Association between Ca_v3 channel upregulation in spiral ganglion neurons and age-dependent hearing loss

Abstract

Ca_v3 channels play a critical role in maintaining calcium homeostasis, and its dysregulation is related to age-related diseases, such as age-related hearing loss (AHL). However, the underlying mechanism of the Ca_v3 channels involved in AHL remains unknown. Previous studies have shown that the degeneration of spiral ganglion neurons (SGNs) plays a critical role in AHL. Here, we explored the involvement of Ca_v3 channels in the dysregulation of SGNs in AHL. We used C57BL/6 mice as the AHL mouse model and found that the expression of Ca_v3 channels was increased in SGNs associated with age. The three subtypes of Ca_v3 channels were present in the apical, middle, and basal SGNs from young and older (AHL) mice. The immunostaining data suggest that Ca_v3.1 and Ca_v3.2 may contribute to Ca_v3 upregulation in SGNs of AHL mice.

Additionally, we found that calpain-2 and apoptosis-inducing factor (AIF) were activated in SGNs from AHL mice. The inhibition of Ca_v3 channels or calpain-2 reduced AIF-activation in SGNs may affect neuronal survival. In conclusion, the findings suggest that Ca_v3 channels are upregulated in SGNs from AHL mice that may contribute to the degeneration of SGNs through the calpain-2-AIF apoptosis pathway in AHL mice.

Introduction

Calcium homeostasis is vital for maintaining and regulating cell function. Dysregulation of calcium homeostasis is one of the major contributors to age-related disease [1]. Voltage-gated calcium channels (VGCCs) are essential for maintaining calcium homeostasis and controlling many critical physiological processes, including the release of neurotransmitters and hormones, cell migration, neuronal excitability, and apoptosis [2, 3].

VGCCs are multi-subunit membrane proteins that are present in a variety of cells and tissues. They are also classified into high-voltage activated (HVA) and low-voltage activated (LVA) calcium channels according to their activation voltages. Ca_v3 calcium channels, known as T-type calcium channels, belong to the LVA calcium channels. Additionally, there are three subtypes of Ca_v3 channels: Ca_v3.1, Ca_v3.2, and Ca_v3.3, encoded by CACNA1G, CACNA1H, and CACNA1I genes, respectively [4], they play crucial roles in the regulation of cytosolic Ca²⁺ concentration. Dysfunction of Ca_v3 channels is associated with pathophysiological conditions, such as epilepsy, neuropathic pain, arrhythmia, and cancer [5–7]. The Ca_v3 channel blocker ethosuximide has recently been demonstrated to improve hearing thresholds in age-related hearing loss (AHL) mouse models, suggesting that the Ca_v3 dysfunction may contribute to AHL [8, 9]. Nevertheless, the underlying mechanism of the Ca_v3 involved in AHL is still unknown.

AHL is the most common sensory disorder in the elderly population [10]. It is characterized by decreased high-frequency hearing sensitivity and refers to the symmetry and progressive age-dependent decline of the binaural auditory function. AHL affects tens of millions of people worldwide. The most common complaint of persons with AHL is difficulty understanding speech in noisy environments. Hearing disability may reduce older adults’ communication, resulting in psychiatric disorders like social isolation and depression [11]. Recent studies have identified AHL as a high-risk factor for cognitive decline, including dementia and Alzheimer’s disease (AD). [12, 13]. It has been shown that the degeneration of spiral ganglion neurons (SGNs) plays a critical role in AHL. SGNs, located in the cochlea, are the first relay afferent neurons of the auditory system. SGNs establish a vital link between cochlear hair cells and the central auditory nuclei in the brainstem. The primary auditory neuron response to neurotransmitter activation from cochlear hair cells and then transmits action potentials to the brain [14, 15]. Degeneration of SGN may break up the auditory transmission pathway and result in hearing impairment. The three subtypes of Ca_v3 are expressed in SGNs [8, 16, 17]. Thus, it is necessary to explore the role of Ca_v3 in SGNs.

To investigate how Ca_v3 channels affect SGN function and contribute to age-related SGN degeneration during AHL, we examined the Ca_v3 expression and its role in regulating apoptosis-related factors associated with SGNs from young and AHL mice. We used the C57BL/6 mice strain in the present study, hereafter referred to as C57, which exhibits progressive age-related hearing loss in an AHL mouse model [18, 19]. Our data indicated that the expression of Ca_v3 channels was increased in SGNs associated with age. Additionally, we found that calpain-2 and apoptosis-inducing factor (AIF) were activated in SGNs from AHL mice. Inhibition of Ca_v3 channels or calpain-2 may reduce AIF-induced SGN apoptosis. These findings suggest that upregulation of Ca_v3 channels may induce degeneration of SGNs through the calpain-2-AIF apoptosis pathway, which may contribute to AHL.

Materials and Methods

Animals

Experiments were performed following protocols approved by the Animal Care and Ethical Committee of Hebei Medical University (Shijiazhuang, China). All C57BL/6 mice and BALB/c mice were purchased from Beijing Vitalriver Laboratory Animal Co (Beijing, China). The mice were bred in-house under a 12:12 h light-dark cycle.

Auditory brainstem response (ABR) testing

ABR was performed to evaluate mice’s auditory function in different groups, including the young and aged C57BL/6 mice and BALB/c mice. Mice were anesthetized, using 100-mg ketamine and 20-mg xylazine/kg body weight (intra-peritoneum (IP) injection). Platinum needle electrodes were subcutaneously placed behind the right ear (active), at the vertex (reference), and in the back (ground). The TDT system (Tucker-Davis Technologies, Gainsville, FL, USA) was used to test the ABR threshold. The stimulus levels of sound were presented from 90 dB SPL to 20 dB SPL in steps of 10-dB SPL at 8, 12, 16, 20, 24, 28, and 32 kHz. The lowest intensity to generate a reproducible ABR waveform was defined as the hearing threshold.

SGNs Morphometry and Counting

The cochleae sections were stained with hematoxylin and eosin and then observed under a light microscope. For quantification of SGN density, five sections were randomly chosen from each mouse. SGN numbers were counted in the apex, middle, and base of the cochlea from each section. In each group, 5-6 mice were used for histopathological assessment. SGN density was calculated using the Image-Pro Plus 6.0 software.

RT-PCR analysis

Total RNA from five mice cochlea in each sample was extracted using the TRI reagent (Takara Bio Inc., Shiga, Japan). DNase I was added to the final step of extraction to avoid any DNA contamination. The solution was then incubated in a water bath for 20 min at 37 °C to digest the DNase in tissues and then heated to 100 °C to destroy DNase I. After detection of the RNA quality by determining ribosomal RNA integrity with 2% agarose gels (Invitrogen, CA, USA), 1000 ng of RNA was synthesized to cDNA using random hexamers and superscript II reverse transcriptase as instructed in the PrimeScript^™ RT reagent Kit (Takara Bio Inc., Dalian, China). GAPDH was used as the housekeeping gene to facilitate normalization. Amplification was performed with the forward and reversed PCR oligonucleotide primers, and the chosen sequences of primers are listed as follows:

Ca_v3.1-F: AATGGCAAGTCGGCTTCAGG;

Ca_v3.1-R: TGTCAGAGACCATGGACACCAG;

Ca_v3.2-F: ATGTTCCGGCCCTGTGAGG A;

Ca_v3.2-R: CCATGACGTAGTACATGATGTCC;

Ca_v3.3-F: ATCTGCTCCCTGTCGG;

Ca_v3.3-R: GAGAACTGGGTCGCTATG;

GAPDH-F: CC TGGCCAAGGTCATCCATGACAAC;

GAPDH-R: TGTCATACCAGGAAATGAGCTTGAC.

Total amplification system of 20 μl contained 12.5 μl Premix Ex Taq II (2×), 1× PCR buffer, 0.5 μM of each PCR primer, and 2-ng of cDNA. The PCR reaction of the TB GREEN Kit (Takara Bio Inc., Dalian, China) was carried out with a two-step cycling program. The steps were DNA polymerase at 95 °C for 5 min, followed by 40 cycles (95 °C for 5 s, 56 °C for 25 s, and 72 °C for 30 s) using a Bio-Rad CFX Connect Real-Time PCR system. The number of PCR cycles was measured and automatically determined when the fluorescence intensity threshold exceeded the preset level. The different expression levels of RNA between the young and old groups were selected from their number of PCR cycles and normalized by calculating with GAPDH using the formula 2^−ΔΔCt.

Immunostaining

Mouse cochleae were removed and kept in 4% paraformaldehyde in phosphate buffer saline (PBS) overnight at 4°C. The preparation was decalcified in 10% EDTA for 2-3 days. Following decalcification, the cochleae were placed in 10% and 30% sucrose solution in 0.1 M PBS overnight at 4°C and embedded with Tissue-Freezing medium Optimal Cutting Temperature (OCT) compound (Leica, Germany). Frozen specimens were sectioned at 10-μm thickness along the axis of the cochleae.

Sections were rinsed with PBS for 10 min, permeabilized in 0.3% Triton X-100 for 60 min, and then blocked with 10% goat serum and 1% bovine serum albumin 30 min at 37 °C. The specimens were incubated with primary antibodies overnight at 4 °C. The primary antibodies used were rabbit anti-Ca_v3.1, anti-Ca_v3.2, anti-Ca_v3.3 (Alomone Labs), rabbit anti-γH2AX (Cell Signaling Technology), rabbit anti-calpain-1 (Cell Signaling Technology), rabbit anti-calpain-2 (Abcam), rabbit anti-AIF(Gene Tex), and mouse anti-Tuj1 (Biolegend). Sections were rinsed with PBS, followed by incubation with the appropriate Alexa Fluor-conjugated fluorescent secondary antibodies for 90 min at RT. The slides were rinsed with PBS three times and treated with DAPI to label the nuclei. Slides were mounted with Antifade Mount (ProLong^™, Invitrogen, CA, USA). Preparations were visualized, and images were obtained using confocal laser scanning microscopy (Leica, Wetzlar, Germany).

SGNs culture

SGNs were isolated from the mouse inner ear following a detailed procedure outlined in a previous study (Lv et al., 2010). Five C57 mice are required for each cell culture. For the young group, we used 2-3-month-old mice, and for the AHL group, we used 9-10-month-old mice. Briefly, mice were sacrificed, and the temporal bones were removed in a solution containing MEM with HBSS (Invitrogen) supplemented with 0.2 g/L kynurenic acid, 10-mM MgCl₂, and 2% fetal bovine serum (FBS; v/v). The SGN tissue was dissected and split into apical and basal segments across the modiolar axis. The apical and basal tissues were digested separately in an enzyme mixture containing collagenase type I (1 mg/mL) and DNase (1 mg/mL) at 37 °C for 15 min. After gentle trituration, the tissue was centrifuged at 2,000 rpm for 5 min. The cell pellets then were reconstituted in 0.5 mL culture media (Neurobasal A) supplemented with 2% B27 (v/v), 0.5 mM L-glutamine, and 100 units/mL penicillin. SGNs were filtered through a 40-mm cell strainer and plated onto a 4-well dish. Cells were cultured for 48–72 h for further experiments.

Electrophysiology

Whole-cell Ca²⁺ currents in spiral ganglion neurons were recorded using the voltage-clamp technique with an Axopatch 200B amplifier (Molecular Devices, CA, USA) at room temperature (25 °C). The electrode (3-4 MΩ) was filled with an internal solution containing the following (in mM): EGTA 5, ATP-Mg 5, HEPES 10, CsCl 60 and NMDG 60; pH 7.2 (adjusted with HCl). The external solution consisted of the following (in mM): CsCl 5, CaCl₂ 2, MgCl₂ 2, HEPES 10, Glucose 10, 4-AP 5, TEA-Cl 20, Choline Cl 105; pH 7.2 (adjusted with HCl). HVA Ca²⁺ currents were recorded from a holding potential of −60 mV to potentials between −50 mV and +30 mV in 10-mV increments. T-type Ca²⁺ currents were generated from −90 mV holding potential and stepped from −90 to −40 mV. Series resistance and capacitance compensation (>70%) were performed, and traces were filtered at 2 kHz with a low-pass Bessel filter and digitized at ⩾20 kHz using a 12-bit acquisition system.

Data analyses were performed using the pClamp 10.0 (Molecular Devices, CA, USA) and Origin 8.2 software (MicroCal Inc.). Where appropriate, pooled data are presented as mean ± SD.

Western blot analysis

The whole cochleae tissue (5 mice per sample) was swiftly transferred to the lysis buffer containing 25 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% sodium deoxycholate, 1% SDS, and protease inhibitor cocktail on ice. After homogenization, lysates were ultrasonicated for 5 min, followed by placing on ice for 60 min. Total tissue lysates were centrifuged at 12000 × g for 20 min at 4°C. Supernatants were quantified with a BCA Kit, and 50 μg of protein/lane was loaded after immediately denaturing with 5× loading buffer for 5 min at 95 °C. A whole-tissue protein of cochleae was fractionated using 12% SDS-PAGE. The blot was transferred onto polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). The blotting membranes were blocked in 5% skimmed fat milk in TBST for 2 h at room temperature and then rinsed three times with TBST for 10 min each time. The blocked blots were probed with the indicated specific antibodies overnight on a rocker at 4°C. After rinsing three times with TBST, the blotting membranes were incubated with 800CW (LI-COR, USA) on a rocker for 90 min at room temperature and subsequently rinsed three times TBST. The immunoreactive bands were presented with infrared (IR) laser-based instrumentation (LI-COR, NC, USA) and quantified with ImageLab 4.0 (Bio-Rad, CA, USA). All western blot experiments were examined at least three times independently with the same trends.

Data Analysis

Data are expressed as mean±SEM. ANOVA or t-tests were performed, and the statistical analyses with p < 0.05 were considered statistically significant.

Results

Upregulation of Ca_v3 channels was associated with age-related hearing loss in C57 mice.

We first examined the auditory function in 2-month (2.1±0.2 months, n=6) and 9-month old (9.2±0.2 months, n=6) C57 and 2-month (2.1±0.1 month, n=5) and 9-month old (9.3±0.3, n=4) BALB/c mice. Figure 1A shows the representative ABR traces recorded from C57 and BALB/c mice at 2- and 9-month old, respectively. The 9-month C57-mice hearing thresholds were significantly elevated across all frequencies than 2-month mice (8-32 kHz) (Fig 1B, C). Meanwhile, there was no significant difference between 2- and 9-month old BALB/c mice (Fig 1B, C). We next examined the hearing ability in C57 mice at different age points ranging from 3 to 12 months old. The hearing thresholds started to increase as early as 6 months. They exceeded the upper limit of ABR at high-frequency at 12 months, suggesting that auditory function declined upon aging in C57 mice (Fig 1D, E). Thus, we used C57 mice as the AHL model.

Fig. 1.

Increased expression of Ca_v3 is associated with age-related hearing loss. A Representative ABR waveforms respond to click (90-20 dB) sound pressure level in C57 and BALB/c mice at young and old age. B, C ABR thresholds measurement for click (C) and pure tone stimulation (8-32kHz) (B) are shown from C57 and BALB/c mice at young and old age. Arrows show that the thresholds exceeded the Tucker Davis Technologies (TDT) ABR system. D, E Plots of ABR threshold values (D) and click values (E) in 3-, 6-, 9-, and 12-month old C57 mice. F Real-time PCR of Ca_v3.1, Ca_v3.2, and Ca_v3.3 in SGNs of C57 mice at different ages (3-, 6-, 9-, and 12-month) shows a significant increase in mRNA level with aging. **P<0.01 vs Young in B, C; *P < 0.05 vs 3-month, **P < 0.01 vs 3-month in D, E, F.

To verify the changes of Ca_v3 channels in the cochlea during aging, real-time PCR was used to quantify the mRNA expression of Ca_v3 channels in C57 mice at different ages from 3 to 12 months. As shown in Fig 1F, the expression of all three types of Ca_v3 channels increased from 6 months old in C57 mice and was age-dependent.

Ca_v3 channels were upregulated in SGNs of AHL mice.

Immunofluorescence analysis of the Ca_v3 subunit expression revealed that all three subtypes were present at the apical, middle, and basal SGNs from young and AHL mice (Fig 2A, C, E). Furthermore, Ca_v3.1 expression was increased in apical and basal SGNs in AHL mice. Ca_v3.2 expression was increased in all three cochlea regions in AHL mice (Fig 2B, D). However, there was no significant alteration in Ca_v3.3 expression in SGNs between young and AHL mice (Fig 2F). We confirmed that Ca_v3 was upregulated in AHL mice by recording the Ca_v3-mediated currents in SGNs from young and AHL mice, using the electrophysiologic method. The Ca_v3-mediated currents were induced by depolarizing steps from −90 to −40 mV in SGNs. There was a dramatic increase in Ca_v3 currents in SGNs of AHL mice (Fig 2I). Given that multiple types of calcium channels are present in SGNs, we also tested the alteration of HVA Ca²⁺ channels in SGNs from AHL mice. We found that HVA calcium channel currents were unchanged in SGNs between young and AHL mice (Fig 2G, H). These results suggested that Ca_v3.1 and Ca_v3.2 may contribute to Ca_v3 channel upregulation in SGNs of AHL mice.

Fig2.

Ca_v3 is upregulated in SGNs of AHL mice. A, C, E Ca_v3.1 (A), Ca_v3.2 (B), and Ca_v3.3 (C) are present in SGNs from young and AHL mice. B, D, F Quantification of Ca_v3.1 (B), Ca_v3.2 (D), and Ca_v3.3 (F) expression is shown in SGNs of young and AHL mice (Scale bar: 20 μm). G, H Whole-cell high-voltage activated calcium currents are recorded in apical (G) and basal (H) SGNs from young and AHL mice. Currents are elicited using depolarizing steps from −50 to 30 mV with 10-mV increments. Vh = −60 mV. The current-voltage curve is shown in the bottom panel. I represent a T-type calcium current in response to the depolarizing step from −90 mV to −40 mV in the upper panel. The currents amplitude shows a significant increase in SGNs from AHL mice.

Degeneration of SGNs associated with DNA damage and apoptosis in AHL mice

We evaluated SGN loss using histological analysis in AHL mice (Fig 3A–D). As shown in Figure 3D, the SGN density was decreased in the middle and basal areas of the cochlea in 9-month-old mice, suggesting that age-related impairment of hearing occurred in the middle-high frequency region.

Fig. 3.

Degeneration of SGNs is displayed in AHL mice. A-C Morphometry changes are observed in apical, middle, and basal SGNs from young and AHL mice. D SGNs are quantified at all three cochlea regions (Scale bar: 200 μm in A, B; 50 μm in C). E, F The expression of γH2AX in apical middle and basal SGNs from young (E) and AHL mice (F) is shown. SGNs are stained using anti-Tuj1, a neuron marker (green), and anti-γH2AX (red). The nucleus is stained with DAPI (blue). G Quantification of γH2AX in young and AHL mice SGNs. H Expression of AIF in SGNs from young and AHL mice. AIF is located in the cytoplasm of young SGNs and translocated to the nucleus of SGNs of AHL mice (white arrow). I The ratio of AIF translocated-positive SGNs shows a dramatic increase in AHL mice (Scale bar: 20 μm in E, F, H).

Immunofluorescence analysis showed increased expression of γH2AX, a biomarker of DNA damage, in SGNs in AHL mice (Fig 3E, F, G). These findings confirm that DNA damage of SGNs is involved in AHL. AIF is a flavored protein released from the mitochondria to the nucleus and interacts with γH2AX to induce chromatolysis and chromatin condensation. We found that the nuclear expression of AIF was observed in SGNs of AHL mice, and there was an increased translocation rate of AIF in SGNs from AHL mice compared to the control mice (Fig 3H, I). These results confirm that AIF-dependent apoptosis may play a critical role in SGN loss in AHL mice.

Expression of calpain-1 and calpain-2 in SGNs from young and AHL mice

Calpains are a family of calcium-dependent non-lysosomal cysteine proteases with two family members: calpain-1 and calpain-2. After activation by Ca²⁺, calpain regulates AIF release by cleaving the membrane-anchored AIF to the truncated form. Once liberated in the cytosol, truncated AIF translocates to the nucleus, where it induces caspase-independent apoptosis. To explore whether calpains are implicated in SGNs apoptosis in AHL. We examined the mRNA expression of calpain-1 and calpain-2 (Fig 4A). Real-time PCR results showed that calpain-2 was dramatically elevated in AHL mice at the mRNA level, whereas there was no significant difference in calpain-1 between young and AHL mice (Fig 4A). Western blotting was performed to confirm the upregulation of calpain-2 in AHL mice (Fig 4B). Immunofluorescence analysis revealed that calpain-1 and calpain-2 were present in the apical, middle, and basal SGNs from young and AHL mice. Quantification of fluorescence intensity supported that only calpain-2 was upregulated in SGNs of AHL mice (Fig 4D, F). These results suggest that calpain-2, not calpain-1, may participate in AHL.

Fig. 4.

Expression of calpain-1 and calpain-2 in SGNs from young and AHL mice. A. The expression of calpain-1 and calpain-2 at mRNA level is shown in the cochlea from young and AHL mice. B Western blotting result shows that calpain-2 expression is significantly increased in AHL mice cochlea. C, D The expression of calpain-1 in SGNs of apex, middle, and base was observed in AHL mice. Calpain-1 is stained with anti-calpain1 (red), and SGNs are labeled with Tuj1 (green). E, F The expression of calpain-2 is observed in the apex, middle, and base of SGNs from AHL mice (Scale bar: 20 μm).

Ca_v3 channels and calpain-2 contribute to AIF-induced SGNs apoptosis.

We investigated whether blocking Ca_v3 channels or calpain-2 can reduce AIF-translocation in SGNs. D-galactose was applied to cultured SGNs to establish a cell senescence model. As shown in Figure 5A, AIF was initially located in the cytoplasm in the control group and then translocated to the nucleus after treatment with D-galactose, suggesting that the AIF pathway was activated SGNs. Application of the Ca_v3 channel blocker Z944 (1 μM) or calpain-2 blocker ALLM (50 μM) for 48 h inhibited AIF translocation (Fig 5A, B). The upregulation of Ca_v3 channels induced an increase in cytoplasmic Ca²⁺ in SGNs from AHL mice. Elevated Ca²⁺ levels are required for activation of calpain-2. The activation of calpain-2 results in AIF releases to the cytosol, followed by AIF translocation to the nucleus in SGNs of AHL mice, which may contribute to the degeneration of SGNs in AHL mice (Fig 5C).

Fig. 5.

Ca_v3 channels and calpain-2 contribute to AIF-activation in SGNs. A AIF is present in the cytoplasm of cultured WT mice SGNs in the control group while translocated to the nucleus after D-galactose treatment. The application of the Ca_v3 channel blocker Z944 (1 μM) or the calpain-2 blocker ALLM (50 mM) for 48 h inhibit AIF translocation (white arrow) from the cytoplasm to the nucleus. AIF is stained with anti-AIF antibody (red), and nuclei are stained with DAPI (blue). SGNs are labeled with Tuj1 (green). B AIF translocation in SGNs is qualitatively assessed by measuring AIF’s ratio of translocated-positive SGNs to total SGNs in each group (Scale bar: 15 μm). C Schematic diagram for Ca_v3-calpain-2-AIF pathway involved in SGNs apoptosis.

Discussion

Our results provide new evidence that upregulation of Ca_v3 channels is involved in AHL. We found that Ca_v3 channels, specifically, Ca_v3.1 and Ca_v3.2, were increased in SGNs of AHL mice. The upregulated Ca_v3 channels may activate calpain-2 and subsequent AIF nuclear translocation in SGNs, suggesting that the age-dependent Ca_v3 channels may regulate apoptosis-related factors in SGNs to contribute to AHL. The C57BL/6 mouse strain, widely used for aging research, displays AHL’s classic pattern by 9-12 months of age, middle age in mice [20]. Unlike deafness caused by natural aging, C57BL/6 mice, resulting from mutations in the cdh23 gene, encoding a component of the tip link in hair-cell stereocilia, has been identified as a significant contributor to AHL [21, 22]. Therefore, C57 mice can be used as an animal model for the early onset of deafness. A long-held view has been that SGN loss may be a secondary consequence of hair cell loss in AHL because hair cells release neurotrophins, which may support SGNs survival [23, 24]. However, recent evidence demonstrates that degeneration of SGNs can occur independent of hair cell loss and may serve as one of the primary sites for AHL initiation [9, 25–27]. In the present study, we used C57BL/6 mice as the AHL mouse model. Compared with age-matched BALB/c mice, which did not demonstrate any hearing impairment, C57 mice at 12 months showed significantly elevated hearing thresholds across all frequencies. The hearing thresholds of C57 mice were elevated as early as 6 months and gradually increased at 9 and 12 months. A few studies have shown that Ca_v3 channel blockers’ improved hearing impairment in AHL mice such as NOD/LtJ and C57/B6 mice, suggesting that the Ca_v3 channel is involved in AHL [8, 9]. There is no evidence that Ca_v3 channels expressed in SGNs may play an essential role in age-dependent hearing impairment. Therefore, we focused on the alteration of Ca_v3 in SGNs between young and AHL mice. We identified all three subtypes of Ca_v3 channels, including Ca_v3.1, Ca_v3.2, and Ca_v3.3, and found that the levels were increased in the AHL’s mRNA level. However, only Ca_v3.1 and Ca_v3.2 at the protein level were significantly increased in SGNs of AHL mice, raising the possibility that upregulation of Ca_v3.1 and Ca_v3.2 channels constitutes one mechanism of age-dependent changes associated with AHL.

Additionally, we found a significant increase in Ca_v3 currents in AHL mice SGNs compared to those in young mice. Meanwhile, other HVA calcium channel currents were unchanged in SGNs between young and AHL mice. Although some studies have reported Ca_v3 channels were upregulated in AHL mice [8, 9], our results are the first to provide the functional data of Ca_v3 channels in young and AHL SGNs. Our study provides additional evidence to explore the mechanism of the Ca_v3 channel in upregulating SGN degeneration in AHL mice.

Apoptosis of SGNs is one of the leading causes of AHL [28–31]. Caspase-dependent and caspase-independent pathways have been reported in SGNs apoptosis in AHL [31, 32]. Our previous study has implied that AIF participates in age-related SGN apoptosis associated with the HCN channel [33]. Other studies have also shown that AIF contributes to glutamate-induced and peroxynitrite-induced SGN apoptosis [34, 35]. AIF is a flavored protein involved in mitochondrial respiration and induces caspase-independent apoptosis under injury conditions [36, 37]. It is released from the mitochondria to the nucleus, where it interacts with γH2AX and induces chromatin condensation and DNA fragmentation [38]. H2AX is a member of the histone H2A family, which is part of the nucleosome complex contributing to DNA packaging and genomic stability. Ser139-phosphorylated H2AX (γH2AX) is a sensitive marker for DNA damage [38, 39], which serves as a critical nuclear partner of AIF in programmed cell death. In the current study, we demonstrated that AIF was translocated into the nucleus of SGNs associated with increased γH2AX levels in AHL mice, confirming that AIF may mediate SGN death in AHL mice.

AIF can be cleaved by calpain, a calcium-activated neutral cysteine protease that is translocated to the nucleus and is implicated in caspase-independent apoptosis [40–42]. Thus, we speculate that the upregulation of Ca_v3 channels may increase cytoplasmic Ca²⁺ and subsequently activate calpain to cleave AIF. We applied the Ca_v3 channel, blocker Z944. We found that it could inhibit AIF’s nuclear translocation in SGNs, suggesting the Ca_v3 channel may contribute to AHL by regulating AIF activation. To further explore whether the Ca_v3 channel regulates AIF activation through calpain, we examined calpain alteration in young and AHL mice. The calpain family comprises a heterogeneous group of cysteine proteases, which have two prominent family members: calpain-1 and calpain-2 [43]. We observed that calpain-2 expression was enhanced in SGNs from AHL mice. Blocking calpain-2 with the specific blocker ALLM reduced AIF translocation in SGNs, suggesting that calpain-2 may contribute to AIF-induced SGNs apoptosis.

In conclusion, our data provide evidence that upregulation of Ca_v3 channels in SGNs is involved in AHL. Accordingly, upregulated Ca_v3 channels would increase calcium in the cytosol, which may activate calpain and contribute to AIF-activation in SGNs during AHL.

Highlight.

Ca_v3 channels were upregulated in SGNs of age-related hearing loss mice

Upregulation of Ca_v3 channels contributes to AIF-induced SGNs apoptosis.

Upregulation of Ca_v3 channels was associated with AHL in C57 mice.