protocols. We would also like to thank Dr. Kensaku Sakamoto from the RIKEN Center for Life Science Technologies for providing the B-95.ΔAΔfabR E. coli.

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acschembio.6c00288.

  • Additional experimental details, materials, and methods; and data, including determination of click efficiency of protein-only and cofactor AzF PrPSc (Figure S1); insolubility of AF647-AzF PrPC (Figure S2); and neuropathology of mice inoculated with AzF PrPSc and AF647-AzF PrPSc (Figure S3). (PDF)

§.

R.G.C. and J.N.I. contributed equally to this work. J.N.I. Investigation, methodology, validation, formal analysis, visualization, writingoriginal draft, writingreview and editing. R.G.C. Investigation, methodology, validation, formal analysis, visualization, writingoriginal draft, writingreview and editing. A.M.S. Methodology, writingreview and editing. S.S. Investigation, methodology, conceptualization, supervision, project administration, funding acquisition.

This study was funded by the National Institute for Neurological Diseases and Stroke (1R37NS125431, R01NS117276, and R01NS118796 to S.S.) and the National Institutes of Health (P20-GM113132 to Dean Madden).

The authors declare no competing financial interest.

References

  1. Prusiner S. B.. Novel proteinaceous infectious particles cause scrapie. Science. 1982;216(4542):136–144. doi: 10.1126/science.6801762. [DOI] [PubMed] [Google Scholar]
  2. Prusiner S. B.. Prions. Proc. Natl. Acad. Sci. U.S.A. 1998;95(23):13363–13383. doi: 10.1073/pnas.95.23.13363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bruce M. E., Will R. G., Ironside J. W., McConnell I., Drummond D., Suttie A., McCardle L., Chree A., Hope J., Birkett C.. et al. Transmissions to mice indicate that ’new variant’ CJD is caused by the BSE agent. Nature. 1997;389(6650):498–501. doi: 10.1038/39057. [DOI] [PubMed] [Google Scholar]
  4. Gambetti P., Parchi P., Petersen R. B., Chen S. G., Lugaresi E.. Fatal familial insomnia and familial Creutzfeldt-Jakob disease: clinical, pathological and molecular features. Brain Pathol. 1995;5(1):43–51. doi: 10.1111/j.1750-3639.1995.tb00576.x. [DOI] [PubMed] [Google Scholar]
  5. Minikel E. V., Vallabh S. M., Lek M., Estrada K., Samocha K. E., Sathirapongsasuti J. F., McLean C. Y., Tung J. Y., Yu L. P., Gambetti P.. et al. Quantifying prion disease penetrance using large population control cohorts. Sci. Transl. Med. 2016;8(322):322ra329. doi: 10.1126/scitranslmed.aad5169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Hsiao K., Meiner Z., Kahana E., Cass C., Kahana I., Avrahami D., Scarlato G., Abramsky O., Prusiner S. B., Gabizon R.. Mutation of the prion protein in Libyan Jews with Creutzfeldt-Jakob disease. N. Engl. J. Med. 1991;324(16):1091–1097. doi: 10.1056/NEJM199104183241604. [DOI] [PubMed] [Google Scholar]
  7. Kraus A., Hoyt F., Schwartz C. L., Hansen B., Artikis E., Hughson A. G., Raymond G. J., Race B., Baron G. S., Caughey B.. High-resolution structure and strain comparison of infectious mammalian prions. Mol. Cell. 2021;81(21):4540–4551. doi: 10.1016/j.molcel.2021.08.011. [DOI] [PubMed] [Google Scholar]
  8. Caughey B., Standke H. G., Artikis E., Hoyt F., Kraus A.. Pathogenic prion structures at high resolution. PLoS Pathog. 2022;18(6):e1010594. doi: 10.1371/journal.ppat.1010594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hoyt F., Alam P., Artikis E., Schwartz C. L., Hughson A. G., Race B., Baune C., Raymond G. J., Baron G. S., Kraus A., Caughey B.. Cryo-EM of prion strains from the same genotype of host identifies conformational determinants. PLoS Pathog. 2022;18(11):e1010947. doi: 10.1371/journal.ppat.1010947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hoyt F., Standke H. G., Artikis E., Schwartz C. L., Hansen B., Li K., Hughson A. G., Manca M., Thomas O. R., Raymond G. J.. et al. Cryo-EM structure of anchorless RML prion reveals variations in shared motifs between distinct strains. Nat. Commun. 2022;13(1):4005. doi: 10.1038/s41467-022-30458-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Manka S. W., Zhang W., Wenborn A., Betts J., Joiner S., Saibil H. R., Collinge J., Wadsworth J. D. F.. 2.7 A cryo-EM structure of ex vivo RML prion fibrils. Nat. Commun. 2022;13(1):4004. doi: 10.1038/s41467-022-30457-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Manka S. W., Wenborn A., Betts J., Joiner S., Saibil H. R., Collinge J., Wadsworth J. D. F.. A structural basis for prion strain diversity. Nat. Chem. Biol. 2023;19:607. doi: 10.1038/s41589-022-01229-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Galkin A. P., Mitkevich V. A., Makarov A. A., Valina A. A., Sysoev E. I.. Pathological and Functional Brain Amyloids: A New Concept Explaining the Differences. Int. J. Mol. Sci. 2025;26(21):10459. doi: 10.3390/ijms262110459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Liebman S. W., Chernoff Y. O.. Prions in yeast. Genetics. 2012;191(4):1041–1072. doi: 10.1534/genetics.111.137760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Eisenberg D., Jucker M.. The amyloid state of proteins in human diseases. Cell. 2012;148(6):1188–1203. doi: 10.1016/j.cell.2012.02.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Sawaya M. R., Hughes M. P., Rodriguez J. A., Riek R., Eisenberg D. S.. The expanding amyloid family: Structure, stability, function, and pathogenesis. Cell. 2021;184(19):4857–4873. doi: 10.1016/j.cell.2021.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Seuma M., Lehner B., Bolognesi B.. An atlas of amyloid aggregation: the impact of substitutions, insertions, deletions and truncations on amyloid beta fibril nucleation. Nat. Commun. 2022;13(1):7084. doi: 10.1038/s41467-022-34742-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Marin-Argany M., Guell-Bosch J., Blancas-Mejia L. M., Villegas S., Ramirez-Alvarado M.. Mutations can cause light chains to be too stable or too unstable to form amyloid fibrils. Protein Sci. 2015;24(11):1829–1840. doi: 10.1002/pro.2790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Goold R., Rabbanian S., Sutton L., Andre R., Arora P., Moonga J., Clarke A. R., Schiavo G., Jat P., Collinge J., Tabrizi S.. Rapid cell-surface prion protein conversion revealed using a novel cell system. Nat. Commun. 2011;2:281. doi: 10.1038/ncomms1282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Roberti M. J., Bertoncini C. W., Klement R., Jares-Erijman E. A., Jovin T. M.. Fluorescence imaging of amyloid formation in living cells by a functional, tetracysteine-tagged alpha-synuclein. Nat. Methods. 2007;4(4):345–351. doi: 10.1038/nmeth1026. [DOI] [PubMed] [Google Scholar]
  21. Zhang F. P., Zhang J., Zhou W., Zhang B. Y., Hung T., Dong X. P.. Expression of PrP­(C) as HIS-fusion form in a baculovirus system and conversion of expressed PrP-sen to PrP-res in a cell-free system. Virus Res. 2002;87(2):145–153. doi: 10.1016/S0168-1702(02)00089-8. [DOI] [PubMed] [Google Scholar]
  22. Salamat K., Moudjou M., Chapuis J., Herzog L., Jaumain E., Beringue V., Rezaei H., Pastore A., Laude H., Dron M.. Integrity of helix 2-helix 3 domain of the PrP protein is not mandatory for prion replication. J. Biol. Chem. 2012;287(23):18953–18964. doi: 10.1074/jbc.M112.341677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Bian J., Nazor K. E., Angers R., Jernigan M., Seward T., Centers A., Green M., Telling G. C.. GFP-tagged PrP supports compromised prion replication in transgenic mice. Biochem. Biophys. Res. Commun. 2006;340(3):894–900. doi: 10.1016/j.bbrc.2005.12.085. [DOI] [PubMed] [Google Scholar]
  24. Barmada S. J., Harris D. A.. Visualization of prion infection in transgenic mice expressing green fluorescent protein-tagged prion protein. J. Neurosci. 2005;25(24):5824–5832. doi: 10.1523/JNEUROSCI.1192-05.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Magalhães A. C., Baron G. S., Lee K. S., Steele-Mortimer O., Dorward D., Prado M. A., Caughey B.. Uptake and neuritic transport of scrapie prion protein coincident with infection of neuronal cells. J. Neurosci. 2005;25(21):5207–5216. doi: 10.1523/JNEUROSCI.0653-05.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Silva C. J., Erickson-Beltran M. L., Dynin I. C.. Quantifying the Role of Lysine in Prion Replication by Nano-LC Mass Spectrometry and Bioassay. Front. Bioeng. Biotechnol. 2020;8:562953. doi: 10.3389/fbioe.2020.562953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Watts J. C., Huo H., Bai Y., Ehsani S., Jeon A. H., Shi T., Daude N., Lau A., Young R., Xu L.. et al. Interactome analyses identify ties of PrP and its mammalian paralogs to oligomannosidic N-glycans and endoplasmic reticulum-derived chaperones. PLoS Pathog. 2009;5(10):e1000608. doi: 10.1371/journal.ppat.1000608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Arshad H., Eid S., Mehra S., Williams D., Kaczmarczyk L., Stuart E., Jackson W. S., Schmitt-Ulms G., Watts J. C.. The brain interactome of a permissive prion replication substrate. Neurobiol. Dis. 2025;206:106802. doi: 10.1016/j.nbd.2025.106802. [DOI] [PubMed] [Google Scholar]
  29. Williams D., Mehrabian M., Arshad H., Eid S., Sackmann C., Zhao W., Wang X., Ghodrati F., Verkuyl C. E., Watts J. C., Schmitt-Ulms G.. The cellular prion protein interacts with and promotes the activity of Na,K-ATPases. PLoS One. 2021;16(11):e0258682. doi: 10.1371/journal.pone.0258682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Rutishauser D., Mertz K. D., Moos R., Brunner E., Rulicke T., Calella A. M., Aguzzi A.. The comprehensive native interactome of a fully functional tagged prion protein. PLoS One. 2009;4(2):e4446. doi: 10.1371/journal.pone.0004446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ghodrati F., Mehrabian M., Williams D., Halgas O., Bourkas M. E. C., Watts J. C., Pai E. F., Schmitt-Ulms G.. The prion protein is embedded in a molecular environment that modulates transforming growth factor beta and integrin signaling. Sci. Rep. 2018;8(1):8654. doi: 10.1038/s41598-018-26685-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Schmitt-Ulms G., Hansen K., Liu J., Cowdrey C., Yang J., DeArmond S. J., Cohen F. E., Prusiner S. B., Baldwin M. A.. Time-controlled transcardiac perfusion cross-linking for the study of protein interactions in complex tissues. Nat. Biotechnol. 2004;22(6):724–731. doi: 10.1038/nbt969. [DOI] [PubMed] [Google Scholar]
  33. Zafar S., Shafiq M., Younas N., Schmitz M., Ferrer I., Zerr I.. Prion Protein Interactome: Identifying Novel Targets in Slowly and Rapidly Progressive Forms of Alzheimer’s Disease. J. Alzheimers Dis. 2017;59(1):265–275. doi: 10.3233/JAD-170237. [DOI] [PubMed] [Google Scholar]
  34. Petrakis S., Sklaviadis T.. Identification of proteins with high affinity for refolded and native PrPC. Proteomics. 2006;6(24):6476–6484. doi: 10.1002/pmic.200600103. [DOI] [PubMed] [Google Scholar]
  35. Wadsworth J. D., Joiner S., Hill A. F., Campbell T. A., Desbruslais M., Luthert P. J., Collinge J.. Tissue distribution of protease resistant prion protein in variant Creutzfeldt-Jakob disease using a highly sensitive immunoblotting assay. Lancet. 2001;358(9277):171–180. doi: 10.1016/S0140-6736(01)05403-4. [DOI] [PubMed] [Google Scholar]
  36. Prinz M., Heikenwalder M., Junt T., Schwarz P., Glatzel M., Heppner F. L., Fu Y. X., Lipp M., Aguzzi A.. Positioning of follicular dendritic cells within the spleen controls prion neuroinvasion. Nature. 2003;425(6961):957–962. doi: 10.1038/nature02072. [DOI] [PubMed] [Google Scholar]
  37. Montrasio F., Frigg R., Glatzel M., Klein M. A., Mackay F., Aguzzi A., Weissmann C.. Impaired prion replication in spleens of mice lacking functional follicular dendritic cells. Science. 2000;288(5469):1257–1259. doi: 10.1126/science.288.5469.1257. [DOI] [PubMed] [Google Scholar]
  38. Majekodunmi T., Britton D., Montclare J. K.. Engineered Proteins and Materials Utilizing Residue-Specific Noncanonical Amino Acid Incorporation. Chem. Rev. 2024;124(15):9113–9135. doi: 10.1021/acs.chemrev.3c00855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Haney C. M., Cleveland C. L., Wissner R. F., Owei L., Robustelli J., Daniels M. J., Canyurt M., Rodriguez P., Ischiropoulos H., Baumgart T.. et al. Site-Specific Fluorescence Polarization for Studying the Disaggregation of alpha-Synuclein Fibrils by Small Molecules. Biochemistry. 2017;56(5):683–691. doi: 10.1021/acs.biochem.6b01060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Shimogawa M., Petersson E. J.. New strategies for fluorescently labeling proteins in the study of amyloids. Curr. Opin. Chem. Biol. 2021;64:57–66. doi: 10.1016/j.cbpa.2021.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Deleault N. R., Piro J. R., Walsh D. J., Wang F., Ma J., Geoghegan J. C., Supattapone S.. Isolation of phosphatidylethanolamine as a solitary cofactor for prion formation in the absence of nucleic acids. Proc. Natl. Acad. Sci. U.S.A. 2012;109(22):8546–8551. doi: 10.1073/pnas.1204498109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Deleault N. R., Walsh D. J., Piro J. R., Wang F., Wang X., Ma J., Rees J. R., Supattapone S.. Cofactor molecules maintain infectious conformation and restrict strain properties in purified prions. Proc. Natl. Acad. Sci. U.S.A. 2012;109(28):E1938–E1946. doi: 10.1073/pnas.1206999109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Burke C. M., Walsh D. J., Steele A. D., Agrimi U., Di Bari M. A., Watts J. C., Supattapone S.. Full restoration of specific infectivity and strain properties from pure mammalian prion protein. PLoS Pathog. 2019;15(3):e1007662. doi: 10.1371/journal.ppat.1007662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Noble G. P., Wang D. W., Walsh D. J., Barone J. R., Miller M. B., Nishina K. A., Li S., Supattapone S.. A Structural and Functional Comparison Between Infectious and Non-Infectious Autocatalytic Recombinant PrP Conformers. PLoS Pathog. 2015;11(6):e1005017. doi: 10.1371/journal.ppat.1005017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Mukai T., Hoshi H., Ohtake K., Takahashi M., Yamaguchi A., Hayashi A., Yokoyama S., Sakamoto K.. Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 2015;5:9699. doi: 10.1038/srep09699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Amiram M., Haimovich A. D., Fan C., Wang Y. S., Aerni H. R., Ntai I., Moonan D. W., Ma N. J., Rovner A. J., Hong S. H.. et al. Evolution of translation machinery in recoded bacteria enables multi-site incorporation of nonstandard amino acids. Nat. Biotechnol. 2015;33(12):1272–1279. doi: 10.1038/nbt.3372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Makarava N., Baskakov I. V.. Expression and purification of full-length recombinant PrP of high purity. Methods Mol. Biol. 2008;459:131–143. doi: 10.1007/978-1-59745-234-2_10. [DOI] [PubMed] [Google Scholar]
  48. Makarava N., Savtchenko R., Baskakov I. V.. Purification and Fibrillation of Full-Length Recombinant PrP. Methods Mol. Biol. 2017;1658:3–22. doi: 10.1007/978-1-4939-7244-9_1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wang F., Wang X., Yuan C. G., Ma J.. Generating a Prion with Bacterially Expressed Recombinant Prion Protein. Science. 2010;327(5969):1132–1135. doi: 10.1126/science.1183748. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Walsh D. J., Schwind A. M., Noble G. P., Supattapone S.. Conformational diversity in purified prions produced in vitro. PLoS Pathog. 2023;19(1):e1011083. doi: 10.1371/journal.ppat.1011083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Bartz J. C., Kincaid A. E., Bessen R. A.. Retrograde transport of transmissible mink encephalopathy within descending motor tracts. J. Virol. 2002;76(11):5759–5768. doi: 10.1128/JVI.76.11.5759-5768.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Bartz J. C., Kincaid A. E., Bessen R. A.. Rapid prion neuroinvasion following tongue infection. J. Virol. 2003;77(1):583–591. doi: 10.1128/JVI.77.1.583-591.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Castilla J., Morales R., Saa P., Barria M., Gambetti P., Soto C.. Cell-free propagation of prion strains. EMBO J. 2008;27(19):2557–2566. doi: 10.1038/emboj.2008.181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Chen P. R., Groff D., Guo J., Ou W., Cellitti S., Geierstanger B. H., Schultz P. G.. A facile system for encoding unnatural amino acids in mammalian cells. Angew. Chem., Int. Ed. 2009;48(22):4052–4055. doi: 10.1002/anie.200900683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Jakob L., Gust A., Grohmann D.. Evaluation and optimization of unnatural amino acid incorporation and bioorthogonal bioconjugation for site-specific fluorescent labelling of proteins expressed in mammalian cells. Biochem. Biophys. Rep. 2019;17:1–9. doi: 10.1016/j.bbrep.2018.10.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Supattapone S.. Synthesis of High Titer Infectious Prions with Cofactor Molecules. J. Biol. Chem. 2014;289(29):19850–19854. doi: 10.1074/jbc.R113.511329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Prusiner S. B., Hadlow W. J., Eklund C. M., Race R. E., Cochran S. P.. Sedimentation characteristics of the scrapie agent from murine spleen and brain. Biochemistry. 1978;17(23):4987–4992. doi: 10.1021/bi00616a020. [DOI] [PubMed] [Google Scholar]
  58. So R. W. L., Watts J. C.. alpha-Synuclein Conformational Strains as Drivers of Phenotypic Heterogeneity in Neurodegenerative Diseases. J. Mol. Biol. 2023;435(12):168011. doi: 10.1016/j.jmb.2023.168011. [DOI] [PubMed] [Google Scholar]
  59. So R. W. L., Frieg B., Camino J. D., Situ C., Metri M. N., Silver N. R. G., Li L. Y., Mao A., Stuart E., Schroder G. F.. et al. Stochastic misfolding drives the emergence of distinct alpha-synuclein strains. Neuron. 2026;114:1951. doi: 10.1016/j.neuron.2026.01.014. [DOI] [PubMed] [Google Scholar]
  60. Lövestam S., Koh F. A., van Knippenberg B., Kotecha A., Murzin A. G., Goedert M., Scheres S. H. W.. Assembly of recombinant tau into filaments identical to those of Alzheimer’s disease and chronic traumatic encephalopathy. eLife. 2022;11:e76494. doi: 10.7554/eLife.76494. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

cb6c00288_si_001.pdf (169.4KB, pdf)

Articles from ACS Chemical Biology are provided here courtesy of American Chemical Society

RESOURCES